ABCMdb

ABCA4 p.Arg152Gln

None has been submitted yet.

Publications

PMID: 22328824 [PubMed] Roberts LJ et al: "Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients."

No. Sentence Comment

139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment

PMID: 20149343 [PubMed] Sohrab MA et al: "Preimplantation genetic diagnosis for stargardt disease."

No. Sentence Comment

28 The c455GϾA variant, resulting in R152Q protein change, has been described in at least 3 studies.11-13 In 1,11 the variant was described as a "rare variant" since it was also detected in controls. Login to comment
31 In this particular case, the R152Q variant was considered possibly pathogenic to avoid the potential disease expression in compound heterozygous state. Login to comment
42 Results showed that she was a carrier of the c455GϾA (R152Q) ABCA4 variant. Login to comment
43 The same testing on the affected husband found 2 Stargardt disease-associated mutations, the splice site-affecting c5018ϩ2CϾT mutation and the c5882GϾA (G1961E) mutation, thereby confirming the clinical diagnosis of STGD. Login to comment
29 The c455Gb0e;A variant, resulting in R152Q protein change, has been described in at least 3 studies.11-13 In 1,11 the variant was described as a "rare variant" since it was also detected in controls. Login to comment
32 In this particular case, the R152Q variant was considered possibly pathogenic to avoid the potential disease expression in compound heterozygous state. Login to comment

PMID: 19365039 [PubMed] Roberts LJ et al: "Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip."

No. Sentence Comment

31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment

PMID: 17325179 [PubMed] Aleman TS et al: "Macular pigment and lutein supplementation in ABCA4-associated retinal degenerations."

No. Sentence Comment

61 Clinical and Molecular Characteristics of the Patients Patient Age (y)/Gender ABCA4 Mutation Visual Acuity* Refraction† Kinetic Visual Field Extent (V-4e)‡ Lutein Trial Participant?RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 -0.50 -0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 -1.00 -1.25 103 104 N 3 18/M ࿣ 20/20 20/125 -1.00 -1.00 126 105 N 4§ 19/F R1129L/L1940P 20/40 20/50 ϩ0.25 ϩ0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 -0.75 -0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 -1.25 -1.50 112 105 Y 7§ 26/M ࿣ 20/40 20/32 ϩ1.00 ϩ0.75 86 88 Y 8 30/F ࿣ 20/50 20/40 ϩ2.25 ϩ1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 -2.25 -3.50 99 93 Y 10 32/F V935A/IVS40ϩ5G3A 20/32 20/40 -0.75 -1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 -1.50 -1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 -3.00 -2.00 99 105 Y 13¶ 38/F V256V/G1961E 20/25 20/25 -1.00 -1.25 106 101 Y 14¶ 42/F V256V/G1961E 20/25 20/32 -0.50 -0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 ϩ0.75 ϩ0.25 108 103 N 16§ 49/M ࿣ 20/32 20/32 -4.50 -4.50 84 79 Y 17 56/M G1977S 20/25 20/25 -5.50 -5.50 99 109 N * Best corrected visual acuity. Login to comment
62 RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 afa;0.50 afa;0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 afa;1.00 afa;1.25 103 104 N 3 18/M $f3; 20/20 20/125 afa;1.00 afa;1.00 126 105 N 4&#a7; 19/F R1129L/L1940P 20/40 20/50 af9;0.25 af9;0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 afa;0.75 afa;0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 afa;1.25 afa;1.50 112 105 Y 7&#a7; 26/M $f3; 20/40 20/32 af9;1.00 af9;0.75 86 88 Y 8 30/F $f3; 20/50 20/40 af9;2.25 af9;1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 afa;2.25 afa;3.50 99 93 Y 10 32/F V935A/IVS40af9;5G3A 20/32 20/40 afa;0.75 afa;1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 afa;1.50 afa;1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 afa;3.00 afa;2.00 99 105 Y 13&#b6; 38/F V256V/G1961E 20/25 20/25 afa;1.00 afa;1.25 106 101 Y 14&#b6; 42/F V256V/G1961E 20/25 20/32 afa;0.50 afa;0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 af9;0.75 af9;0.25 108 103 N 16&#a7; 49/M $f3; 20/32 20/32 afa;4.50 afa;4.50 84 79 Y 17 56/M G1977S 20/25 20/25 afa;5.50 afa;5.50 99 109 N * Best corrected visual acuity. Login to comment

PMID: 15192030 [PubMed] Stenirri S et al: "Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations."

No. Sentence Comment

35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

PMID: 15161829 [PubMed] September AV et al: "Mutation spectrum and founder chromosomes for the ABCA4 gene in South African patients with Stargardt disease."

No. Sentence Comment

71 List of 16 Different Potential Disease-Associated Sequence Variants Identified in 64 SA Subjects with arSTGD Nucleotide Change Amino Acid Change Families (N ‫؍‬ 64) Exon Reference C454T R152X 4 5 3,33 G455A R152Q 1 5 35 C634T R212C 1 6 16,27 G768T (Splice donor) V256splice 5 6 15 C1885T R602W 6 13 9 2588G3C G863A 4 17 8 T3047C V989A 1 20 11 T4319C F1440S 1 29 9 G4328A* R1443H 1 29 This study G4469A C1490Y 19 30 15,9 G5077A V16931 1 36 36 C6079T L2027F 8 44 8 C6088A R2030X 1 44 9,37 C6112T R2038W 2 44 5 IVS45ϩ7G3A Splice donor 1 45 26 6352⌬A* Frameshift 1 46 This study No individuals positive for the R1443H variant were identified in 47 control individuals of Indian ancestry. Login to comment
125 AO (y) Phenotype Mutation 1 Mutation 2 224.1 9 STGD C1490Y R602W 170.2 10 STGD C1490Y R602W 241.1 9 STGD C1490Y 25883C 448.1 20 STGD C1490Y 2588G3C 113.3 10 STGD C1490Y L2027F 209.1 18 STGD C1490Y L2027F 165.4 10 STGD C1490Y V256splice 166.3 27 STGD C1490Y R152X 151.4 5 STGD C1490Y ND 219.1 5 (rapid clinical progression was observed by 9 years) STGD C1490Y ND 223.1 9 STGD C1490Y ND 307.1 9 STGD C1490Y ND 319.3 9 STGD C1490Y ND 385.1 10 STGD C1490Y ND 226.1 10 STGD C1490Y ND 142.2 10 STGD C1490Y ND 273.1 11 STGD C1490Y ND 382.1 12 STGD C1490Y ND 449.1 14 STGD C1490Y ND 344.2 ND STGD C1490Y ND 374.1 10 STGD L2027F 6352⌬A† 305.1 18 STGD L2027F R2038W 377.1 25 STGD L2027F R2038W 276.1 27 STGD L2027F R212C 204.4 8 STGD L2027F ND 135.4 13 STGD L2027F ND 446.1 9 STGD R602W ND 109.3 11 STGD R602W ND 110.7 13 STGD R602W ND 438.3 12 STGD R602W ND 123.1 9 STGD V256splice R152X 105.1* 10 STGD AND atypical RP V256splice R152X 24 129.3* 10 (rapid clinical progression was observed) STGD V256splice ND 163.22 10 STGD V256splice ND 173.1 8 STGD 2588G3C ND 9.4 27 STGD 2588G3C R152X 330.2 29 STGD R152Q V989A 372.1 31 STGD R1443H† R2030X 141.3 11 STGD F1440S IVS45ϩ7G3A (splice site mutation) 206.3 ND STGD V1693I ND Rows are arranged according to the age of onset (AO) starting with the earliest AO for the most common sequence variant. Login to comment

PMID: 14517951 [PubMed] Jaakson K et al: "Genotyping microarray (gene chip) for the ABCR (ABCA4) gene."

No. Sentence Comment

115 Mutations Detected in theTwoTest Populations by the ABCR400 Array,That Had Not Been Found by SSCP Number Nucleotide change Protein e¡ect Number of cases 1 161G4A C54Y 3 2 194G4A G65E 1 3 428C4T P143L 1 4 455G4A R152Q 1 5 514G4A G172S 1 6 635G4A R212H 1 7 656G4C R219T 1 8 768G4Ta Splice/V256V 3 9 1007C4G S336C 2 10 1268A4G H423R 4 11 1411G4A E471K 2 12 1622T4Ca L541P 8 13 1933G4A D645N 1 14 2041C4T R681X 5 15 2090G4A W697X 1 16 2471T4C I824T 1 17 2588G4Ca Splice/G863A 5 18 2828G4A R943Q 1 19 2966T4C V989A 1 20 2971G4C G991R 1 21 4139C4T P1380L 8 22 4195G4A E1399K 1 23 4328G4A R1443H 1 24 4457C4T P1486L 1 25 4462T4Ca C1488R 1 26 4469G4Aa C1490Y 1 27 4918C4Ta R1640W 2 28 IVS40+5G4A Splice 2 29 5537T4C I1846T 2 30 5882G4A G1961E 5 31 6089G4A R2030Q 1 32 6104T4C L2035P 1 33 6449G4A C2150Y 1 Mutation numbering is based on the cDNA sequence (GenBank NM_000350). Login to comment

PMID: 12515255 [PubMed] Ducroq D et al: "The ABCA4 gene in autosomal recessive cone-rod dystrophies."

No. Sentence Comment

30 Among these 13 patients, 2 were homozygotes (from two consanguineous families), 4 were compound heterozygotes, and 7 were Letters to the Editor 1481 Table 1 ABCA4 Mutations in Patients with CRD Patient ABCA4 ALLELE 1 ABCA4 ALLELE 2 OriginNucleotide Change Effect Nucleotide Change Effect 16 AAC 286 GAC N96D - - France 52 ATC 466 GTC I156V - - North Africa 57 ATC 466 GTC I156V GGG 1819 AGG G607R North Africa 51 CGA 455 CAA 5084ϩ1G/A R152Q Frameshift CGC 3323 TGC AGT 6764 ATT R1108C S2256I France 11 CGT 764 TGT R255C - - France 41 GCC 3113 GTC A1038V - - France 60 CTG 3602 CGG L1201R AGT 6764 ATT S2256I South Africa 21 CTC 5908 TTC L1970F - - France 30 AGT 6764 ATT S2256I - - Africa 48 GAA 3259 TAA E1087X - - France 2 2617 del CT Frameshift 2617 del CT Frameshift Portugal 5 571-2A/G Frameshift 571-2A/G Frameshift Morocco 61 CGG 4918 TGG R1602W GGC 5929 AGC G1977S England single heterozygotes (see table 1). Login to comment
31 Among these 13 patients, 2 were homozygotes (from two consanguineous families), 4 were compound heterozygotes, and 7 were Letters to the Editor 1481 Table 1 ABCA4 Mutations in Patients with CRD Patient ABCA4 ALLELE 1 ABCA4 ALLELE 2 Origin Nucleotide Change Effect Nucleotide Change Effect 16 AAC 286 GAC N96D - - France 52 ATC 466 GTC I156V - - North Africa 57 ATC 466 GTC I156V GGG 1819 AGG G607R North Africa 51 CGA 455 CAA 5084af9;1G/A R152Q Frameshift CGC 3323 TGC AGT 6764 ATT R1108C S2256I France 11 CGT 764 TGT R255C - - France 41 GCC 3113 GTC A1038V - - France 60 CTG 3602 CGG L1201R AGT 6764 ATT S2256I South Africa 21 CTC 5908 TTC L1970F - - France 30 AGT 6764 ATT S2256I - - Africa 48 GAA 3259 TAA E1087X - - France 2 2617 del CT Frameshift 2617 del CT Frameshift Portugal 5 571-2A/G Frameshift 571-2A/G Frameshift Morocco 61 CGG 4918 TGG R1602W GGC 5929 AGC G1977S England single heterozygotes (see table 1). Login to comment

PMID: 12397427 [PubMed] Zhang X et al: "Macular pigment and visual acuity in Stargardt macular dystrophy."

No. Sentence Comment

54 Blue light images (A, C); infrared images (B, D) Table 1 Visual acuity, macular pigment and ABCR mutations in patients with Stargardt dystrophy Patient Age/Sex Visual Acuity Macular Pigment Exon Allele 1 Exon Allele 2 OD OS OD OS 1 33F 0.67 0.38 + + ND ND 2 36F 1 0.5 + + ND ND 3 54F 0.48 0.6 + + 42 G1961E 42 G1061E 4 11M 0.8 1 + + NS NS 5 33F 0.67 0.4 +- + 20 V989A ND 6 12F 0.5 0.2 +- +- 30 C1490Y 40 GIVS+5A 7 47M 0.5 0.4 +- +- 17 G863A/R943Q 45 R2077W 8 53M 0.1 1 +- +- 14 W663X ND 9 29F 0.1 0.1 +- +- 26 3819insT ND 10 43M 0.005 0.005 - - 17 G863A/R943Q ND 11 32F 0.1 0.1 - - 19 N965S ND 12 29F 0.005 0.005 - - 23 R1129H ND 13 30F 0.1 0.1 - - 5 R152Q ND 14 63F 0.1 0.1 - - 42 G1961E ND 15 36M 0.07 0.1 - +- 13 Q636H 42 G1961E 16 41F 0.005 0.005 - - 12 L514P/A1038V ND NS: Not screened; ND: Not detected + Normal macular pigment; +- Partial macular pigment; - Absent macular pigment absorption of infrared light in the center of the macula where maximum absorption of blue light occurs, implying that the macula pigments in this subject`s foveas are normal. Login to comment

PMID: 11385708 [PubMed] Paloma E et al: "Spectrum of ABCA4 (ABCR) gene mutations in Spanish patients with autosomal recessive macular dystrophies."

No. Sentence Comment

40 The missense mutation R152Q was confirmed by HinfI digestion of a mismatched PCR product obtained using the 5FOR primer and the following reverse primer: 5' CATCTTTCAAGATATCCCTGATT3',which generates a HinfI restriction site in the mutant allele. Login to comment
59 Pathogenic Mutations In the absence of a functional assay, it is difficult to relate the structural alteration with the TABLE 1. Summary of the Pathogenic Variants Found in the Screening of the ABCA4 Gene Family (NAS) Paternal allele (E) Maternal allele (E) Onset (years) Phenotype SB1 c.3211-3212insGT (22) R212C (6) 9 CRD M266 (2) c.4253+5G>A (28) L2060R (46) 7/4 CRD SM3 [R152Q (5); R2107H (46)] [R152Q (5); R2107H (46)] 7 STGD SZ2 L1940P (41) ND 8 STGD SM1 N1799D (38) ND 9 STGD SM2 c.2888delG (19) [R1055W (21); C.2588G>C (17)] 11 STGD SP1 ND ND 12 STGD SZ3 ND ND 12 STGD M280 N1805D (39) N1805D (39) 14 STGD SB2 (2) R1108C (22) L686S (14) 18/11 STGD SZ4 ND ND 20/28 FFM SP2 ND ND 21 FFM SM4 [T1253L (25); G1961E (42)] ND 38 FFM SZ1 L1940P (41) ND 28 FFM Novel putative pathogenic variants are depicted in bold type and their corresponding nucleotide changes are as follows: L686S=c.2057T>C; R1055W=c.3163C>T; T1253L=c.3758C>T; N1799D=c.5396A>G; N1805D=c.5413A>G; L1940P=c.5819T>C; L2060R=c.6179T>G. Login to comment
72 The fact that the more conservative changes R152Q and T1253L were found in a double mutant allele makes it difficult to evaluate their contribution to the disease phenotype. Login to comment

PMID: 10958763 [PubMed] Rivera A et al: "A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration."

No. Sentence Comment

79 Also considered pathological were missense mutations causing nonconservative amino acid changes-for example, A60T and A60E (table 2)-with the exception of those that were found at similar frequencies in the three study groups-for example, R152Q, N1868I, and V1921M (tables 3 and 4). Login to comment
82 Table 3 Rare Sequence Variants in the ABCA4 Gene EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 5: 455GrA R152Q 3 1 3 This study 8: IVS8ϩ38ArT Unknown 0 1 0 This study 12: 1654GrA V552I 0 0 2 This study IVS11-6CrG Unknown 0 4 2 This study 13: 1932CrT D644D 2 0 0 This study 17: IVS16-12CrG Unknown 0 0 8 This study 18: IVS17-56CrG Unknown 3 0 0 This study IVS17-36CrT Unknown 0 2 1 This study 22: 3261ArC E1087D 1 0 0 This study 3264CrT P1088P 0 0 1 This study IVS21-20CrT Unknown 1 0 0 This study 23: IVS23ϩ10TrG Unknown 1 0 0 This study IVS23ϩ17GrC Unknown 1 0 0 This study 24: IVS23-28TrC Unknown 2 4 1 This study 25: 3759GrA T1253T 1 0 0 This study 28: 4140GrA P1380P 2 0 0 This study IVS28ϩ43GrA Unknown 4 3 1 This study 29: IVS29ϩ13GrA Unknown 0 1 0 This study IVS29ϩ32ArG Unknown 1 0 0 This study 31: 4578GrA T1526T 0 1 0 This study 32: IVS32ϩ45TrC Unknown 1 0 0 This study 33: IVS32-57TrG Unknown 0 0 1 This study 4685TrC I1562T 0 0 6 Allikmets et al. (1997b) 36: IVS36ϩ20GrA Unknown 1 0 0 This study 39: 5487GrT L1829L 0 0 1 This study IVS38-10TrC Unknown 9 0 0 Maugeri et al. (1999) 41: 5761GrA V1921M 1 1 1 This study 43: 5908CrT L1970F 1 0 1 Allikmets et al. (1997b), Rozet et al. (1998), Lewis et al. (1999) IVS43ϩ7ArC Unknown 1 0 0 This study 44: 6027CrT I2023I 1 0 0 Allikmets et al. (1997a), Nasonkin et al. (1998) 45: 6176GrC G2059A 0 0 1 This study 46: IVS46ϩ27GrA Unknown 0 0 1 This study 47: IVS46-46TrA Unknown 1 0 0 This study 48: IVS48ϩ21CrT Unknown 18a 2a 0 Allikmets et al. (1997b), Nasonkin et al. (1998), Papaioannou et al. (2000) 6529GrA D2177N 2 3 4 Allikmets et al. (1997b) 6721CrG L2241V 1 0 0 This study a Occurs together with G1961E in 17/18 and 2/2 instances. Login to comment
142 As well as changes not affecting the specificity of amino acid residues and conservative amino acid substitutions, included in the latter category are some rare nonconservative changes found in similar frequencies in the three study groups-for example, R152Q, V1921M, and L1970F. Login to comment

PMID: 23143460 [PubMed] Downes SM et al: "Detection rate of pathogenic mutations in ABCA4 using direct sequencing: clinical and research implications."

No. Sentence Comment

28 In 5 of the 11 patients, the identification of 2 pathogenic mutations confirmed the historical diagnosis and all had chorioretinal atro- Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 1 1Ab0e;G M1V 2588Gb0e;C G863A In trans Unaffected parents carriers 30 STGD maf9;/0/0 R2030Q 3 PVs 2 161Gb0e;A C54Y 2588Gb0e;C G863A In trans Affected sibling with same mutations 12 STGD m/0/0 0 2 PVs 3 161Gb0e;A C54Y 5882Gb0e;A G1961E NK NK 18 STGD m/0/0 0 2 PVs 4 634Cb0e;T R212C 4457Cb0e;T P1486L In trans Unaffected parents carriers 17 STGD m/0/0 0 2 PVs 5 2588Gb0e;C G863A 4469Gb0e;A C1490Y NK NK 48 STGD maf9;/0/1 0 2 PVs 6 2971Gb0e;C G991R 4254-2Ab0e;G Splice NK NK 21 STGD m/0/0 0 2 PVs 7 2971Gb0e;C G991R 3602Tb0e;G L1201R NK NK 18 STGD maf9;af9;/NP/NP V643M (likely), G885E (likely), G1441D (unlikely), V2244V (highly likely) b0e;2 PVs 8 3322Cb0e;T R1108C 768Gb0e;T V256V NK NK 13 STGD maf9;af9;/1/1 0 2 PVs 9 3322Cb0e;T R1108C 6079Cb0e;T L2027F NK NK 26 STGD maf9;/0/0 0 2 PVs 10 3386Gb0e;T R1129L 4469Gb0e;A C1490Y In trans Unaffected parents carriers 15 STGD maf9;/0/0 R152Q (unlikely) 2 PVs (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1486 phy on current clinical examination, consistent with progression of the disorder.5 One of the 11 patients with chorioretinal atrophy (subject 40) had a single stop codon, again strongly supporting the original clinical diagnosis. Six of the 11 patients did not have pathogenic mutations in ABCA4. Login to comment
30 In 3 of the 6 patients with a historical diagnosis Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients (continued) Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 11 4139Cb0e;T P1380L 5714 af9; 5Gb0e;A Splice NK NK 19 STGD m/0/0 0 2 PVs 12 4457Cb0e;T P1486L 4457Cb0e;T P1486L In trans Unaffected sibling carries 1 mutation 25 STGD maf9;af9;/1/1 0 2 PVs 13 4537dupC Q1513fs 6391Gb0e;A E2131K In trans Unaffected parents carriers 10 STGD maf9;/0/0 R152Q in cis with Q1513fs, E2131K in cis with E471K 2 PVs 14 6079Cb0e;T L2027F 6079Cb0e;T L2027F In trans Unaffected sibling carrier 28 STGD maf9;af9;/0/0 0 2 PVs 15 5018 af9; 2Tb0e;C NA 6316Cb0e;T R2106C In trans Affected sibling with same mutations 17 STGD m/0/1 0 2 PVs 16 3004Cb0e;T R1002Wb 1957Cb0e;T R653C In trans NK 16 STGD m/0/1 0 2 PVs 17 1253Tb0e;C F418S 2588Gb0e;C G863A NK NK 52 STGD maf9;/0/0 0 2 PVs 18 6709Ab0e;C T2237Pb 3064Gb0e;A E1022K In trans 2 Affected siblings with same mutations 6 STGD maf9;af9;/0/0 0 2 PVs 19 5260Tb0e;G Y1754D 4469Gb0e;A C1490Y In trans NK 12 STGD maf9;af9;/0/0 0 2 PVs 20 551Cb0e;T S184Fb 4793Cb0e;A A1598D NK 2 Affected siblings with same mutations 58 STGD m/NP/NP 0 2 PVs 21 550-551TCb0e;CG S184Rb 5882Gb0e;A G1961E In trans Affected sibling with same mutations 25 STGD maf9;af9;/0/0 0 2 PVs 22 5313-3Cb0e;G Spliceb 5882Gb0e;A G1961E In trans Unaffected parents carriers 47 STGD m/0/1 0 2 PVs 23 2588Gb0e;C G863A 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans NA 26 STGD maf9;af9;/3/1 1 In cis with G863A 2 PVs 24 5537Tb0e;C I1846T 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected son carries I1846T only 17 STGD maf9;af9;/3/3 0 2 PVs 25 6089Gb0e;A R2030Q 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected sibling carries R2030Q 4 STGD m/NP/NP 0 2 PVs 26 6730-1Gb0e;C Spliceb 2588Gb0e;C G863A NK NK 15 STGD NP/NP/NP 0 2 PVs 27 3291Ab0e;T R1097Sb 3056Cb0e;T T1019M In trans NK 9 STGD NP/NP/NP 1 In cis with R1097S 2 PVs 28 498delT L167HisfsX2b Not present NA NA NK 28 STGD m/1/1 0 1 PV 29 2345Gb0e;A W782Xb Not present NA NA Unaffected mother carries mutation 25 STGD m/1/1 0 1 PV 30 2588Gb0e;C G863A 4326Cb0e;A N1442K NK NK 36 STGD maf9;/0/0 0 1 PV af9; N1442K (unlikely) 31 2966Tb0e;C V989A Not present NA NA NK 49 STGD m/1/1 0 1 PV (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1487 (c)2012 American Medical Association. All rights reserved. Downloaded From: http://archopht.jamanetwork.com/ by a Semmelweis University Budapest User on 12/06/2015 lopathy is genetically heterogeneous. A total of 10 novel mutations were identified (Table). Login to comment

PMID: 23953153 [PubMed] Fujinami K et al: "Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function."

No. Sentence Comment

141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3. Login to comment

PMID: 25444351 [PubMed] Lambertus S et al: "Early-onset stargardt disease: phenotypic and genotypic characteristics."

No. Sentence Comment

136 ABCA4 Mutations in Early-Onset Stargardt Patients Mutation Effect Allele References Frequency Percentage c.122G>A p.Trp41* 1 1 35 c.214G>A p.Gly72Arg 1 1 32 c.286A>G p.Asn96Asp 4 5 36 c.443-?_570&#fe;?del p.Arg149fs 1 1 This study c.455G>A p.Arg152Gln 1 1 32, 37 c.656G>C p.Arg219Thr 1 1 38 c.768G>T p.Val256Val/p.? Login to comment

PMID: 26574798 [PubMed] Gaia O et al: "Cerebral Involvement in Stargardt's Disease: A VBM and TBSS Study."

No. Sentence Comment

81 Demographic and Genetic Data of STGD Patients Age Sex ABCR Mutations Age of Onset 19 F 250insCAAA G1961E D498N 4017ins24bp 11 18 M L541P/A1038V IVS40&#fe;5g->a 14 25 M L541P/A1038V G1961E 17 15 F G1961E R2149X 13 48 M N96D IVS40&#fe;5G>A 38 29 M G1961E L1938L L1894L S1689P 25 23 F L541P/A1038V F655C 14 33 M R152Q G1961E 402ins24bp 18 21 M A60V G1961E 15 23 M G690V A1598D 11 27 M G1961E R2149X 11 51 F V615A G1961E 25 54 M N96D N1436I 28 21 M 250insCAAA P402A 13 25 F R1448K c.5018&#fe;2T>C 21 49 M 4538insC IVS40&#fe;5G>A 18 23 F G1961E c.6282&#fe;1G>C 18 46 M N96D N1436I 30 T ABLE 4. Login to comment