ABCMdb

ABCG8 p.Tyr54Cys

Predicted by SNAP2:	A: D (91%), C: D (91%), D: D (95%), E: D (95%), F: D (75%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (91%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (91%), W: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: N, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Mutations in ATP-cassette binding proteins G5 (ABC... Hum Mutat. 2001 Oct;18(4):359-60. Hubacek JA, Berge KE, Cohen JC, Hobbs HH
Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia.
Hum Mutat. 2001 Oct;18(4):359-60., [PMID:11668628]

Abstract [show]
Sitosterolemia is an autosomal recessive disorder caused by mutations in two adjacent genes encoding coordinately regulated ATP binding cassette (ABC) half transporters (ABCG5 and ABCG8). In this paper we describe three novel mutations causing sitosterolemia: 1) a frameshift mutation (c.336-337insA) in ABCG5 that results in premature termination of the protein at amino acid 197; 2) a missense mutation that changes a conserved residue c.1311C>G; N437K) in ABCG5 and 3) a splice site mutation in ABCG8 (IVS1-2A>G). This study expands the spectrum of the ABCG5 and ABCG8 mutations that cause sitosterolemia. Nine nonsynonymous polymorphisms are also reported: I523V, C600Y, Q604E, and M622V in ABCG5; and D19H, Y54C, T400K, A632V, and Y641F in ABCG8.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Nine nonsynonymous polymorphisms are also reported: I523V, C600Y, Q604E, and M622V in ABCG5; and D19H, Y54C, T400K, A632V, and Y641F in ABCG8. Login to comment
36 Gene Exon NT change AA change Allele frequency RE ABCG5 ABCG8 ex. 11 ex. 13 ex. 13 ex. 13 ex. 1 ex. 2 ex. 8 ex. 13 ex. 13 c.1567 A>G c.1799 G>A c.1810 C>G c.1864 A>G c.52 G>C c.161 A>G c.1199 C>A c.1895 C>T c.1922 A>T I523V C600Y Q604E M622V D19H Y54C T400K A632V Y641F <1% <1% C=0.80/G=0.20 <1% G=0.94/C=0.06 A=0.61/G=0.39 C=0.80/A=0.20 C=0.83/T=0.17 A=0.99/T=0.01 XmnI TsrpI SexAI MseI NcoI MboII *The polymorphisms were found either in sitosterolemic probands or in genomic DNA from 24 individuals with high plasma cholesterol concentrations. Allele frequencies of the nonsynonymous sequence variants identified were determined in 50 unrelated Caucasians. Login to comment

[hide] Heritability of plasma noncholesterol sterols and ... J Lipid Res. 2002 Mar;43(3):486-94. Berge KE, von Bergmann K, Lutjohann D, Guerra R, Grundy SM, Hobbs HH, Cohen JC
Heritability of plasma noncholesterol sterols and relationship to DNA sequence polymorphism in ABCG5 and ABCG8.
J Lipid Res. 2002 Mar;43(3):486-94., [PMID:11893785]

Abstract [show]
The plasma concentrations of cholesterol precursor sterols and plant sterols vary over a 5- to 10-fold range among normolipidemic individuals, and provide indices of the relative rates of cholesterol synthesis and fractional absorption. In the present study, we examined the relative contributions of genetic and environmental factors to variation in the plasma concentrations and sterol-cholesterol ratios of five noncholesterol sterols, including the 5alpha-saturated derivative of cholesterol (cholestanol), two precursors in the cholesterol biosynthesis pathway (desmosterol and lathosterol), and two phytosterols (campesterol and sitosterol). Plasma sterol concentrations were highly stable in 30 individuals measured over a 48 week period. Regression of offspring sterol levels on the parental values indicated that plasma levels of all five noncholesterol sterols were highly heritable. Analysis of monozygotic and dizygotic twin pairs also indicated strong heritability of all five sterols. Two common sequence variations (D19H and T400K) in ABCG8, an ABC half-transporter defective in sitosterolemia, were associated with lower concentrations of plant sterols in parents, and in their offspring.Taken together, these findings indicate that variation in the plasma concentrations of noncholesterol sterols is highly heritable, and that polymorphism in ABCG8 contributes to genetic variation in the plasma concentrations of plant sterols.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 DЈ P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
126 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 D9 P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
128 Mean plasma sterol concentrations and sterol-cholesterol ratios in unrelated men and women with different ABCG5 and ABCG8 genotypes ABCG8 D19H ABCG8 Y54C ABCG8 T400K ABCG8 A632V ABCG5 Q604E DD n 5 128 DH/HH n 5 14 YY n 5 54 YC/CC n 5 85 TT n 5 95 TK/KK n 5 48 AA n 5 94 VA/VV n 5 49 QQ n 5 91 QE/EE n 5 51 Plasma sterol concentrations Cholesterol 202 6 41 194 6 33 199 6 39 203 6 40 197 6 38 207 6 42 195 6 38 b 213 6 40 198 6 40 204 6 40 Cholestanol 420 6 110 b 340 6 72 400 6 104 419 6 114 410 6 115 418 6 103 400 6 97 437 6 131 411 6 114 416 6 105 Desmosterol 200 6 70 196 6 79 195 6 66 202 6 74 1916 67 221 6 79 197 6 75 210 6 68 197 6 74 208 6 70 Lathosterol 308 6 135 365 6 252 308 6 120 320 6 168 296 6 136 354 6 171 309 6 165 329 6 116 314 6 154 322 6 145 Sitosterol 257 6 105 b 177 6 53 231 6 93 261 6 109 256 6 114 238 6 83 239 6 87 274 6 130 250 6 107 250 6 104 Campesterol 338 6 147 b 233 6 72 310 6 133 339 6 152 332 6 149 324 6 144 308 6 124 a 375 6 177 328 6 154 332 6 136 Plasma sterol-cholesterol ratios (mg/mg) Cholestanol 2.09 6 0.40 c 1.76 6 0.31 2.02 6 0.37 2.07 6 0.39 2.09 6 0.44 2.01 6 0.31 2.06 6 0.41 2.05 6 0.39 2.08 6 0.40 2.04 6 0.42 Desmosterol 0.99 6 0.26 1.00 6 0.32 0.97 6 0.25 0.99 6 0.28 0.96 6 0.25 a 1.06 6 0.30 1.00 6 0.29 0.98 6 0.23 0.98 6 0.27 1.02 6 0.27 Lathosterol 1.53 6 0.60 1.84 6 1.06 1.57 6 0.60 1.57 6 0.70 1.48 6 0.57 a 1.73 6 0.78 1.57 6 0.70 1.56 6 0.57 1.57 6 0.67 1.58 6 0.63 Sitosterol 1.28 6 0.45 c 0.94 6 0.32 1.18 6 0.45 1.29 6 0.45 1.30 6 0.48 a 1.15 6 0.35 1.24 6 0.42 1.29 6 0.51 1.27 6 0.44 1.23 6 0.48 Campesterol 1.67 6 0.62 c 1.21 6 0.36 1.56 6 0.59 1.66 6 0.63 1.68 6 0.62 1.54 6 0.60 1.58 6 0.59 1.74 6 0.65 1.64 6 0.63 1.61 6 0.59 Values are means 6 SD. Plasma cholesterol concentrations are in mg/dl. Login to comment

[hide] ATP binding cassette transporter G5 and G8 genotyp... J Lipid Res. 2004 Apr;45(4):653-6. Epub 2004 Jan 1. Kajinami K, Brousseau ME, Nartsupha C, Ordovas JM, Schaefer EJ
ATP binding cassette transporter G5 and G8 genotypes and plasma lipoprotein levels before and after treatment with atorvastatin.
J Lipid Res. 2004 Apr;45(4):653-6. Epub 2004 Jan 1., [PMID:14703505]

Abstract [show]
The mechanisms responsible for interindividual variation in response to statin therapy remain uncertain. It has been shown that hepatic cholesterol synthesis is associated with ATP binding cassette transporter G5 and G8 (ABCG5/8) activities. To test the hypothesis that genetic variation in ABCG5/8 might influence the plasma lipid response to statin therapy, we examined five nonsynonymous polymorphisms at the ABCG5/8 loci (Q604E, D19H, Y54C, T400K, and A632V) in 338 hypercholesterolemic patients treated with 10 mg atorvastatin. In carriers of the D19H variant, means of posttreatment values and adjusted percent reductions in LDL cholesterol (LDLC) were significantly lower (P = 0.028) and greater (P = 0.036) (112 mg/dl, 39.7%) than those of noncarriers (119 mg/dl, 36.2%), respectively, while no significant difference was observed in percent reductions in total cholesterol. Stepwise multiple regression analysis revealed significant and independent associations with absolute or percent reduction between D19H genotype and posttreatment LDL cholesterol levels. The other polymorphisms were not significantly associated with treatment effects. These results suggest that, in patients with hypercholesterolemia, the ABCG8 D19H variant is associated with greater LDLC-lowering response to atorvastatin therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 In the present study, five prevalent DNA polymorphisms, one in ABCG5 (Q604E) and four in ABCG8 (D19H, Y54C, T400K, and A632V), were studied using a PCR-restriction length polymorphism method. Login to comment
58 RESULTS Genotype, allele, haplotype frequencies, linkage disequilibrium Genotype distributions (wild-type allele homozygote, variant heterozygote, variant homozygote) in each polymorphism were as follows; Q604E (212, 112, 14), D19H (294, 43, 1), Y54C (138, 146, 54), T400K (196, 130, 12), and A632V (225, 96, 17). Login to comment
60 Allele frequencies (wild-type, variant) were Q604E (0.79, 0.21), D19H (0.93, 0.07), Y54C (0.62, 0.38), T400K (0.77, 0.23), and A632V (0.81, 0.19). Login to comment
63 Significant linkage disequilibrium was found in 5 out of 10 pairs of five polymorphisms: Q604E/D19H (D` ϭ 0.6503, P Ͻ 0.0001), Q604E/Y54C (-0.3461, 0.0244), D19H/Y54C (-0.9986, 0.0003), Y54C/T400K (-0.4957, 0.0003), and T400K/A632V (-0.5484, 0.0456). Login to comment
38 For the D19H polymorphism, a 131 bp fragment, including a G to C substitution site at codon 19 of the ABCG8 gene, was amplified using an oligonucleotide primer set (5Ј-GCTGGGTCTAAGAGAGCTGC-3Ј and 5Ј-CTTCCCATTGCT- CACTCACC-3Ј) with 35 cycles of amplification (95ЊC for 30 s, 60ЊC for 30 s, and 72ЊC for 30 s). Login to comment

[hide] ATP-binding cassette (ABC) transporters in human m... Physiol Res. 2004;53(3):235-43. Stefkova J, Poledne R, Hubacek JA
ATP-binding cassette (ABC) transporters in human metabolism and diseases.
Physiol Res. 2004;53(3):235-43., [PMID:15209530]

Abstract [show]
The ATP-binding cassette (ABC) superfamily of active transporters involves a large number of functionally diverse transmembrane proteins. They transport a variety of substrates including amino acids, lipids, inorganic ions, peptides, saccharides, metals, drugs, and proteins. The ABC transporters not only move a variety of substrates into and out of the cell, but also are also involved in intracellular compartmental transport. Energy derived from the hydrolysis of ATP is used to transport the substrate across the membrane against a concentration gradient. The typical ABC transporter consists of two transmembrane domains and two nucleotide-binding domains. Defects in 14 of these transporters cause 13 genetic diseases (cystic fibrosis, Stargardt disease, adrenoleukodystrophy, Tangier disease, etc.). Mutations in three genes affect lipid levels expressively. Mutations in ABCA1 cause severe HDL deficiency syndromes called Tangier disease and familial high-density lipoprotein deficiency, which are characterized by a severe deficiency or absence of high-density lipoprotein in the plasma. Two other ABCG transporters, ABCG5 and ABCG8, mutations of which cause sitosterolemia, have been identified. The affected individuals absorb and retain plant sterols, as well as shellfish sterols.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 The other two polymorphisms (Q604E) in ABCG5 and (Y54C) in ABCG8 were not associated with plasma lipid levels. Login to comment

[hide] Polymorphisms in ABCG5 and ABCG8 transporters and ... Physiol Res. 2004;53(4):395-401. Hubacek JA, Berge KE, Stefkova J, Pitha J, Skodova Z, Lanska V, Poledne R
Polymorphisms in ABCG5 and ABCG8 transporters and plasma cholesterol levels.
Physiol Res. 2004;53(4):395-401., [PMID:15311998]

Abstract [show]
ABCG5 and ABCG8 transporters play an important role in the absorption and excretion of sterols. Missence polymorphisms (Gln604Glu in the ABCG5 and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) in these genes have been described. In 131 males and 154 females whose dietary composition markedly changed and lipid parameters decreased over an 8-year follow-up study (total cholesterol decreased from 6.21+/-1.31 mmol/l in 1988 to 5.43+/-1.06 mmol/l in 1996), these polymorphisms were investigated using PCR. Plasma lipid levels and changes in plasma lipid levels were independent of the Gln604Glu polymorphism in ABCG5 and Asp19His and the Ala632Val polymorphisms in ABCG8. The Tyr54Cys polymorphism influenced the degree of reduction in total plasma cholesterol (delta -0.49 mmol/l in Tyr54 homozygotes vs. delta +0.12 mmol/l in Cys54 homozygotes, p<0.04) and LDL-cholesterol (delta -0.57 mmol/l in Tyr54 homozygotes vs. delta +0.04 mmol/l in Cys54 homozygotes, p<0.03) levels between 1988 and 1996 in females, but not in males. Male Thr400 homozygotes exhibited a greater decrease in total cholesterol (delta -0.90 mmol/l vs. delta -0.30 mmol/l, p<0.02) and LDL-cholesterol (delta -0.62 mmol/l vs. delta -0.19 mmol/l, p<0.04) than Lys400 carriers. No such association was observed in females. We conclude that Tyr54Cys and Thr400Lys variations in the ABCG8 gene may play a role in the genetic determination of plasma cholesterol levels and could possibly influence the gender-specific response of plasma cholesterol levels after dietary changes. These polymorphisms are of potential interest as genetic variants that may influence the lipid profile.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Missence polymorphisms (Gln604Glu in the ABCG5 and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) in these genes have been described. Login to comment
23 To evaluate the role of the ABCG5 and ABCG8 variants in the genetic determination of plasma lipids, we analyzed non-synonymous polymorphisms in the ABCG5 (C1810G = Gln604Glu) and ABCG8 (G55C = Asp19His, A161G = Tyr54Cys, C1199A = Thr400Lys and C1895T = Ala632Val) genes, and searched for associations between the polymorphisms and plasma lipid levels, and between the polymorphisms and plasma lipid changes over a 8 years´ follow-up. Login to comment
33 Polymorphism Primer sequence PCR product Enzyme Size Allele ABCG8 5`atggccgggaaggcggcagaggagag 83 bp BamH I 83 C (His) Asp19His 5`acttcccattgctcactcaccgagggat 56 + 27 G (Asp) ABCG8 5`agggcctccaggatagattgttctcctc 128 bp Bgl I 128 A (Tyr) Tyr54Cys 5`ccttgaacccaggcgtgcgcctacctg 102 + 26 G (Cys) ABCG8 5`agatgcctggggcggtgcagcagctt 108 bp Afl II 108 C (Thr) Thr400Lys 5`ggcttaatgtgatatacaaagacttggg 81 + 27 A (Lys) ABCG8 5`atgtctgtgtctccagatcctcaggg 105 bp Hae III 105 T (Val) Ala632Val 5`tacaggaccatgaagccaccgctgacgcc 79 + 26 C (Ala) ABCG5 5`aaccacacctgacactgtcaatcttttcct 117 bp Xho I 117 G (Glu) Gln604Glu 5`gggcaggttttctcaatgaattgaattcctc 86 + 31 C (Gln) DNA analysis Three ml of blood collected into EDTA tubes for DNA isolation were diluted with sterile water at a 1:1 ratio and stored at -20 °C. DNA was isolated by a standard method (Miller et al. 1988). Login to comment
58 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment
8 The Tyr54Cys polymorphism influenced the degree of reduction in total plasma cholesterol (∆ -0.49 mmol/l in Tyr54 homozygotes vs. ∆ +0.12 mmol/l in Cys54 homozygotes, p<0.04) and LDL-cholesterol (∆ -0.57 mmol/l in Tyr54 homozygotes vs. ∆ +0.04 mmol/l in Cys54 homozygotes, p<0.03) levels between 1988 and 1996 in females, but not in males. Login to comment
11 We conclude that Tyr54Cys and Thr400Lys variations in the ABCG8 gene may play a role in the genetic determination of plasma cholesterol levels and could possibly influence the gender-specific response of plasma cholesterol levels after dietary changes. Login to comment
61 Tyr54Cys polymorphism in ABCG8 in females, their plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 and the changes in T-C levels between 1988 and 1996. Login to comment
62 Tyr54Tyr Tyr54Cys Cys54Cys N 43 68 28 Years 1988 1996 1988 1996 1988 1996 T-C 6.0±1.0 5.5±1.1 5.8±1.1 5.5±1.1 5.6±1.1 5.7±1.3 LDL-C 3.7±1.0 3.2±1.0 3.6±0.9 3.3±1.0 3.4±1.0 3.4±1.0 ∆ T-C* -9.1 % -5.5 % +1.8 % ∆ LDL-C** -15.4 % -9.7 % +1.2 % Data are in mmol/l, means ± S.D., * p<0.04, ** p<0.03. Login to comment
63 The Tyr54Cys polymorphism was not associated with lipid levels in either 1988 or 1996 While no significant change in LDL-cholesterol (∆ +0.04 mmol/l, +1.2 %) was found in females homozygous for the Cys54 allele, a marked decrease was observed in Tyr/Tyr homozygotes (∆ -0.57 mmol/l, -15.4 %) with heterozygotes showing an intermediate decrease (∆ -0.35 mmol/l, -9.7 %) (p<0.03, Table 4). Login to comment
103 In this sample, variations in the ABCG8 gene loci (Tyr54Cys and Thr400Lys polymorphisms) were found to play a role in gender-specific reduction in plasma lipid levels as a response to reduced dietary animal fat and cholesterol intake. Login to comment
104 Our results suggest that the Tyr54Cys and Thr400Lys polymorphisms in ABCG8 might play a role in the genetic determination of plasma lipids in a gender-specific gene-nutrition manner. Login to comment
57 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment
60 Tyr54Cys polymorphism in ABCG8 in females, their plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 and the changes in T-C levels between 1988 and 1996. Login to comment
102 In this sample, variations in the ABCG8 gene loci (Tyr54Cys and Thr400Lys polymorphisms) were found to play a role in gender-specific reduction in plasma lipid levels as a response to reduced dietary animal fat and cholesterol intake. Login to comment

[hide] Plasma concentrations of plant sterols: physiology... Nutr Rev. 2006 Sep;64(9):385-402. Chan YM, Varady KA, Lin Y, Trautwein E, Mensink RP, Plat J, Jones PJ
Plasma concentrations of plant sterols: physiology and relationship with coronary heart disease.
Nutr Rev. 2006 Sep;64(9):385-402., [PMID:17002235]

Abstract [show]
Recently, it has been questioned whether elevated levels of circulating plant sterols increase the risk of coronary heart disease (CHD). To date, no definitive conclusions regarding such a relationship have been reached, nor have there been any studies summarizing the factors that contribute to the observed elevations in plant sterol concentrations in plasma. Thus, the purpose of this review is to systematically compare the plant sterol levels of subjects from the general population and to describe factors that contribute to the variations observed. The question of whether elevated plasma concentrations of plant sterols are associated with an increased risk of CHD was also assessed. Results indicate that the key factors accounting for variations in circulating plant sterol concentrations include: apolipoprotein E phenotypes, ATP-binding cassette transporter polymorphisms, use of statin drugs, presence of metabolic syndrome, dietary intake of plant sterols, gender, and analytical techniques used in the measurement of plant sterols in the plasma. An analysis of the studies examining the relationship between circulating levels of plant sterols and CHD risk in non-sitosterolemic populations revealed no clear associations. Furthermore, it was shown that the above-mentioned factors play an important role in determining the levels of plant sterols in plasma. Since these factors may act as potential confounders, they must be controlled for before more solid conclusions can be reached.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Aside from the rare mutation of a homozygous form resulting in sitosterolemia, several common sequence variations have been described.71 Different studies have shown independently that the cross-sectional plant sterol-to-cholesterol ratio is associated with different ABCG5 and ABCG8 polymorphisms.10,27,72 Out of the five polymorphisms analyzed in relation to concentrations of plant sterols, D19H, Y54C, T400K, A632V, and Q604E, the polymorphisms D19H in exon 1 and T400K in exon 8 of ABCG8 show the most pronounced association. Login to comment
72 Carriers of the H allele of the D19H polymorphism in ABCG8 were found to have a lower plasma campesterol-to-cholesterol ratio10,27 and sitosterol-to-cholesterol ratio,10 suggesting a higher activity of this variant. Login to comment

[hide] The effects of ABCG5/G8 polymorphisms on plasma HD... J Lipid Res. 2009 Mar;50(3):565-73. Epub 2008 Nov 12. Junyent M, Tucker KL, Smith CE, Garcia-Rios A, Mattei J, Lai CQ, Parnell LD, Ordovas JM
The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican Health Study.
J Lipid Res. 2009 Mar;50(3):565-73. Epub 2008 Nov 12., [PMID:19005228]

Abstract [show]
Low HDL-cholesterol (HDL-C) is associated with an increased risk for atherosclerosis, and concentrations are modulated by genetic factors and environmental factors such as smoking. Our objective was to assess whether the association of common single-nucleotide polymorphisms (SNPs) at ABCG5/G8 (i18429G>A, i7892T>C, Gln604GluC>G, 5U145A>C, Tyr54CysA>G, Asp19HisG>C, i14222A>G, and Thr400LysC>A) genes with HDL-C differs according to smoking habit. ABCG5/G8 SNPs were genotyped in 845 participants (243 men and 602 women). ABCG5/G8 (i7892T>C, 5U145A>C, Tyr54CysA>G, Thr400LysC>A) SNPs were significantly associated with HDL-C concentrations (P < 0.001-0.013) by which carriers of the minor alleles at the aforementioned polymorphisms and homozygotes for the Thr400 allele displayed lower HDL-C. A significant gene-smoking interaction was found, in which carriers of the minor alleles at ABCG5/G8 (Gln604GluC>G, Asp19HisG>C, i14222A>G) SNPs displayed lower concentrations of HDL-C only if they were smokers (P = 0.001-0.025). Also, for ABCG8_Thr400LysC>A SNP, smokers, but not nonsmokers, homozygous for the Thr400 allele displayed lower HDL-C (P = 0.004). Further analyses supported a significant haplotype global effect on lowering HDL-C (P = 0.002) among smokers. In conclusion, ABCG5/G8 genetic variants modulate HDL-C concentrations, leading to an HDL-C-lowering effect and thereby a potential increased risk for atherosclerosis only in smokers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Some of these studies reported significant associations between ABCG5/G8 SNPs (Gln604Glu, Thr400Lys, and Tyr54Cys) and total cholesterol and LDL-C, including 154 females undergoing weight loss (13), 112 subjects after consumption of plant stanol esters (14), and 263 mildly hypercholesterolemic patients (17). Login to comment
27 Some of these studies reported significant associations between ABCG5/G8 SNPs (Gln604Glu, Thr400Lys, and Tyr54Cys) and total cholesterol and LDL-C, including 154 females undergoing weight loss (13), 112 subjects after consumption of plant stanol esters (14), and 263 mildly hypercholesterolemic patients (17). Login to comment

[hide] ABCG5/G8 polymorphisms and markers of cholesterol ... J Lipid Res. 2010 Oct;51(10):3016-23. Epub 2010 Jun 25. Jakulj L, Vissers MN, Tanck MW, Hutten BA, Stellaard F, Kastelein JJ, Dallinga-Thie GM
ABCG5/G8 polymorphisms and markers of cholesterol metabolism: systematic review and meta-analysis.
J Lipid Res. 2010 Oct;51(10):3016-23. Epub 2010 Jun 25., [PMID:20581104]

Abstract [show]
Genetic variation at the ABCG5/G8 locus has been associated with markers of cholesterol homeostasis. As data originate from small-scale studies, we performed a meta-analysis to study these associations in a large dataset. We first investigated associations between five common ABCG5/G8 polymorphisms (p.Q604E, p.D19H, p.Y54C, p.T400K, and p.A632V) and plasma sterol levels in 245 hypercholesterolaemic individuals. No significant associations were found. Subsequently, our data were pooled into a meta-analysis that comprised 3,364 subjects from 16 studies (weighted mean age, 46.7 +/- 10.5 years; BMI, 23.9 +/- 3.5 kg/m(2)). Presence of the minor 632V allele correlated with reduced LDL-C concentrations (n = 367) compared with homozygosity for the 632A variant [n = 614; -0.11 mmol/l (95% CI, range: -0.20 to -0.02 mmol/l); P = 0.01]. The remaining polymorphisms were not associated with plasma lipid levels. Carriers of the 19H allele exhibited lower campesterol/TC (n = 83; P < 0.001), sitosterol/TC (P < 0.00001), and cholestanol/TC (P < 0.00001), and increased lathosterol/TC ratios (P = 0.001) compared with homozygous 19D allele carriers (n = 591). The ABCG8 632V variant was associated with a clinically irrelevant LDL-C reduction, whereas the 19H allele correlated with decreased cholesterol absorption and increased synthesis without affecting the lipid profile. Hence, associations between frequently studied missense ABCG5/G8 polymorphisms and markers of cholesterol homeostasis are modest at best.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (␮g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 ± 0.76 4.05 ± 0.61 1.54 ± 0.40 1.09 [0.29-3.56] 1.45 ± 0.64 1.12 ± 0.53 1.49 ± 0.33 1.24 ± 0.49 QE/EE 72 6.23 ± 0.73 4.11 ± 0.63 1.49 ± 0.36 1.19 [0.47-3.93] 1.47 ± 0.88 1.16 ± 0.63 1.46 ± 0.38 1.28 ± 0.57 D19H DD 219 6.19 ± 0.75 4.08 ± 0.61 1.52 ± 0.40 1.10 [0.29-3.93] 1.49 ± 0.69 1.16 ± 0.55 1.49 ± 0.34 1.24 ± 0.49 DH/HH 24 6.04 ± 0.81 3.90 ± 0.63 1.60 ± 0.38 1.15 [0.47-1.97] 1.24 ± 0.82 0.92 ± 0.53 1.38 ± 0.34 1.35 ± 0.64 Y54C YY 73 6.32 ± 0.73 4.14 ± 0.64 1.58 ± 0.37 1.09 [0.45-3.93] 1.59 ± 0.76 1.22 ± 0.60 1.53 ± 0.33 1.24 ± 0.53 YC/CC 171 6.12 ± 0.76 4.03 ± 0.61 1.51 ± 0.41 1.11 [0.29-3.56] 1.41 ± 0.68 1.09 ± 0.53 1.46 ± 0.34 1.26 ± 0.50 T400K TT 183 6.16 ± 0.75 4.03 ± 0.60 1.55 ± 0.40 1.10 [0.29-3.93] 1.48 ± 0.69 1.14 ± 0.55 1.49 ± 0.35 1.25 ± 0.48 TK/KK 61 6.24 ± 0.76 4.19 ± 0.66 1.47 ± 0.37 1.14 [0.47-2.61] 1.38 ± 0.76 1.09 ± 0.59 1.45 ± 0.31 1.27 ± 0.59 A632V AA 139 6.22 ± 0.72 4.12 ± 0.60 1.51 ± 0.37 1.12 [0.33-2.90] 1.49 ± 0.72 1.16 ± 0.58 1.51 ± 0.37 1.21 ± 0.49 AV/VV 105 6.14 ± 0.79 3.99 ± 0.63 1.57 ± 0.43 1.07 [0.29-3.93] 1.42 ± 0.70 1.09 ± 0.52 1.44 ± 0.30 1.31 ± 0.52 Values shown are means ± SD. Triglycerides are shown as median [range]. Login to comment
145 TABLE3.Characteristicsofstudiesincludedinthemeta-analysis Reference Number of SubjectsAge Male/ Female BodyMass IndexEthnicitySingleNucleotidePolymorphismsLipidsNon-CholesterolSterols nyearsnkg/m 2 Berge,2002(5)14855±1174/74NotreportedCaucasianD19H,T400K,Y54C,Q604E,A632VTCCAMP,SITO,CHOLST,LATHO Weggemans,2002(7)48626.3±11.6257/22921.7±3.0CaucasianQ604ETC- Gylling,2004(13)26253.1±8.1143/11926.4±6.5CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Plat,2005(11)a 11233±1641/7122.9±3.6CaucasianT400K,Q604E,A632VLDL-C,HDL-C,TGCAMP,SITO,LATHO Acalovschi,2006(27)72 e 56.3(36-80)30/4230.1±4.9CaucasianD19H,T400K,Y54C,Q604E,A632VTC,HDL-C,TG- Jakulj,etal. b 24558.4±7.5189/4825.8±3.0CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Miwa,2005(28)10062.4±12.148/5223.0±3.5AsianT400K,Y54C,Q604E-SITO,LATHO Wang,2007(29) a,c 13454.1±8.1134/023.2±2.3AsianT400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chen,2008(8) a 104647.0±9.3894/15224.9±2.4AsianD19H,T400K,Y54C,Q604E i TC,LDL-C,HDL-C,TG- Caamano,2008(30) d 10440±1058/4625.5±3.3HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- 11844±771/4727.6±4.9HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- Santosa,2007(31) a 3549.4±6.70/3531.4±2.8Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Rudkowska,2008(32)2659.6±9.615/1126.4±2.7Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chan,2004(33) a 4754.5±8.447/032±3.6Notreported g D19H,T400KTC,LDL-C,HDL-C,TGCAMP,SITO,LATHO Kajinami,2004(12) a 33858±11203/13527.0±3.0Notreported h D19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TG- Herron,2006(9) a 9131.1±9.240/5124.8±4.7Notreported h Q604ETC,LDL-C,HDL-C- Total(WM)336446.7±10.52251/111323.9±3.5 Numberandcharacteristicsofstudiesincludedinthemeta-analysis.CAMP,campesterol/TCratio;CHOLST,cholestanol/TCratio;HDL-C,HDL-cholesterol;LATHO,lathosterol/TCratio;LDL-C, LDL-cholesterol;SITO,sitosterol/TCratio;TC,totalcholesterol;TG,triglyceride;WM,weightedmean. Login to comment
12 We first investigated associations between five common ABCG5/G8 polymorphisms (p.Q604E, p.D19H, p.Y54C, p. T400K, and p.A632V) and plasma sterol levels in 245 hypercholesterolaemic individuals. Login to comment
68 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
125 However, in silico analysis by polyphen predicts p.D19H as a benign variant, and no relation was found between this SNP and ABCG8 mRNA expression levels in human liver tissue samples (38). Login to comment
126 Of note, in silico analyses of the remaining four variants predicted only the p.Y54C polymorphism to be damaging. Login to comment
66 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
124 Of note, in silico analyses of the remaining four variants predicted only the p.Y54C polymorphism to be damaging. Login to comment
139 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment
144 Characteristics of studies included in the meta-analysis Reference Number of Subjects Age Male/ Female Body Mass Index Ethnicity Single Nucleotide Polymorphisms Lipids Non-Cholesterol Sterols n years n kg/m 2 Berge, 2002 (5) 148 55 &#b1; 11 74/74 Not reported Caucasian D19H, T400K, Y54C, Q604E, A632V TC CAMP, SITO, CHOLST, LATHO Weggemans, 2002 (7) 486 26.3 &#b1; 11.6 257/229 21.7 &#b1; 3.0 Caucasian Q604E TC - Gylling, 2004 (13) 262 53.1 &#b1; 8.1 143/119 26.4 &#b1; 6.5 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Plat, 2005 (11) a 112 33 &#b1; 16 41/71 22.9 &#b1; 3.6 Caucasian T400K, Q604E, A632V LDL-C, HDL-C, TG CAMP, SITO, LATHO Acalovschi, 2006 (27) 72 e 56.3 (36-80) 30/42 30.1 &#b1; 4.9 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, HDL-C, TG - Jakulj, et al. b 245 58.4 &#b1; 7.5 189/48 25.8 &#b1; 3.0 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Miwa, 2005 (28) 100 62.4 &#b1; 12.1 48/52 23.0 &#b1; 3.5 Asian T400K, Y54C, Q604E - SITO, LATHO Wang, 2007 (29) a , c 134 54.1 &#b1; 8.1 134/0 23.2 &#b1; 2.3 Asian T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chen, 2008 (8) a 1046 47.0 &#b1; 9.3 894/152 24.9 &#b1; 2.4 Asian D19H, T400K, Y54C, Q604E i TC, LDL-C, HDL-C, TG - Caamano, 2008 (30) d 104 40 &#b1; 10 58/46 25.5 &#b1; 3.3 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - 118 44 &#b1; 7 71/47 27.6 &#b1; 4.9 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - Santosa, 2007 (31) a 35 49.4 &#b1; 6.7 0/35 31.4 &#b1; 2.8 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Rudkowska, 2008 (32) 26 59.6 &#b1; 9.6 15/11 26.4 &#b1; 2.7 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chan, 2004 (33) a 47 54.5 &#b1; 8.4 47/0 32 &#b1; 3.6 Not reported g D19H, T400K TC, LDL-C, HDL-C, TG CAMP, SITO, LATHO Kajinami, 2004 (12) a 338 58 &#b1; 11 203/135 27.0 &#b1; 3.0 Not reported h D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG - Herron, 2006 (9) a 91 31.1 &#b1; 9.2 40/51 24.8 &#b1; 4.7 Not reported h Q604E TC, LDL-C, HDL-C - Total (WM) 3364 46.7 &#b1; 10.5 2251/ 1113 23.9 &#b1; 3.5 Number and characteristics of studies included in the meta-analysis. Login to comment
67 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
140 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment

[hide] ABCG8 D19H polymorphism: a basis for the genetic p... J Gastroenterol Hepatol. 2010 Nov;25(11):1713-4. doi: 10.1111/j.1440-1746.2010.06484.x. Yoon JH, Kuver R, Choi HS
ABCG8 D19H polymorphism: a basis for the genetic prediction of cholesterol gallstone disease.
J Gastroenterol Hepatol. 2010 Nov;25(11):1713-4. doi: 10.1111/j.1440-1746.2010.06484.x., [PMID:21039829]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Wang et al.11 examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H,Y54C, T400K, A632V) genes in 287 patients with gallstone disease. Login to comment

[hide] Interactions between CYP7A1 A-204C and ABCG8 C1199... J Clin Pharm Ther. 2010 Dec 3. doi: 10.1111/j.1365-2710.2010.01227.x. Wei KK, Zhang LR, Zhang Y, Hu XJ
Interactions between CYP7A1 A-204C and ABCG8 C1199A polymorphisms on lipid lowering with atorvastatin.
J Clin Pharm Ther. 2010 Dec 3. doi: 10.1111/j.1365-2710.2010.01227.x., 2010-12-03 [PMID:21128988]

Abstract [show]
What is known and Objective: Cholesterol excretion by ATP binding cassette transporters G5 and G8 (ABCG5/G8) and bile acid biosynthesis by 7a-hydroxylase (CYP7A1) are major pathways for the removal of cholesterol into bile. This suggests that variations in the CYP7A1 and ABCG8 genes may influence the statin response. We aimed to investigate the effect of CYP7A1 A-204C and ABCG8 C1199A polymorphisms and their interactions on the lipid-lowering response to atorvastatin in a Chinese population. Methods: Genotypes were determined by using polymerase chain reaction-restrict fragment length polymorphism (PCR-RFLP) in 185 hyperlipidaemic patients treated with atorvastatin, 20 mg once daily for 4 weeks. Serum levels of triglycerides (TGs), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were determined before and after treatment. Results and Discussion: For 181 patients (89 males), variant allele frequencies of CYP7A1 -204C and ABCG8 1199A were 0.347 and 0.128, respectively. Among all patients, homozygotes for the -204A allele showed a slightly significant mean percentage reduction from baseline in TG level after treatment than heterozygotes and homozygotes for the -204C allele (-25.49 +/- 8.12%vs. -22.80 +/- 8.72%, P = 0.054, and -25.49 +/- 8.12%vs.-22.51 +/- 8.82%, P = 0.048, respectively). For patients with the ABCG8 C1199A variant allele, the difference in percentage reduction from baseline in TG level was increased between the CYP7A1 A-204C wild-type allele homozygotes and variant allele homozygotes after atorvastatin treatment (-28.35%vs.-19.28%, P = 0.001), and increased differences were found between the CYP7A1 A-204C wild-allele homozygotes and variant allele homozygotes (-18.95%vs.-15.61%, P = 0.009) and between the CYP7A1 A-204C variant allele heterozygotes and homozygotes (-18.69%vs.-15.61%, P = 0.012, respectively). What is new and Conclusion: The CYP7A1 -204A and ABCG8 1199A alleles appear to interact to affect lipid-lowering response to atorvastatin. However, given the relatively small number of subjects with the influential variant allele combinations, and the heterogeneity in response, even in the selected sub-populations, testing would be of little clinical utility in the Chinese population sampled.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Several previous studies have found that 5 nonsynonymous single-nucleotide polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may affect plasma plant sterol or cholesterol levels (16-19). Login to comment
29 Allele frequencies of 19H and 632V were found to be rare in a Chinese population (20), and the Y54C and T400K alleles showed strong linkage disequilibrium. Login to comment

[hide] Phytosterols and phytosterolemia: gene-diet intera... Genes Nutr. 2011 Feb;6(1):17-26. Epub 2010 Aug 28. Izar MC, Tegani DM, Kasmas SH, Fonseca FA
Phytosterols and phytosterolemia: gene-diet interactions.
Genes Nutr. 2011 Feb;6(1):17-26. Epub 2010 Aug 28., [PMID:21437027]

Abstract [show]
Phytosterol intake is recommended as an adjunctive therapy for hypercholesterolemia, and plant sterols/stanols can reduce cholesterol absorption at the intestinal lumen through the Niemann-Pick C1 Like 1 (NPC1L1) transporter pathway by competitive solubilization in mixed micelles. Phytosterol absorption is of less magnitude than cholesterol and is preferably secreted in the intestinal lumen by ABCG5/G8 transporters. Therefore, plasma levels of plant sterols/stanols are negligible compared with cholesterol, under an ordinary diet. The mechanisms of cholesterol and plant sterols absorption and the whole-body pool of sterols are discussed in this chapter. There is controversy about treatment with statins inducing further increase in plasma non-cholesterol sterols raising concerns about the safety of supplementation of plant sterols to such drugs. In addition, increase in plant sterols has also been reported upon consumption of plant sterol-enriched foods, regardless of other treatments. Rare mutations on ABCG5/G8 transporters affecting cholesterol/non-cholesterol extrusion, causing sitosterolemia with xanthomas and premature atheroslerotic disease are now known, and cholesterol/plant sterols absorption inhibitor, ezetimibe, emerges as the drug that reduces phytosterolemia and promotes xanthoma regression. On the other hand, common polymorphisms affecting the NPC1L1 transporter can interfere with the action of ezetimibe. Gene-diet interactions participate in this intricate network modulating the expression of genetic variants on specific phenotypes and can also affect the individual response to the hypolipidemic treatment. These very interesting aspects promoted a great deal of research in the field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment
129 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment

[hide] Intestinal cholesterol transport proteins: an upda... Curr Opin Lipidol. 2007 Jun;18(3):310-8. Levy E, Spahis S, Sinnett D, Peretti N, Maupas-Schwalm F, Delvin E, Lambert M, Lavoie MA
Intestinal cholesterol transport proteins: an update and beyond.
Curr Opin Lipidol. 2007 Jun;18(3):310-8., [PMID:17495606]

Abstract [show]
PURPOSE OF REVIEW: Various studies have delineated the causal role of dietary cholesterol in atherogenesis. Strategies have thus been developed to minimize cholesterol absorption, and cholesterol transport proteins found at the apical membrane of enterocytes have been extensively investigated. This review focuses on recent progress related to various brush-border proteins that are potentially involved in alimentary cholesterol transport. RECENT FINDINGS: Molecular mechanisms responsible for dietary cholesterol and plant sterol uptake have not been completely defined. Growing evidence, however, supports the concept that several proteins are involved in mediating intestinal cholesterol transport, including SR-BI, NPC1L1, CD36, aminopeptidase N, P-glycoprotein, and the caveolin-1/annexin-2 heterocomplex. Other ABC family members (ABCA1 and ABCG5/ABCG8) act as efflux pumps favoring cholesterol export out of absorptive cells into the lumen or basolateral compartment. Several of these cholesterol carriers influence intracellular cholesterol homeostasis and are controlled by transcription factors, including RXR, LXR, SREBP-2 and PPARalpha. The lack of responsiveness of NPC1L1-deficient mice to ezetimibe suggests that NPC1L1 is likely to be the principal target of this cholesterol-lowering drug. SUMMARY: The understanding of the role, genetic regulation and coordinated function of proteins mediating intestinal cholesterol transport may lead to novel ways of treating cardiovascular disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 On the other hand, patients with primary hypercholesterolemia, according to NCEP,were associated with a specific ABCB1 haplotype, suggesting this polymorphism may contribute to increased plasma cholesterol and LDL levels [42].ABCG8(A632V,T400K,Y54C)andABCG5(Q604E) variants, however, are likely to be important forthe genetic determination of plasma cholesterol levels, probably via their influence on intestinal absorption and biliary secretion [43-45]. Login to comment

[hide] Increased gallstone risk in humans conferred by co... Hepatology. 2007 Sep;46(3):793-801. Grunhage F, Acalovschi M, Tirziu S, Walier M, Wienker TF, Ciocan A, Mosteanu O, Sauerbruch T, Lammert F
Increased gallstone risk in humans conferred by common variant of hepatic ATP-binding cassette transporter for cholesterol.
Hepatology. 2007 Sep;46(3):793-801., [PMID:17626266]

Abstract [show]
Genomewide scans of inbred strains of mice have linked the genes encoding the hepatocanalicular cholesterol transporter ABCG5/G8 to gallstone formation. Five nonsynonymous coding single-nucleotide polymorphisms (SNPs) in the orthologous human genes are associated with differences in serum cholesterol and plant sterol levels. We now tested these ABCG5/G8 SNPs for linkage and association with gallstone susceptibility in humans. Prospectively, we collected data from 178 white individuals with gallbladder stones or history of cholecystectomy in 84 families and from 70 stone-free controls, as confirmed by abdominal ultrasound. We performed nonparametric linkage (NPL) analysis of affected sib pairs (ASPs) and association tests of cases and controls. In ASPs, gallstones were strongly linked to the D19H variant of the ABCG8 gene (NPL score = 7.1; P = 4.6 x 10(-13)). The risk of gallstones in carriers of the 19H allele was significantly increased in randomly selected cases from the ASP cohort compared to the stone-free controls (OR = 3.018; P = 0.017). Consistent with the mouse model, heterozygosity for the lithogenic ABCG8 allele was associated with gallstones in humans; 21.4% of gallstone patients carried the heterozygous D19H genotype, compared with 8.6% of controls (OR = 2.954; P = 0.026). CONCLUSION: The linkage and association studies identified the cholesterol transporter ABCG5/G8 as a genetic determinant of gallstone formation, or LITH gene, in humans. The function of this transporter and the results of the genetic study taken together indicate that in gallstone-susceptible carriers of the ABCG8 19H allele, cholesterol cholelithiasis is secondary to increased hepatobiliary cholesterol secretion.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 In contrast to ABCG8 D19H, no significant single-point linkage was detected for the other ABCG5/G8 SNPs (p.E604Q, p.Y54C, p.T400K, p.A632V). Login to comment
52 Forgenotyping,weselectedfunctionallyrelevantnonsyn- onymous coding single-nucleotide polymorphisms (SNPs) of the ABCG5/G8 genes (Fig. 1): ABCG5 rs6720173 ϭ c.1810GϾC(p.E604Q);ABCG8rs11887534ϭc.55GϾC (p.D19H), rs4148211 ϭ c.161AϾG (p.Y54C), rs4148217 ϭ c.1199CϾA (p.T400K), and rs6544718 ϭ c.1895CϾT (p.A632V).22,23,25,28,29 All SNPs were genotyped using solution-phase hybridization reactions with 5Ј-nuclease and fluorescence detection (TaqMan assays) in a 7300 Real-Time polymerase chain reaction (PCR) system (Applera, Norwalk, CT). Login to comment

[hide] A genome-wide association scan identifies the hepa... Nat Genet. 2007 Aug;39(8):995-9. Epub 2007 Jul 15. Buch S, Schafmayer C, Volzke H, Becker C, Franke A, von Eller-Eberstein H, Kluck C, Bassmann I, Brosch M, Lammert F, Miquel JF, Nervi F, Wittig M, Rosskopf D, Timm B, Holl C, Seeger M, ElSharawy A, Lu T, Egberts J, Fandrich F, Folsch UR, Krawczak M, Schreiber S, Nurnberg P, Tepel J, Hampe J
A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease.
Nat Genet. 2007 Aug;39(8):995-9. Epub 2007 Jul 15., [PMID:17632509]

Abstract [show]
With an overall prevalence of 10-20%, gallstone disease (cholelithiasis) represents one of the most frequent and economically relevant health problems of industrialized countries. We performed an association scan of >500,000 SNPs in 280 individuals with gallstones and 360 controls. A follow-up study of the 235 most significant SNPs in 1,105 affected individuals and 873 controls replicated the disease association of SNP A-1791411 in ABCG8 (allelic P value P(CCA) = 4.1 x 10(-9)), which was subsequently attributed to coding variant rs11887534 (D19H). Additional replication was achieved in 728 German (P = 2.8 x 10(-7)) and 167 Chilean subjects (P = 0.02). The overall odds ratio for D19H carriership was 2.2 (95% confidence interval: 1.8-2.6, P = 1.4 x 10(-14)) in the full German sample. Association was stronger in subjects with cholesterol gallstones (odds ratio = 3.3), suggesting that His19 might be associated with a more efficient transport of cholesterol into the bile.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
148 Table 3 Haplotype analysis of seven SNPs at the ABCG8 locus in panels B and C Fine mapping, panel B Fine mapping, panel C Haplotype fcases fcontrols ORcase-control PCOCAPHASE fcases fcontrols ORcase-control PCOCAPHASE C-G-A-T-G-T-C 0.340 0.382 0.8 0.01 0.349 0.392 0.8 0.02 T-G-G-T-G-T-G 0.342 0.325 1.1 0.24 0.340 0.325 1.1 0.38 C-G-G-T-G-T-G 0.066 0.071 0.9 0.53 0.077 0.069 1.1 0.42 C-G-A-T-G-T-G 0.067 0.068 1.0 0.89 0.060 0.068 0.9 0.33 C-C-A-C-A-T-C 0.097 0.045 2.3 7.75 Â 10-7 0.080 0.038 2.2 8.76 Â 10-7 C-G-A-T-G-A-C 0.023 0.043 0.5 5.73 Â 10-4 0.028 0.042 0.7 0.03 T-G-A-T-G-A-C 0.025 0.033 0.8 0.12 0.020 0.033 0.6 0.03 T-G-A-T-G-A-C 0.028 0.024 1.2 0.53 0.036 0.028 1.3 0.305 SNPs included in the haplotype analysis (rs4148187, rs11887534 (D19H), rs4148211 (Y54C), SNP_A-1791411, rs4953023, rs17424122 and rs17409589) are marked by an asterisk in Figure 1. Login to comment

[hide] Association of selected ABC gene family single nuc... Atherosclerosis. 2010 Jul;211(1):203-9. Epub 2010 Jan 29. Abellan R, Mansego ML, Martinez-Hervas S, Martin-Escudero JC, Carmena R, Real JT, Redon J, Castrodeza-Sanz JJ, Chaves FJ
Association of selected ABC gene family single nucleotide polymorphisms with postprandial lipoproteins: results from the population-based Hortega study.
Atherosclerosis. 2010 Jul;211(1):203-9. Epub 2010 Jan 29., [PMID:20170916]

Abstract [show]
The aim of the study was to determine the influence of twenty single nucleotide polymorphisms (SNPs) of the ABCA1, ABCG1, ABCG5 and ABCG8 genes on the plasmatic concentrations of total cholesterol (TC), HDL and LDL cholesterol (HDLc, LDLc) in the postprandial state with a representative Spanish Caucasian population (1473 individuals, 50.0% women, ages ranging 21-85 years). In men, subjects with the AA genotype of the ABCA1 rs2230806 (R219K) polymorphism were associated with increased plasma LDLc levels, while the ABCA1 haplotype, which included the rs2230806 A allele, was associated with higher TC and LDLc plasma concentrations. In women, significant relationships were found between rs1893590 polymorphisms (ABCG1 gene) and HDLc plasma concentrations (subjects with the AA genotype had lower HDLc levels). For the ABCG8 gene, the rs4148211 polymorphism was associated with higher plasma TC and LDLc concentrations in the total population. Moreover, an ABCG5-G8 haplotype, which included the rs6544718 T allele, was associated with higher HDLc plasma concentrations in women. In conclusion, different SNPs of the ABCA1, ABCG1 and ABCG5-ABCG8 genes were associated, some under gender-specific analysis, with variations in the plasma lipid levels under postprandial conditions in a representative Spanish population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
144 For the studied polymorphisms of the ABCG5 and ABCG8 genes, only rs4148211 (ABCG8 Y54C) obtained significant associations with the TC and LDLc plasma levels in the total population, even after adjusting for total caloric intake or lipid consumption. Login to comment
149 Regarding the Y54H polymorphism, diverging results have been observed in previous studies for associations with lipid levels [13,14,16,18,19]; these divergences in the results could be related with the degree of the reduction of total plasma cholesterol and LDLc with dietary changes [13]. Login to comment
150 In spite of the feed status, which makes comparisons between studies on lipid levels more difficult, to our knowledge, no variations in LDLc levels directly related with the Y54C polymorphism have been observed. Login to comment
151 However, Wang et al. [17] found higher but not significant plasma LDLc levels for carriers of the less frequent K allele of ABCG8 T400K, which was in strong linkage disequilibrium with the SNP Y54C of ABCG8. Login to comment
142 For the studied polymorphisms of the ABCG5 and ABCG8 genes, only rs4148211 (ABCG8 Y54C) obtained significant associations with the TC and LDLc plasma levels in the total population, even after adjusting for total caloric intake or lipid consumption. Login to comment
148 In spite of the feed status, which makes comparisons between studies on lipid levels more difficult, to our knowledge, no variations in LDLc levels directly related with the Y54C polymorphism have been observed. Login to comment

[hide] Phytosterol and cholesterol precursor levels indic... Hepatology. 2012 May;55(5):1507-17. doi: 10.1002/hep.25563. Epub 2012 Apr 4. Krawczyk M, Lutjohann D, Schirin-Sokhan R, Villarroel L, Nervi F, Pimentel F, Lammert F, Miquel JF
Phytosterol and cholesterol precursor levels indicate increased cholesterol excretion and biosynthesis in gallstone disease.
Hepatology. 2012 May;55(5):1507-17. doi: 10.1002/hep.25563. Epub 2012 Apr 4., [PMID:22213168]

Abstract [show]
In hepatocytes and enterocytes sterol uptake and secretion is mediated by Niemann-Pick C1-like 1 (NPC1L1) and ATP-binding cassette (ABC)G5/8 proteins, respectively. Whereas serum levels of phytosterols represent surrogate markers for intestinal cholesterol absorption, cholesterol precursors reflect cholesterol biosynthesis. Here we compare serum and biliary sterol levels in ethnically different populations of patients with gallstone disease (GSD) and stone-free controls to identify differences in cholesterol transport and synthesis between these groups. In this case-control study four cohorts were analyzed: 112 German patients with GSD and 152 controls; two distinct Chilean ethnic groups: Hispanics (100 GSD, 100 controls), and Amerindians (20 GSD, 20 controls); additionally an 8-year follow-up of 70 Hispanics was performed. Serum sterols were measured by gas chromatography / mass spectrometry. Gallbladder bile sterol levels were analyzed in cholesterol GSD and controls. Common ABCG5/8 variants were genotyped. Comparison of serum sterols showed lower levels of phytosterols and higher levels of cholesterol precursors in GSD patients than in controls. The ratios of phytosterols to cholesterol precursors were lower in GSD patients, whereas biliary phytosterol and cholesterol concentrations were elevated as compared with controls. In the follow-up study, serum phytosterol levels were significantly lower even before GSD was detectable by ultrasound. An ethnic gradient in the ratios of phytosterols to cholesterol precursors was apparent (Germans > Hispanics > Amerindians). ABCG5/8 variants did not fully explain the sterol metabolic trait of GSD in any of the cohorts. CONCLUSION: Individuals predisposed to GSD display increased biliary output of cholesterol in the setting of relatively low intestinal cholesterol absorption, indicating enhanced whole-body sterol clearance. This metabolic trait precedes gallstone formation and is a feature of ethnic groups at higher risk of cholesterol GSD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 p.Y54C (rs4148211, c__29535502_10), p.T400K (rs4148217, c__375061_10), and p.A632V (rs6544718, c__25642779_10) variants, as described in Supporting Methods. Login to comment
104 Interestingly, the p.Y54C variant is associated with phytosterol levels in the Chilean but not the German cohort (Supporting Table 4A). Login to comment

[hide] ATP-binding cassette transporter G5 and G8 polymor... PLoS One. 2012;7(5):e37972. Epub 2012 May 24. Li Q, Yin RX, Wei XL, Yan TT, Aung LH, Wu DF, Wu JZ, Lin WX, Liu CW, Pan SL
ATP-binding cassette transporter G5 and G8 polymorphisms and several environmental factors with serum lipid levels.
PLoS One. 2012;7(5):e37972. Epub 2012 May 24., [PMID:22655090]

Abstract [show]
BACKGROUND: The association of ATP-binding cassette (ABC) transporter single nucleotide polymorphisms (SNPs) and serum lipid profiles is inconsistent. The present study was undertaken to detect the association of ABCG5/G8 SNPs and several environmental factors with serum lipid levels. METHODOLOGY/PRINCIPAL FINDINGS: Genotyping of the ABCG5 (rs4131229 and rs6720173) and ABCG8 (rs3806471 and rs4148211) SNPs was performed in 719 unrelated subjects of Mulao nationality and 782 participants of Han nationality. There were no differences in the genotypic and allelic frequencies of four SNPs between the two ethnic groups besides the genotypic frequencies of rs4131229 SNP in Han. The levels of triglyceride (TG), apolipoprotein (Apo) A1, and ApoA1/ApoB ratio (rs4131229); low-density lipoprotein cholesterol (LDL-C) and ApoB (rs6720173); high-density lipoprotein cholesterol (HDL-C), ApoA1, ApoB, and ApoA1/ApoB ratio (rs3806471); and HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han were different among their genotypes (P<0.05-0.001). The levels of LDL-C (rs6720173) and ApoA1 (rs3806471) in Mulao were also different among their genotypes (P<0.05 for each). The levels of TC, TG, HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4131229); LDL-C and ApoB (rs6720173); HDL-C, ApoA1, and ApoA1/ApoB ratio (rs3806471); and TG, HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han males; and ApoA1/ApoB ratio (rs4131229); LDL-C, ApoB, and ApoA1/ApoB ratio (rs3806471); HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han females were different between the genotypes (P<0.05-0.001). The levels of LDL-C in Mulao females were also different between GG and GC/CC genotypes of rs6720173 (P<0.05). The correlation between serum lipid parameters and genotypes of four SNPs was observed in Han, especially in Han males. Serum lipid parameters were also correlated with several environmental factors. CONCLUSIONS: The associations of four ABCG5/G8 SNPs and serum lipid levels are different between the Mulao and Han populations, or between males and females, suggesting that there may be a racial/ethnic- and/or sex-specific association between ABCG5/G8 SNPs and some serum lipid parameters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Therefore, the aim of the present study was to explore the association of ABCG5 (rs4131229, i7892 T.C and rs6720173, Q604E G.C) and ABCG8 (rs3806471, 5U145 A.C and rs4148211, Y54C A.G) SNPs and several environmental factors with serum lipid profiles in the Mulao and Han populations. Login to comment
182 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
217 The other ABCG5/G8 SNPs (Q604E, Y54C, T400K and A632V) did not show any significant interactions with the CYP7A1 polymorphism. Login to comment
41 Therefore, the aim of the present study was to explore the association of ABCG5 (rs4131229, i7892 T.C and rs6720173, Q604E G.C) and ABCG8 (rs3806471, 5U145 A.C and rs4148211, Y54C A.G) SNPs and several environmental factors with serum lipid profiles in the Mulao and Han populations. Login to comment
180 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
215 The other ABCG5/G8 SNPs (Q604E, Y54C, T400K and A632V) did not show any significant interactions with the CYP7A1 polymorphism. Login to comment
216 No association was observed between ABCG8 T400K and total and LDL-C levels [32-34,36,38-41]. Login to comment
181 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment

[hide] The potential influence of genetic variants in gen... Atherosclerosis. 2010 May;210(1):14-27. Epub 2009 Nov 5. Lu Y, Feskens EJ, Boer JM, Muller M
The potential influence of genetic variants in genes along bile acid and bile metabolic pathway on blood cholesterol levels in the population.
Atherosclerosis. 2010 May;210(1):14-27. Epub 2009 Nov 5., [PMID:19932478]

Abstract [show]
The liver is currently known to be the major organ to eliminate excess cholesterol from our body. It accomplishes this function in two ways: conversion of cholesterol molecules into bile acids (BAs) and secretion of unesterified cholesterol molecules into bile. BAs are synthesized in the hepatocytes, secreted into bile and delivered to the lumen of the small intestine where they act as detergents to facilitate absorption of fats and fat-soluble vitamins. About 95% of BAs are recovered in the ileum during each cycle of the enterohepatic circulation. Five percent are lost and replaced by newly synthesized BAs, which amounts to approximately 500 mg/day in adult humans. In contrast to the efficiency of the BAs' enterohepatic circulation, 50% of the 1000 mg of cholesterol secreted daily into bile is lost in feces. It is known that rare human mutations in certain genes in bile acid and bile metabolic pathway influence blood cholesterol levels. With the recent success of genome-wide association studies, we are convinced that common genetic variants also play a role in the genetic architecture of plasma lipid traits. In this review, we summarized the current state of knowledge about genetic variations in bile acid and bile metabolic pathway, and assessed their impact on blood cholesterol levels and cholesterol metabolic kinetics in the population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1748 Several polymorphisms in ABCG5 (Q604E, rs6720173) and ABCG8 (T400K, rs4148217; D19H, rs11887534; A632V, rs6544718; and Y54C, rs4148211) have been found to be associated with several facets of cholesterol metabolism, including cholesterol level, cholesterol kinetics, and individual responsiveness of blood cholesterol to dietary and pharmaceutical intervention [41]. Login to comment
1781 No association was observed between Y54C of ABCG8 and blood total and LDL cholesterol levels [44,45,47-49]. Login to comment
1782 In 35 hypercholesterolemic Canadian women, Santosa et al. [48] showed that the heterozygous Y54C carriers had a smaller decline in cholesterol synthesis compared with homozygous YY carriers during weight loss through decreasing dietary energy intake and increasing energy expenditure. Login to comment
1785 Overall, no consistent results on effects of T400K, A632V and Y54C in ABCG8 gene on blood cholesterol levels and cholesterol metabolic kinetics were reported so far. Login to comment
1787 No modulating effect was observed from T400K, A632V or Y54C on cholesterol lowering response to atorvastatin [25,26]. Login to comment
1802 Recently, in 845 self-identified Puerto Ricans from Boston, Junyent et al. [47] reported that ABCG5/G8 (i7892T > C, rs4131229; 5U145A > C, rs3806471; Y54C; T400K) SNPs were significantly associated with HDL-C concentrations. Login to comment
1863 Genes Genetic variant Reference Study population Observed associationb ABCG8 A632V (rs6544718, C > T) Berge et al. [44] 143 healthy American Caucasians Higher TC in V allele carriers than AA Viturro et al. [43] 1227 healthy Spanish school children Higher TC, LDL-C and apoB levels in heterozygotes than homozygotes of wide-type allele, but only in the low cholesterol intake group (380 children) Hubacek et al. [46] 285 Czech participants No difference in TC, LDL-C and HDL-C Acalovschi et al. [49] 68 Romanian siblings with gallstone disease No difference in TC and HDL-C Plat et al. [50] 112 healthy Dutch volunteers No difference in LDL-C and HDL-C Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians No modulating effect from A632V on cholesterol lowering response to atorvastatin ABCG8 Y54C (rs4148211, A > G) Berge et al. [44] 139 healthy American Caucasians No difference in TC Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects No difference in TC, LDL-C and HDL-C Junyent et al. [47] 845 self-identified Puerto Ricans No difference in TC and LDL-C, but C allele carriers had a lower HDL-C than YY. Login to comment
1864 Santosa et al. [48] 42 overweight/obese Canadian women No difference in TC and LDL-C Acalovschi et al. [49] 68 Romanian siblings with gallstone disease No difference in TC and HDL-C Santosa et al. [48] 42 overweight/obese Canadian women Smaller decline in heterozygous Y54C carriers in cholesterol synthesis than YY during weight loss Hubacek et al. [46] 285 Czech participants Y allele carriers had larger reduction in TC and LDL-C than the CC, but only in female subjects. Login to comment
1865 Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians No modulating effect from Y54C on cholesterol lowering response to atorvastatin ABCG8 M429V (A > G) Miwa et al. [56] 100 hypercholesterolaemic Japanese subjects M429V variant associated with higher cholesterol absorption ABCG8 rs4131229 (T > C), rs3806471 (A > C) Junyent et al. [47] 845 self-identified Puerto Ricans Lower HDL-C in rare allele carriers than wild-type homozygotes, no difference in TC and LDL-C ABCG8 rs6709904 (A > G) Junyent et al. [47] 845 self-identified Puerto Ricans Lower LDL-C in rare allele carriers than wild-type homozygotes, no difference in TC and HDL-C NPC1L1 g.-113A > Gg.-18C > A-g.1679C > G (L272L, rs2072183) Simon et al. [66] 1208 hypercholesterolemic individuals participating in the ezetimibe + statin treatment arm of the EASE trial [104] and 1132 hypercholesterolemic individuals participating in Vytorin vs. Login to comment

[hide] Increased NPC1L1 and ACAT2 expression in the jejun... Biochem Biophys Res Commun. 2009 Jan 30;379(1):49-54. Epub 2008 Dec 9. Jiang ZY, Jiang CY, Wang L, Wang JC, Zhang SD, Einarsson C, Eriksson M, Han TQ, Parini P, Eggertsen G
Increased NPC1L1 and ACAT2 expression in the jejunal mucosa from Chinese gallstone patients.
Biochem Biophys Res Commun. 2009 Jan 30;379(1):49-54. Epub 2008 Dec 9., [PMID:19071091]

Abstract [show]
The incidence of cholesterol gallstones is a very common disease. The aim of this study is to probe for underlying intestinal molecular defects associated with development of gallstones. Twelve Chinese patients with cholesterol gallstone disease (GS) and 31 gallstone-free (GSF) patients were investigated. Quantitation of mRNA levels for individual genes in mucosal biopsies from jejunum was carried out with real-time PCR. The frequency of two SNPs in the ABCG8 gene (Y54C and T400K) was determined by allelic discrimination. The intestinal mRNA expression of NPC1L1 and ACAT2 were significantly higher in GS than GSF (P<0.05). No differences were observed concerning the levels for plasma lipids, plant sterols and 7alpha-hydroxy-4-cholesten-3-one between GS and GSF. No correlations were observed between patients carrying the different genotypes for Y54C or T400K and their mRNA levels for ABCG5 or ABCG8. The increased NPC1L1 and ACAT2 mRNA levels in gallstone patients might indicate an upregulated absorption and esterification of cholesterol in the small intestine.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 The frequency of two SNPs in the ABCG8 gene (Y54C and T400K) was determined by allelic discrimination. Login to comment
7 No correlations were observed between patients carrying the different genotypes for Y54C or T400K and their mRNA levels for ABCG5 or ABCG8. Login to comment
55 Single nucleotide polymorphism (SNP) analysis of the polymorphic sites Y54C and T400K in the ABCG8 gene were determined by allelic discrimination using intestinal cDNA as template. Login to comment
56 The following sequences were utilized for PCR primers and Taqman probes: Y54C: forward primer: ACA GTG GCC AGC CCA ACA; reverse primer: AGC CAG CTG CTC AAA CCA A. Login to comment
85 for the Y54C and T400K polymorphisms in ABCG8 gene in the GS and GSF patients. Login to comment
88 The campesterol and sitosterol levels were lower in subjects heterozygous or homozygous for the Y54C or the T400K polymorphism compared to individuals homozygous for the WT allele, but significance was only obtained for campesterol (Table 1, P < 0.05). Login to comment
100 (C) Comparison between mRNA levels of the genes ABCG5/G8, NPC1L1 and ACAT2 in the individuals of the total material (GS + GSF) with reference to the Y54C polymorphic site in the ABCG8 gene. Login to comment
102 Table 1 Plasma lipid and plant sterol levels in the total material with reference to the polymorphic sites Y54C and T400K in the ABCG8 gene (means ± SEM). Login to comment

[hide] ATP binding cassette G8 T400K polymorphism may aff... Clin Chim Acta. 2007 Sep;384(1-2):80-5. Epub 2007 Jun 16. Wang Y, Jiang ZY, Fei J, Xin L, Cai Q, Jiang ZH, Zhu ZG, Han TQ, Zhang SD
ATP binding cassette G8 T400K polymorphism may affect the risk of gallstone disease among Chinese males.
Clin Chim Acta. 2007 Sep;384(1-2):80-5. Epub 2007 Jun 16., [PMID:17612515]

Abstract [show]
BACKGROUND: Supersaturation of bile with cholesterol is a primary step in the formation of cholesterol gallstones. ATP binding cassette (ABC) G5 and G8 play an important role in regulating sterol absorption and secretion. To investigate a possible association between transporter gene polymorphism and gallstone formation, we examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) genes in patients with gallstone disease (GS). METHODS: Study subjects included 287 patients with GS and 219 gallstone free controls (GSF). Polymorphisms were determined using PCR-RFLP analysis or the Taqman MGB assay. Plasma and biliary lipid levels were measured. RESULTS: 2 SNPs of ABCG8 gene (Y54C and T400K) showed strong linkage disequilibrium (D'=0.824, r2=0.579). Male carriers of the less frequent K allele of ABCG8 T400K had a 2.31-fold elevated risk [95% confidence interval (CI) 1.12 approximately 4.76, P=0.023] for gallstone disease compared to male with the common genotype after the adjustment for age, body mass index. Males with the K allele had lower plasma triglyceride (P=0.044) and biliary phospholipid (P=0.035) levels than TT homozygotes. No such association was found in female or other 4 SNPs. CONCLUSIONS: These findings indicate that the T400K polymorphism in ABCG8 may be associated with the incidence of gallstone disease in males.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 To investigate a possible association between transporter gene polymorphism and gallstone formation, we examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) genes in patients with gallstone disease (GS). Login to comment
6 Results: 2 SNPs of ABCG8 gene (Y54C and T400K) showed strong linkage disequilibrium (D'=0.824, r2 =0.579). Login to comment
24 Of these variants, it is suggested that 5 non-synonymous single nucleotide polymorphisms (SNPs) in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may effect plasma plant sterol or cholesterol levels [11-14]. Login to comment
41 Four SNP sites in ABCG5 Q604E, ABCG8 Y54C, ABCG8 T400K, and ABCG8 A632V were assayed by PCR amplification and RFLP analysis, as previously described [10,11]. Login to comment
72 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
79 Thus, only the Y54C and T400K SNPs showed strong linkage disequilibrium (D'N0.8, r2 N1/3) [19]. Login to comment
82 No differences were observed when the frequencies of ABCG5 Q604E, ABCG8 D19H, and Y54C and A632V were compared between GS and Table 3 Frequency distribution of the different genotypes and alleles of 5 common ABCG5 and ABCG8 polymorphisms in GS and GSF Polymorphism All (%) Men (%) Women (%) GS GSF GS GSF GS GSF (n=287) (n=219) (n=121) (n=105) (n=166) (n=114) ABCG5:Q604E QQ 78.7 80.4 78.5 78.1 78.9 82.5 QE 20.9 18.7 21.5 20.0 20.5 17.5 EE 0.3 0.9 0 1.9 0.6 0 E allele 10.8 10.3 10.7 11.9 10.8 8.8 OR [95% CI]a 0.95 [0.63~1.42] 1.12 [0.63~2.01] 0.79 [0.45~1.41] ABCG8:D19H DD 98.3 98.6 99.2 99.0 97.6 98.2 DH 1.7 1.4 0.8 1.0 2.4 1.8 HH 0 0 0 0 0 0 H allele 0.9 0.7 0.4 0.5 1.2 0.9 OR [95% CI] 1.27 [0.30~5.36] 0.87 [0.05~13.95] 1.38 [0.25~7.59] ABCG8:Y54C YY 77.4 79.9 76.0 83.8 78.3 76.3 YC 22.3 18.3 24.0 14.3 21.1 21.9 CC 0.3 1.8 0 1.9 0.6 1.8 C allele 11.5 11.0 12.0 9.0 11.1 12.7 OR [95% CI] 1.06 [0.71~1.57] 1.369 [0.74~2.52] 0.861 [0.51~1.45] ABCG8:T400K TT 79.1 83.1 75.2 87.6 81.9 78.9 TK 20.6 16.4 24.8b 12.4 17.5 20.2 KK 0.3 0.5 0 0 0.6 0.9 K allele 10.6 8.7 12.4c 6.2 9.3 11.0 OR [95% CI] 1.25 [0.82~1.92] 2.14 [1.09~4.23] 0.83 [0.48~1.46] ABCG8:A632V AA 99.0 99.1 99.2 100.0 98.8 98.2 AV 1.0 0.9 0.8 0 1.2 1.8 VV 0 0 0 0 0 0 V allele 0.5 0.5 0.4 0 2(0.6) 0.9 OR [95% CI] 0.87 [0.14~5.27] 0.382 [0.02~9.44]d 1.46 [0.20~10.44] a Odds ratio (OR) statistics and 95% confidence intervals (95% CI) were calculated from allele distributions. Login to comment
99 Due to limited number of subjects, heterozygous and homozygous carriers of the genetic variants were combined as follows: ABCG5 Q604E (QE+EE), ABCG8 Y54C (YC+CC), and ABCG8 (TK+KK). Login to comment
102 However, no significant differences were found in the plasma and biliary lipid levels or biliary CSI of subjects with different genotypes of ABCG5 Q604E and ABCG8 Y54C. Login to comment
73 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
80 Thus, only the Y54C and T400K SNPs showed strong linkage disequilibrium (D'N0.8, r2 N1/3) [19]. Login to comment
83 No differences were observed when the frequencies of ABCG5 Q604E, ABCG8 D19H, and Y54C and A632V were compared between GS and Table 3 Frequency distribution of the different genotypes and alleles of 5 common ABCG5 and ABCG8 polymorphisms in GS and GSF Polymorphism All (%) Men (%) Women (%) GS GSF GS GSF GS GSF (n=287) (n=219) (n=121) (n=105) (n=166) (n=114) ABCG5:Q604E QQ 78.7 80.4 78.5 78.1 78.9 82.5 QE 20.9 18.7 21.5 20.0 20.5 17.5 EE 0.3 0.9 0 1.9 0.6 0 E allele 10.8 10.3 10.7 11.9 10.8 8.8 OR [95% CI]a 0.95 [0.63~1.42] 1.12 [0.63~2.01] 0.79 [0.45~1.41] ABCG8:D19H DD 98.3 98.6 99.2 99.0 97.6 98.2 DH 1.7 1.4 0.8 1.0 2.4 1.8 HH 0 0 0 0 0 0 H allele 0.9 0.7 0.4 0.5 1.2 0.9 OR [95% CI] 1.27 [0.30~5.36] 0.87 [0.05~13.95] 1.38 [0.25~7.59] ABCG8:Y54C YY 77.4 79.9 76.0 83.8 78.3 76.3 YC 22.3 18.3 24.0 14.3 21.1 21.9 CC 0.3 1.8 0 1.9 0.6 1.8 C allele 11.5 11.0 12.0 9.0 11.1 12.7 OR [95% CI] 1.06 [0.71~1.57] 1.369 [0.74~2.52] 0.861 [0.51~1.45] ABCG8:T400K TT 79.1 83.1 75.2 87.6 81.9 78.9 TK 20.6 16.4 24.8b 12.4 17.5 20.2 KK 0.3 0.5 0 0 0.6 0.9 K allele 10.6 8.7 12.4c 6.2 9.3 11.0 OR [95% CI] 1.25 [0.82~1.92] 2.14 [1.09~4.23] 0.83 [0.48~1.46] ABCG8:A632V AA 99.0 99.1 99.2 100.0 98.8 98.2 AV 1.0 0.9 0.8 0 1.2 1.8 VV 0 0 0 0 0 0 V allele 0.5 0.5 0.4 0 2(0.6) 0.9 OR [95% CI] 0.87 [0.14~5.27] 0.382 [0.02~9.44]d 1.46 [0.20~10.44] a Odds ratio (OR) statistics and 95% confidence intervals (95% CI) were calculated from allele distributions. Login to comment
100 Due to limited number of subjects, heterozygous and homozygous carriers of the genetic variants were combined as follows: ABCG5 Q604E (QE+EE), ABCG8 Y54C (YC+CC), and ABCG8 (TK+KK). Login to comment
103 However, no significant differences were found in the plasma and biliary lipid levels or biliary CSI of subjects with different genotypes of ABCG5 Q604E and ABCG8 Y54C. Login to comment

[hide] Are plasma lipid levels related to ABCG5/ABCG8 pol... Eur J Intern Med. 2006 Nov;17(7):490-4. Acalovschi M, Ciocan A, Mostean O, Tirziu S, Chiorean E, Keppeler H, Schirin-Sokhan R, Lammert F
Are plasma lipid levels related to ABCG5/ABCG8 polymorphisms? A preliminary study in siblings with gallstones.
Eur J Intern Med. 2006 Nov;17(7):490-4., [PMID:17098593]

Abstract [show]
BACKGROUND: The role of ABCG5 and ABCG8 genes in the determination of plasma lipid levels is currently under intensive investigation. The aim of this study was to evaluate plasma lipid levels in sibling pairs with gallstones and to assess their correlation with common gene polymorphisms in the ABCG5/ABCG8 genes. METHODS: Plasma levels of cholesterol, HDL-cholesterol, and triglycerides were measured in 68 patients belonging to 34 sibling pairs with gallstones (affected sibling pairs, mean age 56.3 years) and in 68 gallstone carriers with stone-free siblings (age/gender-matched controls in a ratio of 2:1 with the index patients of the study group). Four and one non-synonymous sequence variants in ABCG8 and ABCG5 genes, respectively, were determined in the affected sibling pairs, employing allelic discrimination with 5' nuclease assays. RESULTS: Plasma triglyceride levels were higher and HDL-cholesterol levels lower in the index patients than in controls. Plasma lipid levels were correlated in the members of the affected sibling pairs. Triglyceride levels were higher in carriers of the common alleles for ABCG5 Q604E and ABCG8 D19H sequence variants, and HDL-cholesterol was lower in carriers of the common alleles for ABCG5 Q604E than in carriers of the rare alleles. CONCLUSIONS: The significantly different plasma lipid levels in siblings with gallstones versus controls, as well as the correlation of plasma lipids in affected sibling pairs, confirm the genetic influence in gallstone disease. Polymorphisms in ABCG5/ABCG8 genes might contribute to the genetic variation in plasma lipid levels and in cholesterol saturation of the bile.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
78 Triglyceride levels in the carriers of the common alleles were higher than in the carriers of the rare alleles for the ABCG5 Q604E ( p=0.002), ABCG8 D19H ( p=0.058), and ABCG8 Y54C ( p=0.050) sequence variants (Table 4). Login to comment
109 Variation in plasma concentrations of non-cholesterol sterols has been demonstrated to be highly heritable, and D19H and T400K polymorphisms in ABCG8 have been found to contribute to genetic variations in the plasma concentrations of plant sterols [10]. Login to comment
110 Other polymorphisms in ABCG8 (A632V [10], T400K, and Y54C [27]) and in ABCG5 (Q604E [28]) have been suggested to be associated with plasma cholesterol levels. Login to comment
111 In our siblings with gallstones we found significantly higher plasma triglyceride levels in carriers of the common alleles for the polymorphisms Q604E in ABCG5 and D19H and Y54C in ABCG8 than in carriers of the rare alleles. Login to comment
119 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5±57.3 205.7±32.6 48.1±13.2 CC=44 154.1±67.3 204.6±39.2 45.6±18.2 T400K CA/AA=30 168.5±76.9 209.9±37.5 46.0±17.3 CC=42 144.7±50.1 201.5±35.8 48.2±14.4 Y54C AG/GG=44 144.5±58.4 202.7±39.6 44.9±17.0 AA=28 170.6±68.3 210.3±32.8 48.0±15.6 D19H GC/CC=12 130.9±52.6 192.5±27.3 49.0±19.5 GG=60 159.4±64.5 208.3±38.4 46.0±16.0 ABCG5 Q604E CG/GG=24 127.4±51.9 191.7±35.1 55.9±12.9 CC=48 168.2±64.5 212.7±36.3 42.7±15.7 did not correlate with those in controls. Login to comment
53 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
77 Triglyceride levels in the carriers of the common alleles were higher than in the carriers of the rare alleles for the ABCG5 Q604E ( p=0.002), ABCG8 D19H ( p=0.058), and ABCG8 Y54C ( p=0.050) sequence variants (Table 4). Login to comment
118 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5&#b1;57.3 205.7&#b1;32.6 48.1&#b1;13.2 CC=44 154.1&#b1;67.3 204.6&#b1;39.2 45.6&#b1;18.2 T400K CA/AA=30 168.5&#b1;76.9 209.9&#b1;37.5 46.0&#b1;17.3 CC=42 144.7&#b1;50.1 201.5&#b1;35.8 48.2&#b1;14.4 Y54C AG/GG=44 144.5&#b1;58.4 202.7&#b1;39.6 44.9&#b1;17.0 AA=28 170.6&#b1;68.3 210.3&#b1;32.8 48.0&#b1;15.6 D19H GC/CC=12 130.9&#b1;52.6 192.5&#b1;27.3 49.0&#b1;19.5 GG=60 159.4&#b1;64.5 208.3&#b1;38.4 46.0&#b1;16.0 ABCG5 Q604E CG/GG=24 127.4&#b1;51.9 191.7&#b1;35.1 55.9&#b1;12.9 CC=48 168.2&#b1;64.5 212.7&#b1;36.3 42.7&#b1;15.7 did not correlate with those in controls. Login to comment

[hide] Interactions between common genetic polymorphisms ... Atherosclerosis. 2004 Aug;175(2):287-93. Kajinami K, Brousseau ME, Ordovas JM, Schaefer EJ
Interactions between common genetic polymorphisms in ABCG5/G8 and CYP7A1 on LDL cholesterol-lowering response to atorvastatin.
Atherosclerosis. 2004 Aug;175(2):287-93., [PMID:15262185]

Abstract [show]
Cholesterol excretion by ATP binding cassette transporters G5 and G8 (ABCG5/G8) and bile acid biosynthesis by cholesterol 7alpha-hydroxylase (CYP7A1) are major pathways for the removal of cholesterol into bile. To investigate the interactions between common polymorphisms in ABCG5/G8 and CYP7A1 and statin response, we examined the relationships between five non-synonymous polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and a promoter variant in CYP7A1 (A-204C) in 337 hypercholesterolemic patients treated with atorvastatin 10mg. The ABCG8 H19 allele was significantly associated with a greater LDL cholesterol reduction relative to the wild type D19 allele (39.6% versus 36.6%, P = 0.043). This difference was enhanced in non-carriers of the CYP7A1 promoter polymorphism (42.7% versus 38.2%, P = 0.048), and was diminished in accordance with the number of CYP7A1 variant alleles (1.8% in heterozygotes and 0.2% in homozygotes). Combination analysis of these polymorphisms explained a greater percentage of LDL cholesterol response variation (8.5% difference across subgroups) than did single polymorphism analysis (4.2% in CYP7A1 and 3.0% in ABCG8 D19H). The other ABCG5/G8 polymorphisms did not show any significant interactions with the CYP7A1 polymorphism. We conclude that the ABCG8 H19 and CYP7A1 C-204 alleles appear to interact in a dose-dependent manner on atorvastatin response.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (±S.D.) of age and BMI were 58 ± 11 years old and 27.0 ± 3.0 kg/m2, respectively [15]. Login to comment
94 Interaction between other ABCG5/G8 polymorphisms and the CYP7A1 A-204C polymorphism Among the remaining four polymorphisms in ABCG5/G8 (Tables 2 and 3), only Y54C showed a potential interaction with the CYP7A1 A-204C polymorphism. Login to comment
95 The difference in LDL cholesterol reduction across the three CYP7A1 genotypes was greater in Y54C mutant allele homozygotes than in Y54C wild type allele homozygotes (10.5% versus 3.4%) (Table 2). Login to comment
97 We again reclassified subjects to test cumulative allele effects, as we had done for the ABCG8 D19H variant. Login to comment
98 In this case, the differences in LDL cholesterol reduction across the newly categorized groups were 5.5% in a dominant model for Y54C, and 7.5% in a recessive model, both of which were smaller than those observed for the D19H polymorphism (8.5%, Fig. 1). Login to comment
99 Stepwise multiple regression analysis also failed to show any significant association between LDL cholesterol reduction and Y54C genotype in any type of model (data not shown). Login to comment
44 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (&#b1;S.D.) of age and BMI were 58 &#b1; 11 years old and 27.0 &#b1; 3.0 kg/m2, respectively [15]. Login to comment
74 Table 2 Associations between ABCG8 Y54C/CYP7A1 A-204C and the LDL-lowering response to atorvastatin * ABCG8 Y54C All subjects CYP7A1 P-values among CYP7A1 genotype ߤ Unadjusted Adjusted AA AC CC Additive Dominant Recessive YY 36.3 &#b1; 10.0 36.3, 34.7-37.8 (138) 37.5, 34.4-40.6 (34) 36.4, 34.4-38.8 (79) 34.1, 30.5-37.7 (25) 0.311 0.358 0.155 YC 36.9 &#b1; 9.7 37.0, 35.4-38.5 (145) 38.7, 36.2-41.3 (50) 36.4, 34.1-38.8 (58) 35.4, 32.5-38.4 (37) 0.215 0.088 0.278 CC 38.9 &#b1; 9.7 38.7, 36.2-41.2 (54) 42.4, 37.9-46.9 (16) 39.1, 35.7-42.5 (28) 31.9, 26.1-37.6 (10) 0.014 0.048 0.008 P-values among ABCG8 genotype ߤ Additive 0.247 0.253 0.168 0.362 0.614 - - - Dominant 0.286 0.240 0.226 0.534 0.750 - - - P-value in testing genotype interaction between ABCG8 and CYP7A1 using two-way ANOVA were 0.439 when additive model of both genotypes are used; 0.709 when a dominant model of ABCG8 and a recessive model of CYP7A1 were used, and 0.073 when a recessive model for each genotype was used. Login to comment
96 Interaction between other ABCG5/G8 polymorphisms and the CYP7A1 A-204C polymorphism Among the remaining four polymorphisms in ABCG5/G8 (Tables 2 and 3), only Y54C showed a potential interaction with the CYP7A1 A-204C polymorphism. Login to comment
100 In this case, the differences in LDL cholesterol reduction across the newly categorized groups were 5.5% in a dominant model for Y54C, and 7.5% in a recessive model, both of which were smaller than those observed for the D19H polymorphism (8.5%, Fig. 1). Login to comment
101 Stepwise multiple regression analysis also failed to show any significant association between LDL cholesterol reduction and Y54C genotype in any type of model (data not shown). Login to comment

[hide] Genetics of biliary lithiasis from an ethnic persp... Clin Res Hepatol Gastroenterol. 2013 Apr;37(2):119-25. doi: 10.1016/j.clinre.2012.09.002. Epub 2013 Jan 20. Krawczyk M, Miquel JF, Stokes CS, Zuniga S, Hampe J, Mittal B, Lammert F
Genetics of biliary lithiasis from an ethnic perspective.
Clin Res Hepatol Gastroenterol. 2013 Apr;37(2):119-25. doi: 10.1016/j.clinre.2012.09.002. Epub 2013 Jan 20., [PMID:23340007]

Abstract [show]
Gallstone disease represents one of the most common gastroenterological disorders worldwide. Gallstones affect over 15% of adults in Europe and 25-30% of Hispanic populations in Central and South America. The heritability of gallstones varies considerably according to ethnicity, with Native Americans and Hispanics with Amerindian admixture being the most susceptible populations. Genetic factors have been shown to account for 25-30% of total gallstone risk in Europe, however, in Hispanic populations, this risk percentage may increase to 45-65%. Recent genome-wide association and candidate gene studies have identified common polymorphisms in enterohepatic transporters (ABCG5/8, SLC10A2) and the Gilbert syndrome UGT1A1 variant as genetic determinants of gallstone formation. Together, these polymorphisms cover a significant proportion of the previously predicted genetic background of gallstones in European populations. New lithogenic genes need to be discovered in future studies in high-risk populations. In this review, we address the latest developments in the genetic analysis of gallstones and discuss the ethnic background of this condition in European, Central and South American and Asian populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 For this study, common ABCG5 (p.Q604E) and ABCG8 (p.D19H, p.Y54C, p.T400K, p.A632V) variants were selected and the nonparametric linkage (NPL) as well as case-control analyses were performed. Login to comment

[hide] Association of three common single nucleotide poly... PLoS One. 2014 Jan 30;9(1):e87200. doi: 10.1371/journal.pone.0087200. eCollection 2014. Jiang ZY, Cai Q, Chen EZ
Association of three common single nucleotide polymorphisms of ATP binding cassette G8 gene with gallstone disease: a meta-analysis.
PLoS One. 2014 Jan 30;9(1):e87200. doi: 10.1371/journal.pone.0087200. eCollection 2014., [PMID:24498041]

Abstract [show]
BACKGROUND: In this study, we evaluated the association between these polymorphisms and gallstone disease using meta-analysis and compared the hepatic ABCG5/G8 mRNA expression and biliary lipids composition in patients with different genotypes of T400K and Y54C. METHODS: Data were analyzed using the Stata/SE 11.0 software and a random- effects model was applied irrespective of between-study heterogeneity. Hepatic mRNA expression of ABCG5/G8 genes in 182 patients with gallstone disease and 35 gallstone-free patients who underwent cholecystectomy were determined using real-time PCR. Genotypes of Y54C and T400K in the ABCG8 gene were determined by allelic discrimination using either genomic DNA or hepatic cDNA as template by Taqman assays. Biliary compostion in gallbladder bile was assayed in these patients as well. RESULTS: Ten papers including 13 cohorts were included for the final analysis. In the genotype model, the overall association between genotype with gallstone was significant for D19H (OR = 2.43, 95%CI: 2.23-2.64, P<0.001), and for Y54C (OR = 1.36, 95%CI: 1.01-1.83, P = 0.044), or T400K (OR = 1.17, 95%CI: 0.96-1.43. P = 0.110). In allele model, minor alleles of D19H polymorphism (allele D: OR = 2.25, 95%CI: 2.10-2.42, P<0.001) and of T400K polymorphism (allele K: OR = 1.18, 95%CI: 1.06-1.31, P<0.001) were related with an increased risk of gallstone disease. However, minor allele of Y54C polymorphism (allele Y, OR = 1.08, 95%CI: 0.96-1.21, P = 0.146) was not related with gallstone disease. I(2) statistics indicated no significant between-study heterogeneity for all genetic models for any of the three polymorphisms. Funnel plot and Egger's test suggested the absence of publication bias as well. However, no association of T400K and Y54C polymorphism with hepatic ABCG8/G5 mRNA expression or biliary lipids composition was found. CONCLUSIONS: Our study showed strong association of D19H polymorphism with gallstone disease. T400K and Y54C polymorphism, though to a less extent, may also relate with gallstone disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Genotypes of Y54C and T400K in the ABCG8 gene were determined by allelic discrimination using either genomic DNA or hepatic cDNA as template by Taqman assays. Login to comment
5 In the genotype model, the overall association between genotype with gallstone was significant for D19H (OR = 2.43, 95%CI: 2.23-2.64, P,0.001), and for Y54C (OR = 1.36, 95%CI: 1.01-1.83, P = 0.044), or T400K (OR = 1.17, 95%CI: 0.96-1.43. Login to comment
8 However, minor allele of Y54C polymorphism (allele Y, OR = 1.08, 95%CI: 0.96-1.21, P = 0.146) was not related with gallstone disease. Login to comment
11 However, no association of T400K and Y54C polymorphism with hepatic ABCG8/G5 mRNA expression or biliary lipids composition was found. Login to comment
13 T400K and Y54C polymorphism, though to a less extent, may also relate with gallstone disease. Login to comment
32 The most studied loci are D19H, T400K and Y54C. Login to comment
37 The aims of our study are: 1) to evaluate the association between polymorphisms at D19H, T400K and Y54C and gallstone disease using meta-analysis; 2) to compare the hepatic ABCG5/G8 mRNA expression and biliary lipids composition in patients with different genotypes of T400K and Y54C. Methods Literature Search Publication were searched via public database PubMed (http:// www.ncbi.nlm.nih. Login to comment

[hide] The ABCG5/8 cholesterol transporter and myocardial... J Am Coll Cardiol. 2014 May 27;63(20):2121-8. doi: 10.1016/j.jacc.2013.12.055. Epub 2014 Mar 19. Stender S, Frikke-Schmidt R, Nordestgaard BG, Tybjaerg-Hansen A
The ABCG5/8 cholesterol transporter and myocardial infarction versus gallstone disease.
J Am Coll Cardiol. 2014 May 27;63(20):2121-8. doi: 10.1016/j.jacc.2013.12.055. Epub 2014 Mar 19., [PMID:24657701]

Abstract [show]
OBJECTIVES: The study sought to test the hypothesis that genetic variation in ABCG5/8, the transporter responsible for intestinal and hepatobiliary cholesterol efflux, may simultaneously influence plasma and biliary cholesterol levels, and hence risk of myocardial infarction (MI) and gallstone disease in opposite directions. BACKGROUND: High plasma levels of low-density lipoprotein (LDL) cholesterol are a causal risk factor for MI, whereas high levels of biliary cholesterol promote gallstone formation. METHODS: A total of 60,239 subjects from Copenhagen were included, including 5,647 with MI and 3,174 with symptomatic gallstone disease. Subjects were genotyped for 6 common, nonsynonymous and functional variants in ABCG5/8, and a combined weighted genotype score was calculated. RESULTS: Combined, weighted genotype scores were associated with stepwise decreases in LDL cholesterol of up to 5.9% (0.20 mmol/l) for individuals with a score >/=8.0 (prevalence = 11%) versus <2.0 (prevalence = 9%; p for trend across 5 groups = 2 x 10E-35). The cumulative incidences of MI and gallstone disease as a function of age and increasing genotype score were decreased and increased (log-rank ps for trend: 6 x 10E-4 and 9 x 10E-45), respectively. The multifactorially adjusted odds ratios were 0.83 (95% confidence interval: 0.73 to 0.94) for MI and 2.85 (95% confidence interval: 2.39 to 3.39) for symptomatic gallstone disease for individuals with a genotype score >/=8.0 versus <2.0. CONCLUSIONS: Genetic variation in ABCG5/8, which associates with decreased levels of plasma LDL cholesterol protects against MI, but increases the risk of symptomatic gallstone disease. These results suggest that MI and gallstones, 2 seemingly unrelated diseases, are intrinsically linked via the function of the ABCG5/8 cholesterol transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 We genotyped all common nonsynonymous variants (minor allelefrequency >5%) inABCG5/ 8 (ABCG8D19H, Y54C, T400K, A632V; ABCG5 Q604E) and a functional intronic variant (ABCG8 IVS3&#fe;981) in 2 prospective studies of the Danish general population, CGPS (Copenhagen General Population Study) and CCHS (Copenhagen City Heart Study), and in a case-control study, CIHDS (Copenhagen Ischemic Heart Disease Study), totaling 60,239 participants, including 5,647 with MI and 3,174 with symptomatic gallstone disease. Login to comment
40 From the 5 genotypes that were individually associated with reductions in LDL cholesterol levels, we generated combined, weighted genotype scores based on the percentage reductions in LDL cholesterol compared to the reference genotype: ABCG8 D19H, DD &#bc; 0, DH &#bc; 2.7, HH &#bc; 5.8; IVS3&#fe;981 T>C, CC &#bc; 0, TC &#bc; 2.5, TT &#bc; 4.5; Y54C, YY &#bc; 0, YC &#bc; 0.2, CC &#bc; 1.1; T400K, TT &#bc; 0, TK &#bc; 0.9, KK &#bc; 2.9; A632V, VV &#bc; 0, AV &#bc; 0.9, AA &#bc; 1.1. Login to comment
45 In analyses stratified on ABCG8 D19H, a weighted genotype score without D19H was constructed (i.e., including IVS3&#fe;981, Y54C, T400K, and A632V). Login to comment
78 For the individual genotypes, ORs for MI ranged from 0.83 (95% CI: 0.76 to 0.92) for IVS3&#fe;981 TT to 1.07 (95% CI: 0.91 to 1.25) for T400K KK versus noncarriers, while ORs for gallstone disease ranged from 3.82 (95% CI: 2.66 to 5.49) for D19H HH to 1.11 (95% CI: 0.99 to 1.23) for Y54C CC versus noncarriers (Online Fig. 3). Login to comment
87 The corresponding multifactorially adjusted ORs for MI and symptomatic gallstone disease were 0.88 (95% CI: 0.80 to 0.98), and 1.74 (95% CI: 1.48 to 2.05), respectively (p for trend Figure 2 Lipid and Lipoprotein Levels as a Function of ABCG5/8 Genotypes, Individually and Combined The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test. Login to comment
105 Figure 3 Cumulative Incidence of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of Age and ABCG5/8 Genotype Score The genotype score was constructed by summation of weighted low-density lipoprotein cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are by log-rank trend test. Login to comment
122 For instance, a common intronic ABCG8 variant was recently used together with Figure 4 Risk of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of ABCG5/8 Genotype Score The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test, or for trend tests of odds ratios (ORs). Login to comment
159 However, other cohorts with measurements of both LDL cholesterol and plant sterols may be better suited to directly assess the LDL cholesterol Figure 6 Risk of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of ABCG5/8 Genotype Score on a D19H DD Background The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering alleles of adenosine triphosphate-binding cassette transporter G8 (ABCG8) IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test, or for trend tests of odds ratios (ORs). Login to comment

[hide] Lipids, obesity and gallbladder disease in women: ... Eur J Hum Genet. 2016 Jan;24(1):106-12. doi: 10.1038/ejhg.2015.63. Epub 2015 Apr 29. Rodriguez S, Gaunt TR, Guo Y, Zheng J, Barnes MR, Tang W, Danish F, Johnson A, Castillo BA, Li YR, Hakonarson H, Buxbaum SG, Palmer T, Tsai MY, Lange LA, Ebrahim S, Davey Smith G, Lawlor DA, Folsom AR, Hoogeveen R, Reiner A, Keating B, Day IN
Lipids, obesity and gallbladder disease in women: insights from genetic studies using the cardiovascular gene-centric 50K SNP array.
Eur J Hum Genet. 2016 Jan;24(1):106-12. doi: 10.1038/ejhg.2015.63. Epub 2015 Apr 29., [PMID:25920552]

Abstract [show]
Gallbladder disease (GBD) has an overall prevalence of 10-40% depending on factors such as age, gender, population, obesity and diabetes, and represents a major economic burden. Although gallstones are composed of cholesterol by-products and are associated with obesity, presumed causal pathways remain unproven, although BMI reduction is typically recommended. We performed genetic studies to discover candidate genes and define pathways involved in GBD. We genotyped 15 241 women of European ancestry from three cohorts, including 3216 with GBD, using the Human cardiovascular disease (HumanCVD) BeadChip containing up to ~53 000 single-nucleotide polymorphisms (SNPs). Effect sizes with P-values for development of GBD were generated. We identify two new loci associated with GBD, GCKR rs1260326:T>C (P=5.88 x 10(-7), ss=-0.146) and TTC39B rs686030:C>A (P=6.95x10(-7), ss=0.271) and detect four independent SNP effects in ABCG8 rs4953023:G>A (P=7.41 x 10(-47), ss=0.734), ABCG8 rs4299376:G(>)T (P=2.40 x 10(-18), ss=0.278), ABCG5 rs6544718:T>C (P=2.08 x 10(-14), ss=0.044) and ABCG5 rs6720173:G>C (P=3.81 x 10(-12), ss(=)0.262) in conditional analyses taking genotypes of rs4953023:G>A as a covariate. We also delineate the risk effects among many genotypes known to influence lipids. These data, from the largest GBD genetic study to date, show that specific, mainly hepatocyte-centred, components of lipid metabolism are important to GBD risk in women. We discuss the potential pharmaceutical implications of our findings.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 The rs4299376:G4T variant, also in ABCG8, tags an independent effect, possibly reflecting an earlier report of NM_022437.2(ABCG8):c.161A4G (p.Tyr54Cys) (r2 ~ 0.2 between rs4299376:G4T and rs4148211:A4G in Europeans) on GBD in Taiwanese. Login to comment

[hide] ABCG5 and ABCG8 gene polymorphisms in type 2 diabe... Can J Diabetes. 2015 Oct;39(5):405-10. doi: 10.1016/j.jcjd.2015.04.004. Epub 2015 Jun 16. Gok O, Karaali ZE, Acar L, Kilic U, Ergen A
ABCG5 and ABCG8 gene polymorphisms in type 2 diabetes mellitus in the Turkish population.
Can J Diabetes. 2015 Oct;39(5):405-10. doi: 10.1016/j.jcjd.2015.04.004. Epub 2015 Jun 16., [PMID:26088706]

Abstract [show]
OBJECTIVE: The aim of the present study was to investigate the relationship between ABCG5 and ABCG8 gene polymorphisms and plasma lipid concentrations in Turkish patients with type 2 diabetes mellitus. METHODS: Included in this study were 80 patients with type 2 diabetes and 73 healthy controls. Two selected single nucleotide polymorphisms in ABC transporter genes, ABCG5 (rs6720173) and ABCG8 (rs4148211), were genotyped by using the polymerase chain reaction-restriction fragment length polymorphism technique. RESULTS: The rate of having the ABCG8 AA genotype (p=0.001) was significantly higher in the patients than in the control subjects. Correspondingly, the rates of having the AG genotype (p=0.001) and the G allele (p=0.001) were significantly lower in the patients than in controls. Upon comparing the groups regarding ABCG5, the frequencies of occurrence of the GG genotype (p=0.031) and G allele (p=0.003) were considerably higher in patients than in control subjects. In the patients, the rates of having the CC genotype (p=0.003) and the C allele (p=0.031) were also significantly lower than those in control subjects. There was no significant difference between G5 and G8 polymorphism and lipid levels in the study groups. The ABCG8 AA genotype carriers had higher triglyceride (p=0.045) and very low-density-cholesterol (p=0.045) levels than the ABCG8 GG genotype carriers in all study populations. CONCLUSIONS: These results indicate that the AA genotype for ABCG8 and the GG genotype and G allele for ABCG5 are risk factors for diabetes. This study reveals the first data concerning the ABCG5 and ABCG8 gene polymorphisms in Turkish patients with diabetes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 There is no investigation related to ABCG5 Gln604Glu and ABCG8 Tyr54Cys single nucleotide polymorphisms (SNPs) and lipid levels in patients with diabetes. According to this knowledge, we aimed to investigate the association between ABCG5 and ABCG8 gene polymorphisms and lipid levels in Turkish patients with type 2 diabetes as compared to controls. Login to comment
55 Determination of ABCG5 Gln604Glu and ABCG8 Tyr54Cys polymorphisms ABCG5 and ABCG8 gene polymorphisms were analyzed using the PCR-restriction fragment length polymorphism (RFLP) method, as described previously (21). Login to comment
56 A segment of the ABCG5 gene encompassing the Gln604Glu polymorphic site was amplified with the help of PCR by using the forward (5`-AAC CAC ACC TGA CAC TGT CAA TCT TTT CCT-3`) and reverse primers (5`-GGG CAG GTT TTC TCA ATG AAT TGA ATT CCT C-3`), and a segment of the ABCG8 gene encompassing the Tyr54Cys polymorphic site was amplified using the forward (5`-AGG GCC TCC AGG ATA GAT TGT TCT CCT C-3`) and reverse primers (5`CCT TGA ACC CAG GCG TGC GCC TAC CTG-3`) (21). Login to comment
73 * p<0.05. Table 2 Distribution of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes and alleles in study groups Patients (n&#bc;80) Controls (n&#bc;135) p % n % n ABCG5 Gln604Glu genotype CC 36.2* 29 60.3 44 0.003 GG 22.5* 18 9.6 7 0.031 CG 41.2 33 30.1 22 NS Allele C 56.8* 91 75.4 110 0.031 G 43.2* 69 24.6 36 0.003 ABCG8 Tyr54Cys genotype AA 55.0* 44 21.9 16 0.001 GG 12.5 10 12.3 9 NS AG 32.5* 26 65.8 48 0.001 Allele A 71.2 114 54.80 80 NS G 28.8* 46 45.20 66 0.001 n, Number of individuals; NS, not significant. Login to comment
75 * p<0.05. Table 3 Distribution of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes and alleles by gender in study groups Patients (n&#bc;80) Controls (n&#bc;73) Female (n&#bc;59) Male (n&#bc;21) Female (n&#bc;26) Male (n&#bc;47) % n % n % n % n ABCG5 Gln604Glu genotype CC 33.9 20 42.9 9 61.5 16 59.6 28 GG 25.4 15 14.3 3 19.2 5 4.2 2 CG 40.7 24 42.9 9 19.2 5 36.2 17 Allele C 54.2 64 64.28 27 71.1 37 77.7 73 G 45.8 54 35.72 15 28.85 15 22.3 21 ABCG8 Tyr54Cys genotype AA 62.7* 37 33.3 7 19.2 5 23.4 4 GG 13.6 8 9.5 2 7.7 2 14.9 7 AG 23.7 14 57.2* 12 73.1 19 61.7 29 Allele A 74.6 88 61.9 26 55.7 29 54.3 51 G 25.4 30 38.1* 16 44.3 23 45.7 43 n, Number of individuals. Login to comment
79 Frequencies of ABCG5 and ABCG8 gene polymorphisms The frequencies of genotypes and alleles in ABCG5 Gln604Glu and ABCG8 Tyr54Cys genes in both control and patient groups are shown in Table 2. Login to comment
84 The distributions of genotypes and alleles in ABCG5 Gln604Glu and ABCG8 Tyr54Cys genes bygenderare showninTable 3. Login to comment
89 Some frequencies of genotypes were not in the Hardy-Weinberg equilibrium (frequency of the ABCG8 Tyr54Cys genotype in control subjects, frequency of the ABCG8 Tyr54Cys genotype in female patients, frequency of the ABCG5 Gln604Glu genotype and Tyr54Cys genotypes in female control subjects, and frequency of the ABCG5 Tyr54Cys genotype in male control subjects). Login to comment
94 Discussion Type 2 diabetes mellitus is associated with gene-environment interactions due to epigenetic factors, such as defects in lipid metabolism, hyperlipidemia, hypertension, obesity, smoking and Table 4 Comparison of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes with lipid/anthropometric parameters in study groups ABCG5 Gln604Glu genotype ABCG8 Tyr54Cys genotype Patients (n&#bc;80) Controls (n&#bc;73) Patients (n&#bc;80) Controls (n&#bc;73) CC (n&#bc;29) GG (n&#bc;18) CG (n&#bc;33) P CC (n&#bc;29) GG (n&#bc;18) CG (n&#bc;33) P AA (n&#bc;44) GG (n&#bc;10) AG (n&#bc;21) P AA (n&#bc;44) GG (n&#bc;10) AG (n&#bc;21) p Triglyceride (mg/dL) 176.8382.37 176.6166.59 162.2175.04 NS 139.5949.75 123.5742.26 136.7356.21 NS 177.2383.33 137.4050.36 172.6267.88 NS 147.5068.90 130.4431.14 135.0246.99 NS Total cholesterol (mg/dL) 231.5755.85 231.3248.58 214.1459.23 NS 195.5831.07 202.7178.85 204.7135.56 NS 221.7056.57 216.0839.72 231.9560.41 NS 200.6956.77 207.9846.73 196.7829.13 NS HDL cholesterol (mg/dL) 40.6912.36 36.229.441 36.188.36 NS 36.597.01 39.575.15 34.689.15 NS 37.778.66 41.5014.50 36.5011.14 NS 38.758.59 33.568.81 36.006.96 NS LDL cholesterol (mg/dL) 155.5253.72 159.7848.56 145.5253.34 NS 131.0730.32 138.4371.95 142.6837.32 NS 148.4852.78 147.1043.52 160.9254.81 NS 132.4452.19 148.3350.33 133.7728.81 NS VLDL cholesterol (mg/dL) 35.3716.47 35.3213.31 32.4415.00 NS 27.929.95 24.718.45 27.3511.24 NS 35.4516.66 27.4810.07 34.5213.57 NS 29.5013.78 26.096.22 27.009.39 NS Total cholesterol/ HDL cholesterol (mg/dL) 6.252.77 6.932.66 6.222.33 NS 5.581.80 5.101.68 6.362.33 NS 6.312.70 5.872.64 6.742.32 NS 5.381.66 6.873.53 5.691.65 NS BMI (kg/m 2 ) 26.084.65 26.823.55 26.423.83 NS 26.532.81 * 23.363.30 26.583.91 0.018 26.784.13 24.745.15 26.353.41 NS 25.693.18 25.803.27 26.503.40 NS HDL, High density lipoprotein; LDL, low density lipoprotein; n, number of individuals; NS, not significant; SD, standard deviation; VLDL, very low-density lipoprotein; BMI, body mass index. Statistical evaluation was made by using the Student t test and the 1-way ANOVA test. The results are shown as mean SD. Login to comment
108 When we compared the distribution of the ABCG5 and ABCG8 genotypes and alleles with previous studies, we observed that the distribution of the ABCG8 Tyr54Cys genotypes and alleles was similar to that found in the study by Hubacek et al, which reported that the distribution of ABCG8 genotypes and alleles were 34%, 20.4%, 45.6%, 56.8% and 43.2% (21). Login to comment
110 For ABCG8 Tyr54Cys, AA genotype (p&#bc;0.001) was considerably higher in patients with diabetes than in control subjects. Login to comment
116 Hubajeck et al (21) reported that total cholesterol and LDL cholesterol levels were low for ABCG8 Tyr54Cys only in female subjects. Login to comment
124 Junyent et al (39) genotyped ABCG5 Gln604Glu and ABCG8 Tyr54Cys genetic variants in 845 subjects and observed that minor alleles in these SNPs had a lowering effect on HDL cholesterol concentrations. Login to comment
130 Table 5 Comparison of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes with lipid/anthropometric parameters in all study populations ABCG5 Gln604Glu genotype ABCG8 Tyr54Cys genotype CC (n&#bc;73) CG (n&#bc;25) CG (n&#bc;55) p AA (n&#bc;60) GG (n&#bc;19) AG (n&#bc;74) p Triglyceride (mg/dL) 154.3866.74 161.7664.64 152.0268.73 NS 169.3080.27* 134.1141.37 148.2357.67 0.045 Total cholesterol (mg/dL) 209.8845.87 223.3158.29 210.3750.92 NS 216.0956.92 212.2442.15 209.1345.63 NS HDL cholesterol (mg/dL) 38.229.64 37.168.49 35.588.63 NS 38.038.58 37.7412.50 36.188.59 NS LDL cholesterol (mg/dL) 140.7842.62 153.8053.32 144.3847.22 NS 144.2052.66 147.6845.52 143.3141.64 NS VLDL cholesterol (mg/dL) 30.8813.34 32.3512.92 30.4013.74 NS 33.8616.05* 26.828.27 29.6511.53 0.045 Total cholesterol /HDL cholesterol (mg/dL) 5.852.24 6.422.53 6.282.31 NS 6.062.48 6.343.05 6.061.96 NS BMI (kg/m2 ) 26.353.63 25.853.76 26.483.83 NS 26.493.90 25.244.28 26.453.38 NS HDL, High density lipoprotein; LDL, low density lipoprotein; n, number of individuals; NS, not significant; SD, standard deviation; VLDL, very low-density lipoprotein; BMI, body mass index. Statistical evaluation was made by using the Student t test and the 1-way ANOVA test. The results are shown as mean SD. Login to comment
132 Conclusions This study reports the first data about ABCG5 Gln604Glu and ABCG8 Tyr54Cys gene polymorphisms and lipid parameters in diabetes. Login to comment
136 Therefore, future studies with larger sample sizes in differing races will help us to understand the relationship between ABCG5 Gln604Glu and ABCG8 Tyr54Cys polymorphisms and lipid profiles in diabetes mellitus. Login to comment