ABCMdb

ABCG8 p.Tyr54Cys

None has been submitted yet.

Publications

PMID: 11668628 [PubMed] Hubacek JA et al: "Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia."

No. Sentence Comment

6 Nine nonsynonymous polymorphisms are also reported: I523V, C600Y, Q604E, and M622V in ABCG5; and D19H, Y54C, T400K, A632V, and Y641F in ABCG8. Login to comment
36 Gene Exon NT change AA change Allele frequency RE ABCG5 ABCG8 ex. 11 ex. 13 ex. 13 ex. 13 ex. 1 ex. 2 ex. 8 ex. 13 ex. 13 c.1567 A>G c.1799 G>A c.1810 C>G c.1864 A>G c.52 G>C c.161 A>G c.1199 C>A c.1895 C>T c.1922 A>T I523V C600Y Q604E M622V D19H Y54C T400K A632V Y641F <1% <1% C=0.80/G=0.20 <1% G=0.94/C=0.06 A=0.61/G=0.39 C=0.80/A=0.20 C=0.83/T=0.17 A=0.99/T=0.01 XmnI TsrpI SexAI MseI NcoI MboII *The polymorphisms were found either in sitosterolemic probands or in genomic DNA from 24 individuals with high plasma cholesterol concentrations. Allele frequencies of the nonsynonymous sequence variants identified were determined in 50 unrelated Caucasians. Login to comment

PMID: 11893785 [PubMed] Berge KE et al: "Heritability of plasma noncholesterol sterols and relationship to DNA sequence polymorphism in ABCG5 and ABCG8."

No. Sentence Comment

125 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 DЈ P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
126 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 D9 P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
128 Mean plasma sterol concentrations and sterol-cholesterol ratios in unrelated men and women with different ABCG5 and ABCG8 genotypes ABCG8 D19H ABCG8 Y54C ABCG8 T400K ABCG8 A632V ABCG5 Q604E DD n 5 128 DH/HH n 5 14 YY n 5 54 YC/CC n 5 85 TT n 5 95 TK/KK n 5 48 AA n 5 94 VA/VV n 5 49 QQ n 5 91 QE/EE n 5 51 Plasma sterol concentrations Cholesterol 202 6 41 194 6 33 199 6 39 203 6 40 197 6 38 207 6 42 195 6 38 b 213 6 40 198 6 40 204 6 40 Cholestanol 420 6 110 b 340 6 72 400 6 104 419 6 114 410 6 115 418 6 103 400 6 97 437 6 131 411 6 114 416 6 105 Desmosterol 200 6 70 196 6 79 195 6 66 202 6 74 1916 67 221 6 79 197 6 75 210 6 68 197 6 74 208 6 70 Lathosterol 308 6 135 365 6 252 308 6 120 320 6 168 296 6 136 354 6 171 309 6 165 329 6 116 314 6 154 322 6 145 Sitosterol 257 6 105 b 177 6 53 231 6 93 261 6 109 256 6 114 238 6 83 239 6 87 274 6 130 250 6 107 250 6 104 Campesterol 338 6 147 b 233 6 72 310 6 133 339 6 152 332 6 149 324 6 144 308 6 124 a 375 6 177 328 6 154 332 6 136 Plasma sterol-cholesterol ratios (mg/mg) Cholestanol 2.09 6 0.40 c 1.76 6 0.31 2.02 6 0.37 2.07 6 0.39 2.09 6 0.44 2.01 6 0.31 2.06 6 0.41 2.05 6 0.39 2.08 6 0.40 2.04 6 0.42 Desmosterol 0.99 6 0.26 1.00 6 0.32 0.97 6 0.25 0.99 6 0.28 0.96 6 0.25 a 1.06 6 0.30 1.00 6 0.29 0.98 6 0.23 0.98 6 0.27 1.02 6 0.27 Lathosterol 1.53 6 0.60 1.84 6 1.06 1.57 6 0.60 1.57 6 0.70 1.48 6 0.57 a 1.73 6 0.78 1.57 6 0.70 1.56 6 0.57 1.57 6 0.67 1.58 6 0.63 Sitosterol 1.28 6 0.45 c 0.94 6 0.32 1.18 6 0.45 1.29 6 0.45 1.30 6 0.48 a 1.15 6 0.35 1.24 6 0.42 1.29 6 0.51 1.27 6 0.44 1.23 6 0.48 Campesterol 1.67 6 0.62 c 1.21 6 0.36 1.56 6 0.59 1.66 6 0.63 1.68 6 0.62 1.54 6 0.60 1.58 6 0.59 1.74 6 0.65 1.64 6 0.63 1.61 6 0.59 Values are means 6 SD. Plasma cholesterol concentrations are in mg/dl. Login to comment

PMID: 14703505 [PubMed] Kajinami K et al: "ATP binding cassette transporter G5 and G8 genotypes and plasma lipoprotein levels before and after treatment with atorvastatin."

No. Sentence Comment

37 In the present study, five prevalent DNA polymorphisms, one in ABCG5 (Q604E) and four in ABCG8 (D19H, Y54C, T400K, and A632V), were studied using a PCR-restriction length polymorphism method. Login to comment
58 RESULTS Genotype, allele, haplotype frequencies, linkage disequilibrium Genotype distributions (wild-type allele homozygote, variant heterozygote, variant homozygote) in each polymorphism were as follows; Q604E (212, 112, 14), D19H (294, 43, 1), Y54C (138, 146, 54), T400K (196, 130, 12), and A632V (225, 96, 17). Login to comment
60 Allele frequencies (wild-type, variant) were Q604E (0.79, 0.21), D19H (0.93, 0.07), Y54C (0.62, 0.38), T400K (0.77, 0.23), and A632V (0.81, 0.19). Login to comment
63 Significant linkage disequilibrium was found in 5 out of 10 pairs of five polymorphisms: Q604E/D19H (D` ϭ 0.6503, P Ͻ 0.0001), Q604E/Y54C (-0.3461, 0.0244), D19H/Y54C (-0.9986, 0.0003), Y54C/T400K (-0.4957, 0.0003), and T400K/A632V (-0.5484, 0.0456). Login to comment
38 For the D19H polymorphism, a 131 bp fragment, including a G to C substitution site at codon 19 of the ABCG8 gene, was amplified using an oligonucleotide primer set (5Ј-GCTGGGTCTAAGAGAGCTGC-3Ј and 5Ј-CTTCCCATTGCT- CACTCACC-3Ј) with 35 cycles of amplification (95ЊC for 30 s, 60ЊC for 30 s, and 72ЊC for 30 s). Login to comment

PMID: 15209530 [PubMed] Stefkova J et al: "ATP-binding cassette (ABC) transporters in human metabolism and diseases."

No. Sentence Comment

107 The other two polymorphisms (Q604E) in ABCG5 and (Y54C) in ABCG8 were not associated with plasma lipid levels. Login to comment

PMID: 15311998 [PubMed] Hubacek JA et al: "Polymorphisms in ABCG5 and ABCG8 transporters and plasma cholesterol levels."

No. Sentence Comment

5 Missence polymorphisms (Gln604Glu in the ABCG5 and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) in these genes have been described. Login to comment
23 To evaluate the role of the ABCG5 and ABCG8 variants in the genetic determination of plasma lipids, we analyzed non-synonymous polymorphisms in the ABCG5 (C1810G = Gln604Glu) and ABCG8 (G55C = Asp19His, A161G = Tyr54Cys, C1199A = Thr400Lys and C1895T = Ala632Val) genes, and searched for associations between the polymorphisms and plasma lipid levels, and between the polymorphisms and plasma lipid changes over a 8 years´ follow-up. Login to comment
33 Polymorphism Primer sequence PCR product Enzyme Size Allele ABCG8 5`atggccgggaaggcggcagaggagag 83 bp BamH I 83 C (His) Asp19His 5`acttcccattgctcactcaccgagggat 56 + 27 G (Asp) ABCG8 5`agggcctccaggatagattgttctcctc 128 bp Bgl I 128 A (Tyr) Tyr54Cys 5`ccttgaacccaggcgtgcgcctacctg 102 + 26 G (Cys) ABCG8 5`agatgcctggggcggtgcagcagctt 108 bp Afl II 108 C (Thr) Thr400Lys 5`ggcttaatgtgatatacaaagacttggg 81 + 27 A (Lys) ABCG8 5`atgtctgtgtctccagatcctcaggg 105 bp Hae III 105 T (Val) Ala632Val 5`tacaggaccatgaagccaccgctgacgcc 79 + 26 C (Ala) ABCG5 5`aaccacacctgacactgtcaatcttttcct 117 bp Xho I 117 G (Glu) Gln604Glu 5`gggcaggttttctcaatgaattgaattcctc 86 + 31 C (Gln) DNA analysis Three ml of blood collected into EDTA tubes for DNA isolation were diluted with sterile water at a 1:1 ratio and stored at -20 °C. DNA was isolated by a standard method (Miller et al. 1988). Login to comment
58 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment
8 The Tyr54Cys polymorphism influenced the degree of reduction in total plasma cholesterol (∆ -0.49 mmol/l in Tyr54 homozygotes vs. ∆ +0.12 mmol/l in Cys54 homozygotes, p<0.04) and LDL-cholesterol (∆ -0.57 mmol/l in Tyr54 homozygotes vs. ∆ +0.04 mmol/l in Cys54 homozygotes, p<0.03) levels between 1988 and 1996 in females, but not in males. Login to comment
11 We conclude that Tyr54Cys and Thr400Lys variations in the ABCG8 gene may play a role in the genetic determination of plasma cholesterol levels and could possibly influence the gender-specific response of plasma cholesterol levels after dietary changes. Login to comment
61 Tyr54Cys polymorphism in ABCG8 in females, their plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 and the changes in T-C levels between 1988 and 1996. Login to comment
62 Tyr54Tyr Tyr54Cys Cys54Cys N 43 68 28 Years 1988 1996 1988 1996 1988 1996 T-C 6.0±1.0 5.5±1.1 5.8±1.1 5.5±1.1 5.6±1.1 5.7±1.3 LDL-C 3.7±1.0 3.2±1.0 3.6±0.9 3.3±1.0 3.4±1.0 3.4±1.0 ∆ T-C* -9.1 % -5.5 % +1.8 % ∆ LDL-C** -15.4 % -9.7 % +1.2 % Data are in mmol/l, means ± S.D., * p<0.04, ** p<0.03. Login to comment
63 The Tyr54Cys polymorphism was not associated with lipid levels in either 1988 or 1996 While no significant change in LDL-cholesterol (∆ +0.04 mmol/l, +1.2 %) was found in females homozygous for the Cys54 allele, a marked decrease was observed in Tyr/Tyr homozygotes (∆ -0.57 mmol/l, -15.4 %) with heterozygotes showing an intermediate decrease (∆ -0.35 mmol/l, -9.7 %) (p<0.03, Table 4). Login to comment
103 In this sample, variations in the ABCG8 gene loci (Tyr54Cys and Thr400Lys polymorphisms) were found to play a role in gender-specific reduction in plasma lipid levels as a response to reduced dietary animal fat and cholesterol intake. Login to comment
104 Our results suggest that the Tyr54Cys and Thr400Lys polymorphisms in ABCG8 might play a role in the genetic determination of plasma lipids in a gender-specific gene-nutrition manner. Login to comment
57 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment
60 Tyr54Cys polymorphism in ABCG8 in females, their plasma levels of total cholesterol (T-C) and LDL-cholesterol (LDL-C) in 1988 and 1996 and the changes in T-C levels between 1988 and 1996. Login to comment
102 In this sample, variations in the ABCG8 gene loci (Tyr54Cys and Thr400Lys polymorphisms) were found to play a role in gender-specific reduction in plasma lipid levels as a response to reduced dietary animal fat and cholesterol intake. Login to comment

PMID: 17002235 [PubMed] Chan YM et al: "Plasma concentrations of plant sterols: physiology and relationship with coronary heart disease."

No. Sentence Comment

71 Aside from the rare mutation of a homozygous form resulting in sitosterolemia, several common sequence variations have been described.71 Different studies have shown independently that the cross-sectional plant sterol-to-cholesterol ratio is associated with different ABCG5 and ABCG8 polymorphisms.10,27,72 Out of the five polymorphisms analyzed in relation to concentrations of plant sterols, D19H, Y54C, T400K, A632V, and Q604E, the polymorphisms D19H in exon 1 and T400K in exon 8 of ABCG8 show the most pronounced association. Login to comment
72 Carriers of the H allele of the D19H polymorphism in ABCG8 were found to have a lower plasma campesterol-to-cholesterol ratio10,27 and sitosterol-to-cholesterol ratio,10 suggesting a higher activity of this variant. Login to comment

PMID: 19005228 [PubMed] Junyent M et al: "The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican Health Study."

No. Sentence Comment

28 Some of these studies reported significant associations between ABCG5/G8 SNPs (Gln604Glu, Thr400Lys, and Tyr54Cys) and total cholesterol and LDL-C, including 154 females undergoing weight loss (13), 112 subjects after consumption of plant stanol esters (14), and 263 mildly hypercholesterolemic patients (17). Login to comment
27 Some of these studies reported significant associations between ABCG5/G8 SNPs (Gln604Glu, Thr400Lys, and Tyr54Cys) and total cholesterol and LDL-C, including 154 females undergoing weight loss (13), 112 subjects after consumption of plant stanol esters (14), and 263 mildly hypercholesterolemic patients (17). Login to comment

PMID: 20581104 [PubMed] Jakulj L et al: "ABCG5/G8 polymorphisms and markers of cholesterol metabolism: systematic review and meta-analysis."

No. Sentence Comment

141 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (␮g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 ± 0.76 4.05 ± 0.61 1.54 ± 0.40 1.09 [0.29-3.56] 1.45 ± 0.64 1.12 ± 0.53 1.49 ± 0.33 1.24 ± 0.49 QE/EE 72 6.23 ± 0.73 4.11 ± 0.63 1.49 ± 0.36 1.19 [0.47-3.93] 1.47 ± 0.88 1.16 ± 0.63 1.46 ± 0.38 1.28 ± 0.57 D19H DD 219 6.19 ± 0.75 4.08 ± 0.61 1.52 ± 0.40 1.10 [0.29-3.93] 1.49 ± 0.69 1.16 ± 0.55 1.49 ± 0.34 1.24 ± 0.49 DH/HH 24 6.04 ± 0.81 3.90 ± 0.63 1.60 ± 0.38 1.15 [0.47-1.97] 1.24 ± 0.82 0.92 ± 0.53 1.38 ± 0.34 1.35 ± 0.64 Y54C YY 73 6.32 ± 0.73 4.14 ± 0.64 1.58 ± 0.37 1.09 [0.45-3.93] 1.59 ± 0.76 1.22 ± 0.60 1.53 ± 0.33 1.24 ± 0.53 YC/CC 171 6.12 ± 0.76 4.03 ± 0.61 1.51 ± 0.41 1.11 [0.29-3.56] 1.41 ± 0.68 1.09 ± 0.53 1.46 ± 0.34 1.26 ± 0.50 T400K TT 183 6.16 ± 0.75 4.03 ± 0.60 1.55 ± 0.40 1.10 [0.29-3.93] 1.48 ± 0.69 1.14 ± 0.55 1.49 ± 0.35 1.25 ± 0.48 TK/KK 61 6.24 ± 0.76 4.19 ± 0.66 1.47 ± 0.37 1.14 [0.47-2.61] 1.38 ± 0.76 1.09 ± 0.59 1.45 ± 0.31 1.27 ± 0.59 A632V AA 139 6.22 ± 0.72 4.12 ± 0.60 1.51 ± 0.37 1.12 [0.33-2.90] 1.49 ± 0.72 1.16 ± 0.58 1.51 ± 0.37 1.21 ± 0.49 AV/VV 105 6.14 ± 0.79 3.99 ± 0.63 1.57 ± 0.43 1.07 [0.29-3.93] 1.42 ± 0.70 1.09 ± 0.52 1.44 ± 0.30 1.31 ± 0.52 Values shown are means ± SD. Triglycerides are shown as median [range]. Login to comment
145 TABLE3.Characteristicsofstudiesincludedinthemeta-analysis Reference Number of SubjectsAge Male/ Female BodyMass IndexEthnicitySingleNucleotidePolymorphismsLipidsNon-CholesterolSterols nyearsnkg/m 2 Berge,2002(5)14855±1174/74NotreportedCaucasianD19H,T400K,Y54C,Q604E,A632VTCCAMP,SITO,CHOLST,LATHO Weggemans,2002(7)48626.3±11.6257/22921.7±3.0CaucasianQ604ETC- Gylling,2004(13)26253.1±8.1143/11926.4±6.5CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Plat,2005(11)a 11233±1641/7122.9±3.6CaucasianT400K,Q604E,A632VLDL-C,HDL-C,TGCAMP,SITO,LATHO Acalovschi,2006(27)72 e 56.3(36-80)30/4230.1±4.9CaucasianD19H,T400K,Y54C,Q604E,A632VTC,HDL-C,TG- Jakulj,etal. b 24558.4±7.5189/4825.8±3.0CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Miwa,2005(28)10062.4±12.148/5223.0±3.5AsianT400K,Y54C,Q604E-SITO,LATHO Wang,2007(29) a,c 13454.1±8.1134/023.2±2.3AsianT400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chen,2008(8) a 104647.0±9.3894/15224.9±2.4AsianD19H,T400K,Y54C,Q604E i TC,LDL-C,HDL-C,TG- Caamano,2008(30) d 10440±1058/4625.5±3.3HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- 11844±771/4727.6±4.9HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- Santosa,2007(31) a 3549.4±6.70/3531.4±2.8Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Rudkowska,2008(32)2659.6±9.615/1126.4±2.7Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chan,2004(33) a 4754.5±8.447/032±3.6Notreported g D19H,T400KTC,LDL-C,HDL-C,TGCAMP,SITO,LATHO Kajinami,2004(12) a 33858±11203/13527.0±3.0Notreported h D19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TG- Herron,2006(9) a 9131.1±9.240/5124.8±4.7Notreported h Q604ETC,LDL-C,HDL-C- Total(WM)336446.7±10.52251/111323.9±3.5 Numberandcharacteristicsofstudiesincludedinthemeta-analysis.CAMP,campesterol/TCratio;CHOLST,cholestanol/TCratio;HDL-C,HDL-cholesterol;LATHO,lathosterol/TCratio;LDL-C, LDL-cholesterol;SITO,sitosterol/TCratio;TC,totalcholesterol;TG,triglyceride;WM,weightedmean. Login to comment
12 We first investigated associations between five common ABCG5/G8 polymorphisms (p.Q604E, p.D19H, p.Y54C, p. T400K, and p.A632V) and plasma sterol levels in 245 hypercholesterolaemic individuals. Login to comment
68 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
125 However, in silico analysis by polyphen predicts p.D19H as a benign variant, and no relation was found between this SNP and ABCG8 mRNA expression levels in human liver tissue samples (38). Login to comment
126 Of note, in silico analyses of the remaining four variants predicted only the p.Y54C polymorphism to be damaging. Login to comment
66 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
124 Of note, in silico analyses of the remaining four variants predicted only the p.Y54C polymorphism to be damaging. Login to comment
139 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment
144 Characteristics of studies included in the meta-analysis Reference Number of Subjects Age Male/ Female Body Mass Index Ethnicity Single Nucleotide Polymorphisms Lipids Non-Cholesterol Sterols n years n kg/m 2 Berge, 2002 (5) 148 55 &#b1; 11 74/74 Not reported Caucasian D19H, T400K, Y54C, Q604E, A632V TC CAMP, SITO, CHOLST, LATHO Weggemans, 2002 (7) 486 26.3 &#b1; 11.6 257/229 21.7 &#b1; 3.0 Caucasian Q604E TC - Gylling, 2004 (13) 262 53.1 &#b1; 8.1 143/119 26.4 &#b1; 6.5 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Plat, 2005 (11) a 112 33 &#b1; 16 41/71 22.9 &#b1; 3.6 Caucasian T400K, Q604E, A632V LDL-C, HDL-C, TG CAMP, SITO, LATHO Acalovschi, 2006 (27) 72 e 56.3 (36-80) 30/42 30.1 &#b1; 4.9 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, HDL-C, TG - Jakulj, et al. b 245 58.4 &#b1; 7.5 189/48 25.8 &#b1; 3.0 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Miwa, 2005 (28) 100 62.4 &#b1; 12.1 48/52 23.0 &#b1; 3.5 Asian T400K, Y54C, Q604E - SITO, LATHO Wang, 2007 (29) a , c 134 54.1 &#b1; 8.1 134/0 23.2 &#b1; 2.3 Asian T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chen, 2008 (8) a 1046 47.0 &#b1; 9.3 894/152 24.9 &#b1; 2.4 Asian D19H, T400K, Y54C, Q604E i TC, LDL-C, HDL-C, TG - Caamano, 2008 (30) d 104 40 &#b1; 10 58/46 25.5 &#b1; 3.3 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - 118 44 &#b1; 7 71/47 27.6 &#b1; 4.9 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - Santosa, 2007 (31) a 35 49.4 &#b1; 6.7 0/35 31.4 &#b1; 2.8 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Rudkowska, 2008 (32) 26 59.6 &#b1; 9.6 15/11 26.4 &#b1; 2.7 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chan, 2004 (33) a 47 54.5 &#b1; 8.4 47/0 32 &#b1; 3.6 Not reported g D19H, T400K TC, LDL-C, HDL-C, TG CAMP, SITO, LATHO Kajinami, 2004 (12) a 338 58 &#b1; 11 203/135 27.0 &#b1; 3.0 Not reported h D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG - Herron, 2006 (9) a 91 31.1 &#b1; 9.2 40/51 24.8 &#b1; 4.7 Not reported h Q604E TC, LDL-C, HDL-C - Total (WM) 3364 46.7 &#b1; 10.5 2251/ 1113 23.9 &#b1; 3.5 Number and characteristics of studies included in the meta-analysis. Login to comment
67 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
140 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment

PMID: 21039829 [PubMed] Yoon JH et al: "ABCG8 D19H polymorphism: a basis for the genetic prediction of cholesterol gallstone disease."

No. Sentence Comment

15 Wang et al.11 examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H,Y54C, T400K, A632V) genes in 287 patients with gallstone disease. Login to comment

PMID: 21128988 [PubMed] Wei KK et al: "Interactions between CYP7A1 A-204C and ABCG8 C1199A polymorphisms on lipid lowering with atorvastatin."

No. Sentence Comment

27 Several previous studies have found that 5 nonsynonymous single-nucleotide polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may affect plasma plant sterol or cholesterol levels (16-19). Login to comment
29 Allele frequencies of 19H and 632V were found to be rare in a Chinese population (20), and the Y54C and T400K alleles showed strong linkage disequilibrium. Login to comment

PMID: 21437027 [PubMed] Izar MC et al: "Phytosterols and phytosterolemia: gene-diet interactions."

No. Sentence Comment

127 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment
129 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment

PMID: 17495606 [PubMed] Levy E et al: "Intestinal cholesterol transport proteins: an update and beyond."

No. Sentence Comment

100 On the other hand, patients with primary hypercholesterolemia, according to NCEP,were associated with a specific ABCB1 haplotype, suggesting this polymorphism may contribute to increased plasma cholesterol and LDL levels [42].ABCG8(A632V,T400K,Y54C)andABCG5(Q604E) variants, however, are likely to be important forthe genetic determination of plasma cholesterol levels, probably via their influence on intestinal absorption and biliary secretion [43-45]. Login to comment

PMID: 17626266 [PubMed] Grunhage F et al: "Increased gallstone risk in humans conferred by common variant of hepatic ATP-binding cassette transporter for cholesterol."

No. Sentence Comment

94 In contrast to ABCG8 D19H, no significant single-point linkage was detected for the other ABCG5/G8 SNPs (p.E604Q, p.Y54C, p.T400K, p.A632V). Login to comment
52 Forgenotyping,weselectedfunctionallyrelevantnonsyn- onymous coding single-nucleotide polymorphisms (SNPs) of the ABCG5/G8 genes (Fig. 1): ABCG5 rs6720173 ϭ c.1810GϾC(p.E604Q);ABCG8rs11887534ϭc.55GϾC (p.D19H), rs4148211 ϭ c.161AϾG (p.Y54C), rs4148217 ϭ c.1199CϾA (p.T400K), and rs6544718 ϭ c.1895CϾT (p.A632V).22,23,25,28,29 All SNPs were genotyped using solution-phase hybridization reactions with 5Ј-nuclease and fluorescence detection (TaqMan assays) in a 7300 Real-Time polymerase chain reaction (PCR) system (Applera, Norwalk, CT). Login to comment

PMID: 17632509 [PubMed] Buch S et al: "A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease."

No. Sentence Comment

148 Table 3 Haplotype analysis of seven SNPs at the ABCG8 locus in panels B and C Fine mapping, panel B Fine mapping, panel C Haplotype fcases fcontrols ORcase-control PCOCAPHASE fcases fcontrols ORcase-control PCOCAPHASE C-G-A-T-G-T-C 0.340 0.382 0.8 0.01 0.349 0.392 0.8 0.02 T-G-G-T-G-T-G 0.342 0.325 1.1 0.24 0.340 0.325 1.1 0.38 C-G-G-T-G-T-G 0.066 0.071 0.9 0.53 0.077 0.069 1.1 0.42 C-G-A-T-G-T-G 0.067 0.068 1.0 0.89 0.060 0.068 0.9 0.33 C-C-A-C-A-T-C 0.097 0.045 2.3 7.75 Â 10-7 0.080 0.038 2.2 8.76 Â 10-7 C-G-A-T-G-A-C 0.023 0.043 0.5 5.73 Â 10-4 0.028 0.042 0.7 0.03 T-G-A-T-G-A-C 0.025 0.033 0.8 0.12 0.020 0.033 0.6 0.03 T-G-A-T-G-A-C 0.028 0.024 1.2 0.53 0.036 0.028 1.3 0.305 SNPs included in the haplotype analysis (rs4148187, rs11887534 (D19H), rs4148211 (Y54C), SNP_A-1791411, rs4953023, rs17424122 and rs17409589) are marked by an asterisk in Figure 1. Login to comment

PMID: 20170916 [PubMed] Abellan R et al: "Association of selected ABC gene family single nucleotide polymorphisms with postprandial lipoproteins: results from the population-based Hortega study."

No. Sentence Comment

144 For the studied polymorphisms of the ABCG5 and ABCG8 genes, only rs4148211 (ABCG8 Y54C) obtained significant associations with the TC and LDLc plasma levels in the total population, even after adjusting for total caloric intake or lipid consumption. Login to comment
149 Regarding the Y54H polymorphism, diverging results have been observed in previous studies for associations with lipid levels [13,14,16,18,19]; these divergences in the results could be related with the degree of the reduction of total plasma cholesterol and LDLc with dietary changes [13]. Login to comment
150 In spite of the feed status, which makes comparisons between studies on lipid levels more difficult, to our knowledge, no variations in LDLc levels directly related with the Y54C polymorphism have been observed. Login to comment
151 However, Wang et al. [17] found higher but not significant plasma LDLc levels for carriers of the less frequent K allele of ABCG8 T400K, which was in strong linkage disequilibrium with the SNP Y54C of ABCG8. Login to comment
142 For the studied polymorphisms of the ABCG5 and ABCG8 genes, only rs4148211 (ABCG8 Y54C) obtained significant associations with the TC and LDLc plasma levels in the total population, even after adjusting for total caloric intake or lipid consumption. Login to comment
148 In spite of the feed status, which makes comparisons between studies on lipid levels more difficult, to our knowledge, no variations in LDLc levels directly related with the Y54C polymorphism have been observed. Login to comment

PMID: 22213168 [PubMed] Krawczyk M et al: "Phytosterol and cholesterol precursor levels indicate increased cholesterol excretion and biosynthesis in gallstone disease."

No. Sentence Comment

47 p.Y54C (rs4148211, c__29535502_10), p.T400K (rs4148217, c__375061_10), and p.A632V (rs6544718, c__25642779_10) variants, as described in Supporting Methods. Login to comment
104 Interestingly, the p.Y54C variant is associated with phytosterol levels in the Chilean but not the German cohort (Supporting Table 4A). Login to comment

PMID: 22655090 [PubMed] Li Q et al: "ATP-binding cassette transporter G5 and G8 polymorphisms and several environmental factors with serum lipid levels."

No. Sentence Comment

42 Therefore, the aim of the present study was to explore the association of ABCG5 (rs4131229, i7892 T.C and rs6720173, Q604E G.C) and ABCG8 (rs3806471, 5U145 A.C and rs4148211, Y54C A.G) SNPs and several environmental factors with serum lipid profiles in the Mulao and Han populations. Login to comment
182 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
217 The other ABCG5/G8 SNPs (Q604E, Y54C, T400K and A632V) did not show any significant interactions with the CYP7A1 polymorphism. Login to comment
41 Therefore, the aim of the present study was to explore the association of ABCG5 (rs4131229, i7892 T.C and rs6720173, Q604E G.C) and ABCG8 (rs3806471, 5U145 A.C and rs4148211, Y54C A.G) SNPs and several environmental factors with serum lipid profiles in the Mulao and Han populations. Login to comment
180 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment
215 The other ABCG5/G8 SNPs (Q604E, Y54C, T400K and A632V) did not show any significant interactions with the CYP7A1 polymorphism. Login to comment
216 No association was observed between ABCG8 T400K and total and LDL-C levels [32-34,36,38-41]. Login to comment
181 Allele frequencies of the ABCG8 D19H, Y54C, T400K, and A632V SNPs in patients with ischemic vascular diseases showed no significant differences compared with controls. Login to comment

PMID: 19932478 [PubMed] Lu Y et al: "The potential influence of genetic variants in genes along bile acid and bile metabolic pathway on blood cholesterol levels in the population."

No. Sentence Comment

1748 Several polymorphisms in ABCG5 (Q604E, rs6720173) and ABCG8 (T400K, rs4148217; D19H, rs11887534; A632V, rs6544718; and Y54C, rs4148211) have been found to be associated with several facets of cholesterol metabolism, including cholesterol level, cholesterol kinetics, and individual responsiveness of blood cholesterol to dietary and pharmaceutical intervention [41]. Login to comment
1781 No association was observed between Y54C of ABCG8 and blood total and LDL cholesterol levels [44,45,47-49]. Login to comment
1782 In 35 hypercholesterolemic Canadian women, Santosa et al. [48] showed that the heterozygous Y54C carriers had a smaller decline in cholesterol synthesis compared with homozygous YY carriers during weight loss through decreasing dietary energy intake and increasing energy expenditure. Login to comment
1785 Overall, no consistent results on effects of T400K, A632V and Y54C in ABCG8 gene on blood cholesterol levels and cholesterol metabolic kinetics were reported so far. Login to comment
1787 No modulating effect was observed from T400K, A632V or Y54C on cholesterol lowering response to atorvastatin [25,26]. Login to comment
1802 Recently, in 845 self-identified Puerto Ricans from Boston, Junyent et al. [47] reported that ABCG5/G8 (i7892T > C, rs4131229; 5U145A > C, rs3806471; Y54C; T400K) SNPs were significantly associated with HDL-C concentrations. Login to comment
1863 Genes Genetic variant Reference Study population Observed associationb ABCG8 A632V (rs6544718, C > T) Berge et al. [44] 143 healthy American Caucasians Higher TC in V allele carriers than AA Viturro et al. [43] 1227 healthy Spanish school children Higher TC, LDL-C and apoB levels in heterozygotes than homozygotes of wide-type allele, but only in the low cholesterol intake group (380 children) Hubacek et al. [46] 285 Czech participants No difference in TC, LDL-C and HDL-C Acalovschi et al. [49] 68 Romanian siblings with gallstone disease No difference in TC and HDL-C Plat et al. [50] 112 healthy Dutch volunteers No difference in LDL-C and HDL-C Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians No modulating effect from A632V on cholesterol lowering response to atorvastatin ABCG8 Y54C (rs4148211, A > G) Berge et al. [44] 139 healthy American Caucasians No difference in TC Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects No difference in TC, LDL-C and HDL-C Junyent et al. [47] 845 self-identified Puerto Ricans No difference in TC and LDL-C, but C allele carriers had a lower HDL-C than YY. Login to comment
1864 Santosa et al. [48] 42 overweight/obese Canadian women No difference in TC and LDL-C Acalovschi et al. [49] 68 Romanian siblings with gallstone disease No difference in TC and HDL-C Santosa et al. [48] 42 overweight/obese Canadian women Smaller decline in heterozygous Y54C carriers in cholesterol synthesis than YY during weight loss Hubacek et al. [46] 285 Czech participants Y allele carriers had larger reduction in TC and LDL-C than the CC, but only in female subjects. Login to comment
1865 Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians No modulating effect from Y54C on cholesterol lowering response to atorvastatin ABCG8 M429V (A > G) Miwa et al. [56] 100 hypercholesterolaemic Japanese subjects M429V variant associated with higher cholesterol absorption ABCG8 rs4131229 (T > C), rs3806471 (A > C) Junyent et al. [47] 845 self-identified Puerto Ricans Lower HDL-C in rare allele carriers than wild-type homozygotes, no difference in TC and LDL-C ABCG8 rs6709904 (A > G) Junyent et al. [47] 845 self-identified Puerto Ricans Lower LDL-C in rare allele carriers than wild-type homozygotes, no difference in TC and HDL-C NPC1L1 g.-113A > Gg.-18C > A-g.1679C > G (L272L, rs2072183) Simon et al. [66] 1208 hypercholesterolemic individuals participating in the ezetimibe + statin treatment arm of the EASE trial [104] and 1132 hypercholesterolemic individuals participating in Vytorin vs. Login to comment

PMID: 19071091 [PubMed] Jiang ZY et al: "Increased NPC1L1 and ACAT2 expression in the jejunal mucosa from Chinese gallstone patients."

No. Sentence Comment

4 The frequency of two SNPs in the ABCG8 gene (Y54C and T400K) was determined by allelic discrimination. Login to comment
7 No correlations were observed between patients carrying the different genotypes for Y54C or T400K and their mRNA levels for ABCG5 or ABCG8. Login to comment
55 Single nucleotide polymorphism (SNP) analysis of the polymorphic sites Y54C and T400K in the ABCG8 gene were determined by allelic discrimination using intestinal cDNA as template. Login to comment
56 The following sequences were utilized for PCR primers and Taqman probes: Y54C: forward primer: ACA GTG GCC AGC CCA ACA; reverse primer: AGC CAG CTG CTC AAA CCA A. Login to comment
85 for the Y54C and T400K polymorphisms in ABCG8 gene in the GS and GSF patients. Login to comment
88 The campesterol and sitosterol levels were lower in subjects heterozygous or homozygous for the Y54C or the T400K polymorphism compared to individuals homozygous for the WT allele, but significance was only obtained for campesterol (Table 1, P < 0.05). Login to comment
100 (C) Comparison between mRNA levels of the genes ABCG5/G8, NPC1L1 and ACAT2 in the individuals of the total material (GS + GSF) with reference to the Y54C polymorphic site in the ABCG8 gene. Login to comment
102 Table 1 Plasma lipid and plant sterol levels in the total material with reference to the polymorphic sites Y54C and T400K in the ABCG8 gene (means ± SEM). Login to comment

PMID: 17612515 [PubMed] Wang Y et al: "ATP binding cassette G8 T400K polymorphism may affect the risk of gallstone disease among Chinese males."

No. Sentence Comment

2 To investigate a possible association between transporter gene polymorphism and gallstone formation, we examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) genes in patients with gallstone disease (GS). Login to comment
6 Results: 2 SNPs of ABCG8 gene (Y54C and T400K) showed strong linkage disequilibrium (D'=0.824, r2 =0.579). Login to comment
24 Of these variants, it is suggested that 5 non-synonymous single nucleotide polymorphisms (SNPs) in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may effect plasma plant sterol or cholesterol levels [11-14]. Login to comment
41 Four SNP sites in ABCG5 Q604E, ABCG8 Y54C, ABCG8 T400K, and ABCG8 A632V were assayed by PCR amplification and RFLP analysis, as previously described [10,11]. Login to comment
72 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
79 Thus, only the Y54C and T400K SNPs showed strong linkage disequilibrium (D'N0.8, r2 N1/3) [19]. Login to comment
82 No differences were observed when the frequencies of ABCG5 Q604E, ABCG8 D19H, and Y54C and A632V were compared between GS and Table 3 Frequency distribution of the different genotypes and alleles of 5 common ABCG5 and ABCG8 polymorphisms in GS and GSF Polymorphism All (%) Men (%) Women (%) GS GSF GS GSF GS GSF (n=287) (n=219) (n=121) (n=105) (n=166) (n=114) ABCG5:Q604E QQ 78.7 80.4 78.5 78.1 78.9 82.5 QE 20.9 18.7 21.5 20.0 20.5 17.5 EE 0.3 0.9 0 1.9 0.6 0 E allele 10.8 10.3 10.7 11.9 10.8 8.8 OR [95% CI]a 0.95 [0.63~1.42] 1.12 [0.63~2.01] 0.79 [0.45~1.41] ABCG8:D19H DD 98.3 98.6 99.2 99.0 97.6 98.2 DH 1.7 1.4 0.8 1.0 2.4 1.8 HH 0 0 0 0 0 0 H allele 0.9 0.7 0.4 0.5 1.2 0.9 OR [95% CI] 1.27 [0.30~5.36] 0.87 [0.05~13.95] 1.38 [0.25~7.59] ABCG8:Y54C YY 77.4 79.9 76.0 83.8 78.3 76.3 YC 22.3 18.3 24.0 14.3 21.1 21.9 CC 0.3 1.8 0 1.9 0.6 1.8 C allele 11.5 11.0 12.0 9.0 11.1 12.7 OR [95% CI] 1.06 [0.71~1.57] 1.369 [0.74~2.52] 0.861 [0.51~1.45] ABCG8:T400K TT 79.1 83.1 75.2 87.6 81.9 78.9 TK 20.6 16.4 24.8b 12.4 17.5 20.2 KK 0.3 0.5 0 0 0.6 0.9 K allele 10.6 8.7 12.4c 6.2 9.3 11.0 OR [95% CI] 1.25 [0.82~1.92] 2.14 [1.09~4.23] 0.83 [0.48~1.46] ABCG8:A632V AA 99.0 99.1 99.2 100.0 98.8 98.2 AV 1.0 0.9 0.8 0 1.2 1.8 VV 0 0 0 0 0 0 V allele 0.5 0.5 0.4 0 2(0.6) 0.9 OR [95% CI] 0.87 [0.14~5.27] 0.382 [0.02~9.44]d 1.46 [0.20~10.44] a Odds ratio (OR) statistics and 95% confidence intervals (95% CI) were calculated from allele distributions. Login to comment
99 Due to limited number of subjects, heterozygous and homozygous carriers of the genetic variants were combined as follows: ABCG5 Q604E (QE+EE), ABCG8 Y54C (YC+CC), and ABCG8 (TK+KK). Login to comment
102 However, no significant differences were found in the plasma and biliary lipid levels or biliary CSI of subjects with different genotypes of ABCG5 Q604E and ABCG8 Y54C. Login to comment
73 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
80 Thus, only the Y54C and T400K SNPs showed strong linkage disequilibrium (D'N0.8, r2 N1/3) [19]. Login to comment
83 No differences were observed when the frequencies of ABCG5 Q604E, ABCG8 D19H, and Y54C and A632V were compared between GS and Table 3 Frequency distribution of the different genotypes and alleles of 5 common ABCG5 and ABCG8 polymorphisms in GS and GSF Polymorphism All (%) Men (%) Women (%) GS GSF GS GSF GS GSF (n=287) (n=219) (n=121) (n=105) (n=166) (n=114) ABCG5:Q604E QQ 78.7 80.4 78.5 78.1 78.9 82.5 QE 20.9 18.7 21.5 20.0 20.5 17.5 EE 0.3 0.9 0 1.9 0.6 0 E allele 10.8 10.3 10.7 11.9 10.8 8.8 OR [95% CI]a 0.95 [0.63~1.42] 1.12 [0.63~2.01] 0.79 [0.45~1.41] ABCG8:D19H DD 98.3 98.6 99.2 99.0 97.6 98.2 DH 1.7 1.4 0.8 1.0 2.4 1.8 HH 0 0 0 0 0 0 H allele 0.9 0.7 0.4 0.5 1.2 0.9 OR [95% CI] 1.27 [0.30~5.36] 0.87 [0.05~13.95] 1.38 [0.25~7.59] ABCG8:Y54C YY 77.4 79.9 76.0 83.8 78.3 76.3 YC 22.3 18.3 24.0 14.3 21.1 21.9 CC 0.3 1.8 0 1.9 0.6 1.8 C allele 11.5 11.0 12.0 9.0 11.1 12.7 OR [95% CI] 1.06 [0.71~1.57] 1.369 [0.74~2.52] 0.861 [0.51~1.45] ABCG8:T400K TT 79.1 83.1 75.2 87.6 81.9 78.9 TK 20.6 16.4 24.8b 12.4 17.5 20.2 KK 0.3 0.5 0 0 0.6 0.9 K allele 10.6 8.7 12.4c 6.2 9.3 11.0 OR [95% CI] 1.25 [0.82~1.92] 2.14 [1.09~4.23] 0.83 [0.48~1.46] ABCG8:A632V AA 99.0 99.1 99.2 100.0 98.8 98.2 AV 1.0 0.9 0.8 0 1.2 1.8 VV 0 0 0 0 0 0 V allele 0.5 0.5 0.4 0 2(0.6) 0.9 OR [95% CI] 0.87 [0.14~5.27] 0.382 [0.02~9.44]d 1.46 [0.20~10.44] a Odds ratio (OR) statistics and 95% confidence intervals (95% CI) were calculated from allele distributions. Login to comment
100 Due to limited number of subjects, heterozygous and homozygous carriers of the genetic variants were combined as follows: ABCG5 Q604E (QE+EE), ABCG8 Y54C (YC+CC), and ABCG8 (TK+KK). Login to comment
103 However, no significant differences were found in the plasma and biliary lipid levels or biliary CSI of subjects with different genotypes of ABCG5 Q604E and ABCG8 Y54C. Login to comment

PMID: 17098593 [PubMed] Acalovschi M et al: "Are plasma lipid levels related to ABCG5/ABCG8 polymorphisms? A preliminary study in siblings with gallstones."

No. Sentence Comment

54 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
78 Triglyceride levels in the carriers of the common alleles were higher than in the carriers of the rare alleles for the ABCG5 Q604E ( p=0.002), ABCG8 D19H ( p=0.058), and ABCG8 Y54C ( p=0.050) sequence variants (Table 4). Login to comment
109 Variation in plasma concentrations of non-cholesterol sterols has been demonstrated to be highly heritable, and D19H and T400K polymorphisms in ABCG8 have been found to contribute to genetic variations in the plasma concentrations of plant sterols [10]. Login to comment
110 Other polymorphisms in ABCG8 (A632V [10], T400K, and Y54C [27]) and in ABCG5 (Q604E [28]) have been suggested to be associated with plasma cholesterol levels. Login to comment
111 In our siblings with gallstones we found significantly higher plasma triglyceride levels in carriers of the common alleles for the polymorphisms Q604E in ABCG5 and D19H and Y54C in ABCG8 than in carriers of the rare alleles. Login to comment
119 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5±57.3 205.7±32.6 48.1±13.2 CC=44 154.1±67.3 204.6±39.2 45.6±18.2 T400K CA/AA=30 168.5±76.9 209.9±37.5 46.0±17.3 CC=42 144.7±50.1 201.5±35.8 48.2±14.4 Y54C AG/GG=44 144.5±58.4 202.7±39.6 44.9±17.0 AA=28 170.6±68.3 210.3±32.8 48.0±15.6 D19H GC/CC=12 130.9±52.6 192.5±27.3 49.0±19.5 GG=60 159.4±64.5 208.3±38.4 46.0±16.0 ABCG5 Q604E CG/GG=24 127.4±51.9 191.7±35.1 55.9±12.9 CC=48 168.2±64.5 212.7±36.3 42.7±15.7 did not correlate with those in controls. Login to comment
53 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
77 Triglyceride levels in the carriers of the common alleles were higher than in the carriers of the rare alleles for the ABCG5 Q604E ( p=0.002), ABCG8 D19H ( p=0.058), and ABCG8 Y54C ( p=0.050) sequence variants (Table 4). Login to comment
118 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5&#b1;57.3 205.7&#b1;32.6 48.1&#b1;13.2 CC=44 154.1&#b1;67.3 204.6&#b1;39.2 45.6&#b1;18.2 T400K CA/AA=30 168.5&#b1;76.9 209.9&#b1;37.5 46.0&#b1;17.3 CC=42 144.7&#b1;50.1 201.5&#b1;35.8 48.2&#b1;14.4 Y54C AG/GG=44 144.5&#b1;58.4 202.7&#b1;39.6 44.9&#b1;17.0 AA=28 170.6&#b1;68.3 210.3&#b1;32.8 48.0&#b1;15.6 D19H GC/CC=12 130.9&#b1;52.6 192.5&#b1;27.3 49.0&#b1;19.5 GG=60 159.4&#b1;64.5 208.3&#b1;38.4 46.0&#b1;16.0 ABCG5 Q604E CG/GG=24 127.4&#b1;51.9 191.7&#b1;35.1 55.9&#b1;12.9 CC=48 168.2&#b1;64.5 212.7&#b1;36.3 42.7&#b1;15.7 did not correlate with those in controls. Login to comment

PMID: 15262185 [PubMed] Kajinami K et al: "Interactions between common genetic polymorphisms in ABCG5/G8 and CYP7A1 on LDL cholesterol-lowering response to atorvastatin."

No. Sentence Comment

43 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (±S.D.) of age and BMI were 58 ± 11 years old and 27.0 ± 3.0 kg/m2, respectively [15]. Login to comment
94 Interaction between other ABCG5/G8 polymorphisms and the CYP7A1 A-204C polymorphism Among the remaining four polymorphisms in ABCG5/G8 (Tables 2 and 3), only Y54C showed a potential interaction with the CYP7A1 A-204C polymorphism. Login to comment
95 The difference in LDL cholesterol reduction across the three CYP7A1 genotypes was greater in Y54C mutant allele homozygotes than in Y54C wild type allele homozygotes (10.5% versus 3.4%) (Table 2). Login to comment
97 We again reclassified subjects to test cumulative allele effects, as we had done for the ABCG8 D19H variant. Login to comment
98 In this case, the differences in LDL cholesterol reduction across the newly categorized groups were 5.5% in a dominant model for Y54C, and 7.5% in a recessive model, both of which were smaller than those observed for the D19H polymorphism (8.5%, Fig. 1). Login to comment
99 Stepwise multiple regression analysis also failed to show any significant association between LDL cholesterol reduction and Y54C genotype in any type of model (data not shown). Login to comment
44 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (&#b1;S.D.) of age and BMI were 58 &#b1; 11 years old and 27.0 &#b1; 3.0 kg/m2, respectively [15]. Login to comment
74 Table 2 Associations between ABCG8 Y54C/CYP7A1 A-204C and the LDL-lowering response to atorvastatin * ABCG8 Y54C All subjects CYP7A1 P-values among CYP7A1 genotype ߤ Unadjusted Adjusted AA AC CC Additive Dominant Recessive YY 36.3 &#b1; 10.0 36.3, 34.7-37.8 (138) 37.5, 34.4-40.6 (34) 36.4, 34.4-38.8 (79) 34.1, 30.5-37.7 (25) 0.311 0.358 0.155 YC 36.9 &#b1; 9.7 37.0, 35.4-38.5 (145) 38.7, 36.2-41.3 (50) 36.4, 34.1-38.8 (58) 35.4, 32.5-38.4 (37) 0.215 0.088 0.278 CC 38.9 &#b1; 9.7 38.7, 36.2-41.2 (54) 42.4, 37.9-46.9 (16) 39.1, 35.7-42.5 (28) 31.9, 26.1-37.6 (10) 0.014 0.048 0.008 P-values among ABCG8 genotype ߤ Additive 0.247 0.253 0.168 0.362 0.614 - - - Dominant 0.286 0.240 0.226 0.534 0.750 - - - P-value in testing genotype interaction between ABCG8 and CYP7A1 using two-way ANOVA were 0.439 when additive model of both genotypes are used; 0.709 when a dominant model of ABCG8 and a recessive model of CYP7A1 were used, and 0.073 when a recessive model for each genotype was used. Login to comment
96 Interaction between other ABCG5/G8 polymorphisms and the CYP7A1 A-204C polymorphism Among the remaining four polymorphisms in ABCG5/G8 (Tables 2 and 3), only Y54C showed a potential interaction with the CYP7A1 A-204C polymorphism. Login to comment
100 In this case, the differences in LDL cholesterol reduction across the newly categorized groups were 5.5% in a dominant model for Y54C, and 7.5% in a recessive model, both of which were smaller than those observed for the D19H polymorphism (8.5%, Fig. 1). Login to comment
101 Stepwise multiple regression analysis also failed to show any significant association between LDL cholesterol reduction and Y54C genotype in any type of model (data not shown). Login to comment

PMID: 23340007 [PubMed] Krawczyk M et al: "Genetics of biliary lithiasis from an ethnic perspective."

No. Sentence Comment

39 For this study, common ABCG5 (p.Q604E) and ABCG8 (p.D19H, p.Y54C, p.T400K, p.A632V) variants were selected and the nonparametric linkage (NPL) as well as case-control analyses were performed. Login to comment

PMID: 24498041 [PubMed] Jiang ZY et al: "Association of three common single nucleotide polymorphisms of ATP binding cassette G8 gene with gallstone disease: a meta-analysis."

No. Sentence Comment

2 Genotypes of Y54C and T400K in the ABCG8 gene were determined by allelic discrimination using either genomic DNA or hepatic cDNA as template by Taqman assays. Login to comment
5 In the genotype model, the overall association between genotype with gallstone was significant for D19H (OR = 2.43, 95%CI: 2.23-2.64, P,0.001), and for Y54C (OR = 1.36, 95%CI: 1.01-1.83, P = 0.044), or T400K (OR = 1.17, 95%CI: 0.96-1.43. Login to comment
8 However, minor allele of Y54C polymorphism (allele Y, OR = 1.08, 95%CI: 0.96-1.21, P = 0.146) was not related with gallstone disease. Login to comment
11 However, no association of T400K and Y54C polymorphism with hepatic ABCG8/G5 mRNA expression or biliary lipids composition was found. Login to comment
13 T400K and Y54C polymorphism, though to a less extent, may also relate with gallstone disease. Login to comment
32 The most studied loci are D19H, T400K and Y54C. Login to comment
37 The aims of our study are: 1) to evaluate the association between polymorphisms at D19H, T400K and Y54C and gallstone disease using meta-analysis; 2) to compare the hepatic ABCG5/G8 mRNA expression and biliary lipids composition in patients with different genotypes of T400K and Y54C. Methods Literature Search Publication were searched via public database PubMed (http:// www.ncbi.nlm.nih. Login to comment

PMID: 24657701 [PubMed] Stender S et al: "The ABCG5/8 cholesterol transporter and myocardial infarction versus gallstone disease."

No. Sentence Comment

22 We genotyped all common nonsynonymous variants (minor allelefrequency >5%) inABCG5/ 8 (ABCG8D19H, Y54C, T400K, A632V; ABCG5 Q604E) and a functional intronic variant (ABCG8 IVS3&#fe;981) in 2 prospective studies of the Danish general population, CGPS (Copenhagen General Population Study) and CCHS (Copenhagen City Heart Study), and in a case-control study, CIHDS (Copenhagen Ischemic Heart Disease Study), totaling 60,239 participants, including 5,647 with MI and 3,174 with symptomatic gallstone disease. Login to comment
40 From the 5 genotypes that were individually associated with reductions in LDL cholesterol levels, we generated combined, weighted genotype scores based on the percentage reductions in LDL cholesterol compared to the reference genotype: ABCG8 D19H, DD &#bc; 0, DH &#bc; 2.7, HH &#bc; 5.8; IVS3&#fe;981 T>C, CC &#bc; 0, TC &#bc; 2.5, TT &#bc; 4.5; Y54C, YY &#bc; 0, YC &#bc; 0.2, CC &#bc; 1.1; T400K, TT &#bc; 0, TK &#bc; 0.9, KK &#bc; 2.9; A632V, VV &#bc; 0, AV &#bc; 0.9, AA &#bc; 1.1. Login to comment
45 In analyses stratified on ABCG8 D19H, a weighted genotype score without D19H was constructed (i.e., including IVS3&#fe;981, Y54C, T400K, and A632V). Login to comment
78 For the individual genotypes, ORs for MI ranged from 0.83 (95% CI: 0.76 to 0.92) for IVS3&#fe;981 TT to 1.07 (95% CI: 0.91 to 1.25) for T400K KK versus noncarriers, while ORs for gallstone disease ranged from 3.82 (95% CI: 2.66 to 5.49) for D19H HH to 1.11 (95% CI: 0.99 to 1.23) for Y54C CC versus noncarriers (Online Fig. 3). Login to comment
87 The corresponding multifactorially adjusted ORs for MI and symptomatic gallstone disease were 0.88 (95% CI: 0.80 to 0.98), and 1.74 (95% CI: 1.48 to 2.05), respectively (p for trend Figure 2 Lipid and Lipoprotein Levels as a Function of ABCG5/8 Genotypes, Individually and Combined The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test. Login to comment
105 Figure 3 Cumulative Incidence of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of Age and ABCG5/8 Genotype Score The genotype score was constructed by summation of weighted low-density lipoprotein cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are by log-rank trend test. Login to comment
122 For instance, a common intronic ABCG8 variant was recently used together with Figure 4 Risk of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of ABCG5/8 Genotype Score The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering genotypes of adenosine triphosphate-binding cassette transporter G8 (ABCG8) D19H, IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test, or for trend tests of odds ratios (ORs). Login to comment
159 However, other cohorts with measurements of both LDL cholesterol and plant sterols may be better suited to directly assess the LDL cholesterol Figure 6 Risk of Myocardial Infarction and Symptomatic Gallstone Disease as a Function of ABCG5/8 Genotype Score on a D19H DD Background The genotype score was constructed by summation of weighted low-density lipoprotein (LDL) cholesterol lowering alleles of adenosine triphosphate-binding cassette transporter G8 (ABCG8) IVS3&#fe;981, T400K, Y54C, and A632V. The p values are for trend tests by Cuzick`s extension of a Wilcoxon rank sum test, or for trend tests of odds ratios (ORs). Login to comment

PMID: 25920552 [PubMed] Rodriguez S et al: "Lipids, obesity and gallbladder disease in women: insights from genetic studies using the cardiovascular gene-centric 50K SNP array."

No. Sentence Comment

139 The rs4299376:G4T variant, also in ABCG8, tags an independent effect, possibly reflecting an earlier report of NM_022437.2(ABCG8):c.161A4G (p.Tyr54Cys) (r2 ~ 0.2 between rs4299376:G4T and rs4148211:A4G in Europeans) on GBD in Taiwanese. Login to comment

PMID: 26088706 [PubMed] Gok O et al: "ABCG5 and ABCG8 gene polymorphisms in type 2 diabetes mellitus in the Turkish population."

No. Sentence Comment

41 There is no investigation related to ABCG5 Gln604Glu and ABCG8 Tyr54Cys single nucleotide polymorphisms (SNPs) and lipid levels in patients with diabetes. According to this knowledge, we aimed to investigate the association between ABCG5 and ABCG8 gene polymorphisms and lipid levels in Turkish patients with type 2 diabetes as compared to controls. Login to comment
55 Determination of ABCG5 Gln604Glu and ABCG8 Tyr54Cys polymorphisms ABCG5 and ABCG8 gene polymorphisms were analyzed using the PCR-restriction fragment length polymorphism (RFLP) method, as described previously (21). Login to comment
56 A segment of the ABCG5 gene encompassing the Gln604Glu polymorphic site was amplified with the help of PCR by using the forward (5`-AAC CAC ACC TGA CAC TGT CAA TCT TTT CCT-3`) and reverse primers (5`-GGG CAG GTT TTC TCA ATG AAT TGA ATT CCT C-3`), and a segment of the ABCG8 gene encompassing the Tyr54Cys polymorphic site was amplified using the forward (5`-AGG GCC TCC AGG ATA GAT TGT TCT CCT C-3`) and reverse primers (5`CCT TGA ACC CAG GCG TGC GCC TAC CTG-3`) (21). Login to comment
73 * p<0.05. Table 2 Distribution of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes and alleles in study groups Patients (n&#bc;80) Controls (n&#bc;135) p % n % n ABCG5 Gln604Glu genotype CC 36.2* 29 60.3 44 0.003 GG 22.5* 18 9.6 7 0.031 CG 41.2 33 30.1 22 NS Allele C 56.8* 91 75.4 110 0.031 G 43.2* 69 24.6 36 0.003 ABCG8 Tyr54Cys genotype AA 55.0* 44 21.9 16 0.001 GG 12.5 10 12.3 9 NS AG 32.5* 26 65.8 48 0.001 Allele A 71.2 114 54.80 80 NS G 28.8* 46 45.20 66 0.001 n, Number of individuals; NS, not significant. Login to comment
75 * p<0.05. Table 3 Distribution of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes and alleles by gender in study groups Patients (n&#bc;80) Controls (n&#bc;73) Female (n&#bc;59) Male (n&#bc;21) Female (n&#bc;26) Male (n&#bc;47) % n % n % n % n ABCG5 Gln604Glu genotype CC 33.9 20 42.9 9 61.5 16 59.6 28 GG 25.4 15 14.3 3 19.2 5 4.2 2 CG 40.7 24 42.9 9 19.2 5 36.2 17 Allele C 54.2 64 64.28 27 71.1 37 77.7 73 G 45.8 54 35.72 15 28.85 15 22.3 21 ABCG8 Tyr54Cys genotype AA 62.7* 37 33.3 7 19.2 5 23.4 4 GG 13.6 8 9.5 2 7.7 2 14.9 7 AG 23.7 14 57.2* 12 73.1 19 61.7 29 Allele A 74.6 88 61.9 26 55.7 29 54.3 51 G 25.4 30 38.1* 16 44.3 23 45.7 43 n, Number of individuals. Login to comment
79 Frequencies of ABCG5 and ABCG8 gene polymorphisms The frequencies of genotypes and alleles in ABCG5 Gln604Glu and ABCG8 Tyr54Cys genes in both control and patient groups are shown in Table 2. Login to comment
84 The distributions of genotypes and alleles in ABCG5 Gln604Glu and ABCG8 Tyr54Cys genes bygenderare showninTable 3. Login to comment
89 Some frequencies of genotypes were not in the Hardy-Weinberg equilibrium (frequency of the ABCG8 Tyr54Cys genotype in control subjects, frequency of the ABCG8 Tyr54Cys genotype in female patients, frequency of the ABCG5 Gln604Glu genotype and Tyr54Cys genotypes in female control subjects, and frequency of the ABCG5 Tyr54Cys genotype in male control subjects). Login to comment
94 Discussion Type 2 diabetes mellitus is associated with gene-environment interactions due to epigenetic factors, such as defects in lipid metabolism, hyperlipidemia, hypertension, obesity, smoking and Table 4 Comparison of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes with lipid/anthropometric parameters in study groups ABCG5 Gln604Glu genotype ABCG8 Tyr54Cys genotype Patients (n&#bc;80) Controls (n&#bc;73) Patients (n&#bc;80) Controls (n&#bc;73) CC (n&#bc;29) GG (n&#bc;18) CG (n&#bc;33) P CC (n&#bc;29) GG (n&#bc;18) CG (n&#bc;33) P AA (n&#bc;44) GG (n&#bc;10) AG (n&#bc;21) P AA (n&#bc;44) GG (n&#bc;10) AG (n&#bc;21) p Triglyceride (mg/dL) 176.8382.37 176.6166.59 162.2175.04 NS 139.5949.75 123.5742.26 136.7356.21 NS 177.2383.33 137.4050.36 172.6267.88 NS 147.5068.90 130.4431.14 135.0246.99 NS Total cholesterol (mg/dL) 231.5755.85 231.3248.58 214.1459.23 NS 195.5831.07 202.7178.85 204.7135.56 NS 221.7056.57 216.0839.72 231.9560.41 NS 200.6956.77 207.9846.73 196.7829.13 NS HDL cholesterol (mg/dL) 40.6912.36 36.229.441 36.188.36 NS 36.597.01 39.575.15 34.689.15 NS 37.778.66 41.5014.50 36.5011.14 NS 38.758.59 33.568.81 36.006.96 NS LDL cholesterol (mg/dL) 155.5253.72 159.7848.56 145.5253.34 NS 131.0730.32 138.4371.95 142.6837.32 NS 148.4852.78 147.1043.52 160.9254.81 NS 132.4452.19 148.3350.33 133.7728.81 NS VLDL cholesterol (mg/dL) 35.3716.47 35.3213.31 32.4415.00 NS 27.929.95 24.718.45 27.3511.24 NS 35.4516.66 27.4810.07 34.5213.57 NS 29.5013.78 26.096.22 27.009.39 NS Total cholesterol/ HDL cholesterol (mg/dL) 6.252.77 6.932.66 6.222.33 NS 5.581.80 5.101.68 6.362.33 NS 6.312.70 5.872.64 6.742.32 NS 5.381.66 6.873.53 5.691.65 NS BMI (kg/m 2 ) 26.084.65 26.823.55 26.423.83 NS 26.532.81 * 23.363.30 26.583.91 0.018 26.784.13 24.745.15 26.353.41 NS 25.693.18 25.803.27 26.503.40 NS HDL, High density lipoprotein; LDL, low density lipoprotein; n, number of individuals; NS, not significant; SD, standard deviation; VLDL, very low-density lipoprotein; BMI, body mass index. Statistical evaluation was made by using the Student t test and the 1-way ANOVA test. The results are shown as mean SD. Login to comment
108 When we compared the distribution of the ABCG5 and ABCG8 genotypes and alleles with previous studies, we observed that the distribution of the ABCG8 Tyr54Cys genotypes and alleles was similar to that found in the study by Hubacek et al, which reported that the distribution of ABCG8 genotypes and alleles were 34%, 20.4%, 45.6%, 56.8% and 43.2% (21). Login to comment
110 For ABCG8 Tyr54Cys, AA genotype (p&#bc;0.001) was considerably higher in patients with diabetes than in control subjects. Login to comment
116 Hubajeck et al (21) reported that total cholesterol and LDL cholesterol levels were low for ABCG8 Tyr54Cys only in female subjects. Login to comment
124 Junyent et al (39) genotyped ABCG5 Gln604Glu and ABCG8 Tyr54Cys genetic variants in 845 subjects and observed that minor alleles in these SNPs had a lowering effect on HDL cholesterol concentrations. Login to comment
130 Table 5 Comparison of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes with lipid/anthropometric parameters in all study populations ABCG5 Gln604Glu genotype ABCG8 Tyr54Cys genotype CC (n&#bc;73) CG (n&#bc;25) CG (n&#bc;55) p AA (n&#bc;60) GG (n&#bc;19) AG (n&#bc;74) p Triglyceride (mg/dL) 154.3866.74 161.7664.64 152.0268.73 NS 169.3080.27* 134.1141.37 148.2357.67 0.045 Total cholesterol (mg/dL) 209.8845.87 223.3158.29 210.3750.92 NS 216.0956.92 212.2442.15 209.1345.63 NS HDL cholesterol (mg/dL) 38.229.64 37.168.49 35.588.63 NS 38.038.58 37.7412.50 36.188.59 NS LDL cholesterol (mg/dL) 140.7842.62 153.8053.32 144.3847.22 NS 144.2052.66 147.6845.52 143.3141.64 NS VLDL cholesterol (mg/dL) 30.8813.34 32.3512.92 30.4013.74 NS 33.8616.05* 26.828.27 29.6511.53 0.045 Total cholesterol /HDL cholesterol (mg/dL) 5.852.24 6.422.53 6.282.31 NS 6.062.48 6.343.05 6.061.96 NS BMI (kg/m2 ) 26.353.63 25.853.76 26.483.83 NS 26.493.90 25.244.28 26.453.38 NS HDL, High density lipoprotein; LDL, low density lipoprotein; n, number of individuals; NS, not significant; SD, standard deviation; VLDL, very low-density lipoprotein; BMI, body mass index. Statistical evaluation was made by using the Student t test and the 1-way ANOVA test. The results are shown as mean SD. Login to comment
132 Conclusions This study reports the first data about ABCG5 Gln604Glu and ABCG8 Tyr54Cys gene polymorphisms and lipid parameters in diabetes. Login to comment
136 Therefore, future studies with larger sample sizes in differing races will help us to understand the relationship between ABCG5 Gln604Glu and ABCG8 Tyr54Cys polymorphisms and lipid profiles in diabetes mellitus. Login to comment