ABCC2 p.Cys1515Tyr

[switch to full view]
Comments [show]
Publications
PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."
No. Sentence Comment
882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press).
X
ABCC2 p.Cys1515Tyr 16766035:882:788
status: NEW
Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."
No. Sentence Comment
101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined.
X
ABCC2 p.Cys1515Tyr 18464048:101:1067
status: NEW
Login to comment

148 Furthermore, both non-synonymous SNPs, 3563T>C (Val1188Glu) and 4544G>A (Cys1515Tyr), in combination with an ABCC1 SNP were associated with anthracycline-induced cardiotoxicity (Wojnowski et al., 2005).
X
ABCC2 p.Cys1515Tyr 18464048:148:73
status: NEW
Login to comment

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."
No. Sentence Comment
83 In Vitro Studies Associated with Common SNPs of Drug Transporter Genes Exon Polymorphism Effect dbSNP Cell Expression Function Reference ABCC2 Exon 1 -24C>T 5`-UTR rs717620 116A>T Tyr2Phe rs927344Exon 2 159A>G synonymous rs17222596 Exon 7 736A>C Met246Leu rs17222744 Exon 8 998A>G Asp333Gly rs17222674 Exon 9 1058G>A Arg353His rs7080681 1219C>T synonymous rs17216198 1249G>A Val417Ile rs2273697 LLC-PK1 Protein (n.s.) Membrane localization (n.s.) Transport activity (n.s.) Hirouchi et al. [51] 1434G>T synonymous 1434G>A synonymous rs4267009 Exon 10 1457C>T Thr486Ile rs17222589 Exon 11 1483A>G Lys495Glu rs17222561 Exon 13 1686T>G Phe562Leu rs17216233 2009T>C Ile670Thr rs17222632Exon 16 2073C>A synonymous rs17222624 Exon 17 2153A>G Asn718Ser rs3740072 Exon 19 2546T>G Leu849Arg rs17222617 Exon 20 2677G>C Glu893Gln rs3740071 2901C>A Tyr967stop rs17222547 2934G>A synonymous rs3740070 Exon 22 2944A>G Ile982Val rs17222554 3107T>C Ile1036Thr rs17216149Exon 23 3188A>G Asn1063Ser rs17222540 Exon 24 3396T>C synonymous rs17216345 3542G>T Arg1181Leu rs8187692 3561G>A synonymous rs17216324 Exon 25 3563T>A Val1188Glu rs17222723 Exon 27 3817A>G Thr1273Ara rs8187699 3872C>T Pro1291Leu rs17216317 3895A>C Lys1299Gln rs4148400 3927C>T synonymous rs4148401 Exon 28 3972C>T synonymous rs3740066 4062C>T synonymous rs17216275Exon 29 4110C>T synonymous rs7899457 4242C>T synonymous rs17216296Exon 30 4290G>T synonymous rs1137968 4410G>A synonymous rs8187706Exon 31 4488C>T synonymous rs8187707 4527C>T synonymous rs8187709Exon 32 4544G>A Cys1515Tyr rs8187710 ABCG2 PA317 mRNA (n.s.) Protein (n.s.) Drug sensitivity (n.s.) Topotecan uptake (n.s.) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (impaired) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] Exon 2 34G>A Val12Met rs2231137 LLC-PK1 Apical localization (n.s.) .
X
ABCC2 p.Cys1515Tyr 18673259:83:1529
status: NEW
Login to comment

93 Exon Polymorphism Effect dbSNP Subject Expression Function Reference Exon 24 3396T>C synonymous rs17216345 3542G>T Arg1181Leu rs8187692 3561G>A synonymous rs17216324 3563T>A Val1188Glu rs17222723 Healthy (Finnish) Pravastatin PK (TT TA) Niemi et al. [48] HIV patient (Caucasian) Nelfinavir intracellular AUC (TT TA) Colombo et al. [58] Exon 25 Patient Acute anthracycline-induced cardiotoxicity (TT<TA) Chronic anthracycline-induced cardiotoxicity (TT TA) Wojnowski et al. [59] Exon 27 3817A>G Thr1273Ara rs8187699 3872C>T Pro1291Leu rs17216317 3895A>C Lys1299Gln rs4148400 3927C>T synonymous rs4148401 3972C>T synonymous rs3740066 Women undergoing cesarean section Placental mRNA (GG GA AA) Placental protein (GG GA AA) Meyer zu Schwabedissen et al. [52] DNT patient Tumoral protein (GG GA) Peritumoral protein (GG GA) Vogelgesang et al. [54] Patient 9-nitrocamptotecin PK and toxicity (CC CT TT) 9-aminocamptotecin PK and toxicity (CC CT TT) Zamboni et al. [55] Exon 28 Colorectal cancer patient (Japanese) Tumoral mRNA (CC CT TT) Drug sensitivity (CC CT TT) Tumor growth rate (CC CT TT) Nishioka et al. [57] 4062C>T synonymous rs17216275Exon 29 4110C>T synonymous rs7899457 4242C>T synonymous rs17216296Exon 30 4290G>T synonymous rs1137968 Exon 31 4410G>A synonymous rs8187706 4488C>T synonymous rs8187707 HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CT) Colombo et al. [58] 4527C>T synonymous rs8187709 4544G>A Cys1515Tyr rs8187710 Healthy (Finnish) Pravastatin PK (GG GA) Niemi et al. [48] HIV patient (Caucasian) Nelfinavir intracellular AUC (GG GA) Colombo et al. [58] Exon 32 Patient Acute anthracycline-induced cardiotoxicity (GG<GA) Chronic anthracycline-induced cardiotoxicity (GG GA) Wojnowski et al. [59] ABCG2 34G>A Val12Met rs2231137 Nasopharyngeal cancer patient Irinotecan PK (GG GA+AA) SN-38 PK (GG GA+AA) SN-38G PK (GG GA+AA) Zhou et al. [56] HIV patient (Caucasian) Nelfinavir intracellular AUC (GG GA) Colombo et al. [58] Exon 2 Patient (Japanese) Placental mRNA (GG GA AA) Placental protein (GG GA AA) Kobayashi et al. [91] (Table 3) contd….
X
ABCC2 p.Cys1515Tyr 18673259:93:1427
status: NEW
Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."
No. Sentence Comment
190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96).
X
ABCC2 p.Cys1515Tyr 19949922:190:691
status: NEW
Login to comment

212 [98] c.1446C>G T482T Bioavailability of pravastatin Increased [101] c.3563T>A V1188E Higher protein expression in liver Increased [102] c.3972C>T I1324I Intrahepatic cholestasis in pregnancy Decreased [103] c.4544G>A C1515Y Higher protein expression in liver Increased [102] composed of 655 amino acids (109).
X
ABCC2 p.Cys1515Tyr 19949922:212:217
status: NEW
Login to comment

PMID: 16041239 [PubMed] Colombo S et al: "Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo."
No. Sentence Comment
71 - 24C > T exon 1 Itoda et al., 2002 mp-v-004 rs717620 IVS 6-30 G > T intron 6 Epidauros mp-v-051 rs8187666 c.842G > A exon 7 p.S281N Epidauros mp-v-115 c.998G > A intron 7 Epidauros mp-v-083 c.1219C > T exon 10 synonymous (p.L407L) Epidauros mp-v-007 rs8187669 c.1249G > A exon 10 p.V417I Itoda et al., 2002 mp-v-008 rs2273697 c.1346C > G exon 10 synonymous (p.T482T) Epidauros mp-v-114 c.1457C > T exon 10 p.T486I Epidauros mp-v-055 rs8187670 IVS 16 - 47 G > A intron 16 Epidauros mp-v-118 IVS 16 - 30 T > A intron 16 Epidauros mp-v-119 c.2153A > G exon 17 p.N718S Epidauros mp-v-093 rs3740072 c.2216T > C exon 17 p.L739P Epidauros mp-v-108 c.3449G > A exon 25 p.R1150H Mor-Cohen et al., 2001 mp-v-085 c.3517A > T exon 25 p.I1173F Keitel et al., 2003 mp-v-096 c.3521G > A exon 25 p.R1174H Epidauros mp-v-068 c.3542G > T exon 25 p.R1181L Epidauros mp-v-069 rs8187692 c.3563T > A exon 25 p.V1188E Epidauros mp-v-025 rs8187694 IVS 30 - 53 C > T intron 30 Epidauros mp-v-105 rs3824610 c.4348G > A exon 31 p.A1450T Suzuki et al. 2002 mp-v-106 c.4410G > A exon 31 synonymous (p.E1470E) Epidauros mp-v-077 rs8187706 c.4488C > T exon 31 synonymous (p.H1496H) Epidauros mp-v-038 rs8187707 IVS 31 + 12 G > A intron 31 Epidauros mp-v-039 rs8187708 IVS 31 + 74 C > T intron 31 Epidauros mp-v-040 IVS 31 - 9 T > C intron 31 Epidauros mp-v-042 c 4527C > T exon 32 synonymous (p.A1509A) Epidauros mp-v-048 rs8187709 c.4544G > A exon 32 p.C1515Y Epidauros mp-v-043 rs8187710 + 259 G > T 30 flanking Epidauros mp-v-120 Transporter polymorphisms and HIV treatment Colombo et al. 601 BCRP (ABCG2) g.
X
ABCC2 p.Cys1515Tyr 16041239:71:1424
status: NEW
Login to comment

102 - 24C > T rs717620 19 5 3 1 1.5 1.1 0.64 0.73 c.1249G > A (V417I) rs2273697 20 7 1 1 1.4 0.2 4.43 0.11 c.1346C > G NM_000392; c.1483C > G 26 1 1 0.6 1.34 0.25 IVS 16 - 47 G > A NC_000010; g.34448G > A 27 1 1 1.5 0.86 0.35 c.3563T > A (V1188E) rs8187694 23 4 1 1.1 0.07 0.78 c.4488C > T rs8187707 23 5 1 0.8 0.04 0.83 IVS 31 + 12G > A rs8187708 23 5 1 0.8 0.04 0.83 IVS 31 + 74C > T NC_000010; g.68057C > T 24 4 1 1.1 0.00 0.95 c.4544G > A (C1515Y) rs8187710 22 5 1 0.8 0.02 0.90 g.
X
ABCC2 p.Cys1515Tyr 16041239:102:440
status: NEW
Login to comment

PMID: 16330681 [PubMed] Wojnowski L et al: "NAD(P)H oxidase and multidrug resistance protein genetic polymorphisms are associated with doxorubicin-induced cardiotoxicity."
No. Sentence Comment
16 In addition, acute ACT was associated with the Gly671Val variant of the doxorubicin efflux transporter multidrug resistance protein 1 (MRP1) (OR, 3.6; 95% CI, 1.6 to 8.4) and with the Val1188Glu-Cys1515Tyr (rs8187694-rs8187710) haplotype of the functionally similar MRP2 (OR, 2.3; 95% CI, 1.0 to 5.4).
X
ABCC2 p.Cys1515Tyr 16330681:16:195
status: NEW
Login to comment

132 The 2 missense mutations in MRP2, Val1188Glu (rs8187694) and Cys1515Tyr (rs8187710), yielded identical frequencies and relationships with acute ACT, as characterized by an OR of 2.3 (95% CI, 1.0 to 5.4).
X
ABCC2 p.Cys1515Tyr 16330681:132:61
status: NEW
Login to comment

136 All associations except 1 (the Val1188Glu and Cys1515Tyr haplotype) were still significant when chronic cases were defined more conservatively (ejection fraction Ͻ45% instead of Ͻ50%).
X
ABCC2 p.Cys1515Tyr 16330681:136:46
status: NEW
Login to comment

202 The 2 missense variants associating with ACT, Val1188Glu (rs8187694), and Cys1515Tyr (rs8187710), were initially described in the Japanese.48 No data on their functional significance have been published, and the specific variant relevant to doxorubicin treatment cannot be inferred from our results because of the 100% LD between the 2 missense mutations in our cohort.
X
ABCC2 p.Cys1515Tyr 16330681:202:74
status: NEW
Login to comment

PMID: 20368717 [PubMed] Bergmann TK et al: "Impact of CYP2C8*3 on paclitaxel clearance: a population pharmacokinetic and pharmacogenomic study in 93 patients with ovarian cancer."
No. Sentence Comment
135 This effect on clearance of a 'non-fixed` variable provides a competing and dynamic biological explanation for clearance that certainly should be Table 4 Clearance of unbound paclitaxel as function of observed genotypes Gene/allelea Effectb Reference homozygote Heterozygote Variant homozygote P-valuee SNP IDf Nc CLd (10th-90th) Nc CLd (10th-90th) Nc CLd (10th-90th) Candidate SNPs for confirmative analysis CYP2C8 1196A4G(*3) K399R 74 395 (297-490) 19 350 (238-458) 0.03* (0.04) rs10509681 ABCB1 1236C4T G412G 29 391 (270-569) 45 393 (299-490) 19 359 (291-437) 0.25 (0.25) rs1128503 2677G4T/Ag A893S/T 26 387 (270-490) 42(GT) 396 (299-490) 20(TT) 356 (294-437) 0.20 (0.26) rs2032582 3435C4T I1145I 11 403 (326-548) 44 387 (282-490) 38 378 (297-468) 0.83 (0.43) rs1045642 Candidate SNPs for exploratory analysis CYP2C8 792C4G(*4) I264M 86 391 (297-490) 7 321 (270-374) 0.04* (0.03) rs1058930 15577956G4T (*1B) - 49 395 (298-552) 43 373 (291-478) 1 461 0.75 (0.36) rs7909236 15578055A4C (*1C) - 69 382 (291-478) 24 393 (300-552) 0.48 (0.62) rs17110453 ABCB1 À1A4G - 1 458 29 396 (270-592) 63 379 (297-477) 0.56 (0.3) rs2214102 61A4G N21D 63 384 (282-490) 29 386 (298-478) 1 437 0.52 (0.77) rs9282564 1199G4A S400N 83 385 (291-490) 10 386 (322-461) 0.74 (0.99) rs2229109 CYP3A4 24616372T4C (*1B) - 85 383 (296-490) 7 397 (270-641) 0.67 (0.72) rs2740574 CYP3A5 219-237G4A Frameshift 84 388 (297-490) 9 360 (176-726) 0.30 (0.36) rs776746 SLCO1B3 699G4A M233I 1 326 19 377 (299-481) 73 388 (291-490) 0.99 (0.46) rs7311358 767G4C G256A 67 386 (298-481) 26 383 (291-490) 0.63 (0.89) rs60140950 CYP1B1 1294C4G (*3) V432L 30 389 (270-530) 36 401 (298-490) 27 361 (300-470) 0.77 (0.24) rs1056836 ABCC1 7356253C4G - 65 394 (297-548) 27 368 (291-470) 1 332 0.04* (0.15) rs504348 ABCC2 1249G4A V417I 67 381 (291-490) 24 396 (297-552) 2 415 (368-468) 0.21 (0.39) rs2273697 3563T4A V1188E 87 386 (296-490) 5 370 (176-569) 0.7 (0.7) rs17222723 4544G4A C1515Y 75 389 (296-490) 3 355 (176-569) 0.72 (0.52) rs8187710 ABCG2 421C4A Q141K 61 374 (291-478) 32 408 (315-548) 0.4 (0.09) rs2231142 34G4A V12M 87 385 (291-490) 4 395 (296-726) 0.68 (0.83) rs2231137 ABCC10 2759T4C I920T 46 386 (297-478) 43 386 (291-548) 4 373 (326-467) 0.88 (0.89) rs2125739 Abbreviations: CL, clearance of unbound paclitaxel; SNP, single-nucleotide polymorphism.
X
ABCC2 p.Cys1515Tyr 20368717:135:1942
status: NEW
Login to comment

PMID: 16799996 [PubMed] Meier Y et al: "Interindividual variability of canalicular ATP-binding-cassette (ABC)-transporter expression in human liver."
No. Sentence Comment
154 Box-plot analysis of (A) normalized BSEP-expression against genetic variants of 1457TϾC(V444A) and 2155A Ͼ G(M677V); (B) MDR3-expression against 3826A Ͼ G (R652G); (C) MRP2-expression against 1286G Ͼ A(V417I), 3600T Ͼ A(V1188E), and 4581G Ͼ A(C1515Y) and MDR1 against 3435C Ͼ T and 2677G Ͼ T/A(A893S/T).
X
ABCC2 p.Cys1515Tyr 16799996:154:279
status: NEW
Login to comment

63 Primers and Probes of RealTime PCR for Allelic Discrimination of Single Nucleotide Polymorphisms (SNPs) in Whites Gene Exon cDNA PositionA SNPB GenBank Reference Amino Acid Exchange Sense-Antisense Primer Probesc ABCB11 13 1457 T Ͼ C rs2287617* V444A 5Ј-CTTTCTTCTCCAGATTCTAAATGACCTCA-3Ј/ VIC 5Ј-CCTGGTTTAATGACCATGT-3Ј 5Ј-GTCCTACCAGAGCTGTCATTTCC-3Ј FAM 5Ј-CTGGTTTAATGGCCATGT-3Ј ABCB11 17 2155 A Ͼ G Ref. 14,15** M677V 5Ј-TCATGCTGTGTTGAGTAGATGCA-3Ј/ VIC 5Ј- CTGAAGATGACATGCTT-3Ј 5Ј-GGTAGCTCCCTCTGCTAAAGGT-3Ј FAM 5Ј- ACTGAAGATGACGTGCTT-3Ј ABCB4 16 3826 A Ͼ G rs8187799* R652G 5Ј-TCCAGTCAGAAGAATTTGAACTAAATGATGAA-3Ј/ VIC 5Ј-CTGCCACTAGAATGG-3Ј 5Ј-GCCTAAATAGATTTCCAGCCATTTGG-3Ј FAM 5Ј-TGCCACTGGAATGG-3Ј ABCC2 10 1286 G Ͼ A rs2273697* V417I 5Ј-CCAACTTGGCCAGGAAGGA-3Ј/ VIC 5Ј-CTGTTTCTCCAACGGTGTA-3Ј 5Ј-GGCATCCACAGACATCAGGTT-3Ј FAM 5Ј-ACTGTTTCTCCAATGGTGTA-3Ј ABCC2 25 3600 T Ͼ A rs8187694* V1188E 5Ј-GCACCAGCAGCGATTTCTG-3Ј/ VIC 5Ј-ACACAATGAGGTGAGGAT-3Ј 5Ј-AGGTGATCCAGGAAAAGACACATTT-3Ј FAM 5Ј-ACAATGAGGAGAGGAT-3Ј ABCC2 32 4581 G Ͼ A rs8187710* C1515Y 5Ј-GTAATGGTCCTAGACAACGGGAAG-3Ј/ VIC 5Ј- AGAGTGCGGCAGCC -3Ј 5Ј-CCAGGGATTTGTAGCAGTTCTTCAG-3Ј FAM 5Ј-ATTATAGAGTACGGCAGCC-3Ј ABCB1 26 3435 CϾT rs1045642* synonym.
X
ABCC2 p.Cys1515Tyr 16799996:63:1310
status: NEW
Login to comment

141 Distribution of Genotypes and Allelic Frequencies of Investigated SNPs in Individuals With Low, Normal and High Transporter Expression Phenotypes SNP Study population Low expressorsA Normal expressorsB High expressionC 1) BSEP n ϭ 110 (100%) n ϭ 14 (100%) n ϭ 79 (100%) n ϭ 17 (100%) Alleles (2n) 220 (100%) 28 (100%) 158 (100%) 34 (100%) a) ABCB11 1457T>C (V444A): Genotypes: TT 19 (17%) 1 (7%) 14 (18%) 4 (24%) CC 29 (26%) 6 (43%) 19 (24%) 4 (24% TC 62 (56%) 7 (50%) 46 (58%) 9 (53%) Allelic frequency: C-allele 120 (55%) 19 (68%) 84 (53%) 17 (50%) b) ABCB11 2155A>G (M677V): Genotypes: AA 102 (93%) 14 (100%) 72 (91%) 16 (94%) AG 8 (7%) 7 (9%) 1 (6%) Allelic frequency: G-allele 8 (4%) 7 (7%) 1 (3%) 2) MDR3 n ϭ 110 (100%) n ϭ 13 (100%) n ϭ 86 (100%) n ϭ 11 (100%) Alleles (2n) 220 (100%) 26 (100%) 172 (100%) 22 (100%) ABCB4 3826A>G (R652G): Genotypes: AA 87 (89%) 8 (62%) 71 (83%) 8 (73%) AG 23 (21%) 5 (38%) 15 (17%) 3 (27%) Allelic frequency: G-allele 23 (10%) 5 (19%) 15 (9%) 3 (14%) 3) MRP2 n ϭ 110 (100%) n ϭ 11 (100%) n ϭ 90 (100%) n ϭ 9 (100%) Alleles (2n) 220 (100%) 22 (100%) 180 (100%) 18 (100%) a) ABCC2 1286G>A (V417I): Genotypes: GG 64 (58%) 7 (64%) 51 (57%) 6 (67%) AA 1 (1%) 1 (1%) GA 45 (41%) 4 (36%) 38 (42%) 3 (33%) Allelic frequency: A-allele 47 (26%) 4 (18%) 40 (22%) 3 (17%) b) ABCC2 3600T>A (V1188E): Genotypes: TT 95 (86%) 10 (91%) 80 (89%) 5 (56%) AA 1 (1%) 1 (11%) TA 14 (13%) 1 (9%) 10 (11%) 3 (33%) Allelic frequency: A-allele 16 (6%) 1 (5%) 10 (5%) 5 (28%) c) ABCC2 4581G>A (C1515Y): Genotypes: GG 95 (86%) 10 (91%) 80 (89%) 5 (56%) AA 1 (1%) 1 (11%) GA 14 (13%) 1 (9%) 10 (11%) 3 (33%) Allelic frequency: A-allele 16 (6%) 1 (5%) 10 (5%) 5 (28%) 4) MDR1 n ϭ 110 (100%) n ϭ 17 (100%) n ϭ 77 (100%) n ϭ 16 (100%) Alleles (2n) 220 (100%) 34 (100%) 154 (100%) 32 (100%) a) ABCB1 3435C>T: Genotypes: CC 23 (21%) 3 (18%) 16 (21%) 4 (25%) TT 28 (25%) 4 (24%) 20 (26%) 4 (25%) CT 59 (54%) 10 (58%) 41 (53%) 8 (50%) Allelic frequency: T-allele 115 (52%) 18 (53%) 81 (53%) 16 (50%) b) ABCB1 2677G>T/A (A893S/T): Genotypes: GG 31 (28%) 6 (35%) 20 (26%) 5 (31%) TT 21 (19%) 5 (29%) 15 (20%) 1 (6%) AA 1 (1%) 1 (6%) GT 48 (44%) 4 (24%) 35 (45%) 9 (56%) GA 4 (4%) 3 (4%) 1 (6%) TA 5 (5%) 1 (6%) 4 (5%) Allelic frequency: T/A-allele 95/11 (43%/5%) 15/3 (44%/9%) 69/7 (45%/5%) 11/1 (34%/3%) AIndividuals with phenotype low expressors (Ͻmean-1SD) and very low (Ͻmean-2SD) transporter expression levels.
X
ABCC2 p.Cys1515Tyr 16799996:141:1580
status: NEW
Login to comment

130 As indicated in Table 3, the overall distribution of the allelic variants in our study population was found to be similar to previously published data in whites,14,19 with the exception of ABCC2 variants 3600TϾA(V1188E) and 4581GϾA(C1515Y), which occurred with allelic frequencies of 6% in our study population as compared with the 1% recently published for a Finish collective.20 However, correlation of expression levels of transporter proteins with allelic variants of the corresponding transporter genes indicated a deviation from this distribution pattern.
X
ABCC2 p.Cys1515Tyr 16799996:130:244
status: NEW
Login to comment

150 A similar distribution and association with MRP2 expression was found for the 4581GϾA(C1515Y) (Table 3; Fig. 5C), indicating that the two ABCC2 SNPs 3600TϾA and 4581GϾA might be closely linked.
X
ABCC2 p.Cys1515Tyr 16799996:150:92
status: NEW
Login to comment

170 Interestingly, two alanine- containing ABCB11 haplotypes were encountered more frequently in patients with pri mary biliary cirrhosis or associated with higher Mayo Risk Scores in patients with primary sclerosing cholangitis.34 The 444AA phenotype therefore also could be a risk factor to develop acquired cholestasis under certain challenges, such as inhibition of BSEP function by certain drugs such as cyclosporine, troglitazone, or bosentan.1,2,13,35,36 Furthermore, MRP2 expression levels were significantly higher in the presence of the two linked polymorphisms in exon 28 (V1188E) and in exon 32 (C1515Y) compared with carriers of the reference alleles.
X
ABCC2 p.Cys1515Tyr 16799996:170:604
status: NEW
Login to comment

PMID: 17001288 [PubMed] Owen A et al: "Pharmacogenetics of HIV therapy."
No. Sentence Comment
171 Pharmacogenetics of HIV therapy Owen et al. 699 Table 1 Polymorphisms that have been studied within the context of metabolism, transport and toxicity (but not progression and response) along with the reference ID (where available), the genotypic consequence and the observed phenotype for antiretroviral drugs Gene SNP (haplotype) Reference SNP Genotypic consequence Phenotypic consequence Confirmation CYP3A4 A - 392G (CYP3A4*1B) rs2740574 Promoter; altered expression No effect on nelfinavir or efavirenz Yes for nelfinavir; controversial for efavirenz T878C (CYP3A4*18) rs4986909 L293P; altered activity No effect on efavirenz No CYP3A5 A6986G (CYP3A5*3) rs776746 Splice defect No effect on nelfinavir, saquinavir or efavirenz AUC but altered urinary metabolic ratio of saquinavir Yes for efavirenz G14690A (CYP3A5*6) rs10264272 Splice defect No effect on nelfinavir or efavirenz Yes CYP2C19 G681A (CYP2C19*2) rs4244285 Truncated protein Higher nelfinavir AUC and trend toward decreased virological failure; no effect on efavirenz Yes for efavirenz; controversial for nelfinavir CYP2D6 A2549del (CYP2D6*3) NT21914757 Frameshift Trend to higher plasma levels of nelfinavir and efavirenz No G1846A (CYP2D6*4) rs3892097 Splice defect Trend to higher plasma levels of nelfinavir and efavirenz No T1707del (CYP2D6*6) rs5030655 Frameshift Higher plasma nelfinavir concentrations No CYP2B6 G516 T (CYP2B6*6, *7, *9, *13, *19 and *20) rs3745274 Q172H Higher plasma and intracellular efavirenz AUCs and increased neurotoxicity Yes, numerous studies C1459T (CYP2B6*5 and *7) rs3211371 R487C No effect on nelfinavir or efavirenz No ABCB1 IVS1 - 80delG rs3214119 N/A No influence on cellular nelfinavir No A61G rs9282564 N21D No influence on cellular nelfinavir No TAG1 rs3789243 N/A No influence on cellular nelfinavir No G1199A rs2229109 S400N No influence on cellular nelfinavir No TAG5 rs1128503 N/A No influence on cellular nelfinavir No TAG6 rs2235046 N/A No influence on cellular nelfinavir No IVS21 + T49C rs2032583 N/A No influence on cellular nelfinavir No C3435T rs1045642 Synonymous Some evidence of an influence on plasma and intracellular nelfinavir; decreased efavirenz plasma concentrations; currently under debate; increase in HDL cholesterol with efavirenz Controversial G2677T rs2032582 Ala893Ser No effect on efavirenz, ritonavir, nelfinavir, indinavir or viral decay and CD4 count Yes IVS26 + T59G rs2235047 N/A No influence on cellular nelfinavir No IVS26 + T80C rs2235048 N/A Increased intracellular nelfinavir concentrations No TAG11 rs1186746 N/A No influence on cellular nelfinavir No TAG12 rs1186745 N/A No influence on cellular nelfinavir No ABCC1 G816A P272P No influence on cellular nelfinavir No T825C rs246221 V275V No influence on cellular nelfinavir No T1062C rs35587 Synonymous No influence on cellular nelfinavir No IVS9 + A8G rs35588 N/A No influence on cellular nelfinavir No IVS10 + C64T N/A No influence on cellular nelfinavir No ABCC2 C - 24T rs717620 N/A No influence on cellular nelfinavir No G1249A rs2273697 V417I No influence on cellular nelfinavir No C1436G Synonymous No influence on cellular nelfinavir No IVS16 - G47A N/A No influence on cellular nelfinavir No T3563A rs8187694 V1188E No influence on cellular nelfinavir No C4488T rs8187707 Synonymous No influence on cellular nelfinavir No IVS31 + G12A rs8187708 N/A No influence on cellular nelfinavir No IVS31 + C74T N/A No influence on cellular nelfinavir No G4544A rs8187710 C1515Y No influence on cellular nelfinavir No G + 259T N/A No influence on cellular nelfinavir No ABCG2 - 19571_ - 19568delT- CAC rs4148162 Deletion No influence on cellular nelfinavir No A-19541G N/A No influence on cellular nelfinavir No G34A rs2231137 V12M No influence on cellular nelfinavir No IVS2 + 35G rs4148152 N/A No influence on cellular nelfinavir No C421A rs2231142 Q141K No influence on cellular nelfinavir No APOCIII C-482T Pending Promoter Hyperlipidaemia in presence of ritonavir Yes T-455C Pending Promoter Hyperlipidaemia in presence of ritonavir Yes C3238G rs5128 30 UTR variant Hyperlipidaemia in presence of ritonavir Yes APOE 2060T/2198T (APOEe2) rs429358 R112C/R158C Hyperlipidaemia in presence of ritonavir Yes 2060T/2198C (APOEe3) rs7412 R112C/R158R Hyperlipidaemia in presence of ritonavir Yes TNFa G - 238A rs361525 Promoter Rapid development of lipoatrophy Controversial SPINK-1 C112T rs17107315 N34S Associated with risk of pancreatitis Yes, in general population CFTR G1717 - 1A Splice defect Associated with risk of pancreatitis Yes, in general population IVS8 5T Splice defect Associated with risk of pancreatitis Yes, in general population HLA-B HLA-B*57.1 N/A Abacavir hypersensitivity Yes, but not in all populations HLA-DR HLA-DRB1*0101 N/A Nevirapine hypersensitivity No HSPA1L C2437T rs2227956 M493T Abacavir hypersensitivity No UGT1A1 A(TA)7TAA, - 43_ - 42in- sTA (UGT1A1*28) rs8175347 Promoter; insertion at TATA box Gilberts syndrome, hyperbilirubinaemia in presence of atazanavir and indinavir but not saquinavir Yes MT-CO1 C7028T Synonymous Haplogroup T associated with greater incidence of peripheral neuropathy No 700 Pharmacogenetics and Genomics 2006, Vol 16 No The NNRTI nevirapine can also cause a hypersensitivity syndrome characterized by a rash with systemic symptoms; occasionally liver injury may be part of the clinical picture, or alternatively, may actually be the only manifestation.
X
ABCC2 p.Cys1515Tyr 17001288:171:3472
status: NEW
Login to comment

PMID: 18176959 [PubMed] Meier Y et al: "Increased susceptibility for intrahepatic cholestasis of pregnancy and contraceptive-induced cholestasis in carriers of the 1331T>C polymorphism in the bile salt export pump."
No. Sentence Comment
1 paulic@uhbs.ch Telephone: + 41-61-3287715 Fax: + 41-61-2653708 Received: July 12, 2007 Revised: September 12, 2007 Abstract AIM: To study the association of three common ABCB11 and ABCC2 polymorphisms (ABCB11: 1331T>C V444A; ABCC2: 3563T>A    V1188E and 4544G>A C1515Y) with intrahepatic cholestasis of pregnancy (ICP) and contraceptive-induced cholestasis (CIC).
X
ABCC2 p.Cys1515Tyr 18176959:1:283
status: NEW
Login to comment

88 Specifically, the CC genotype was encountered in 57.1% of all ICP patients (ICPnew, 47.6% and ICPold, 67.7%) and 100% of CIC patients compared to 20 and 32.2% in pregnant Table 2 New group of patients with ICP (ICPnew) Patient ID Age (yr) Liver parameters Comments Genotypes of SNPs ALT (ULN) AP (ULN) g-GT (ULN) tBili (ULN) tBA (ULN) No of preg/ No ICP Others ABCB11 1331T>C (V444A) ABCC2 3600T>A (V1188E) ABCC2 4581G>A (C1515Y) 1 36 0.9 2.3 3.3 0.8 10.7 2/1 CC TA GA 2 31 1.6 2.5.
X
ABCC2 p.Cys1515Tyr 18176959:88:422
status: NEW
Login to comment

90 Table 3 Characteristics of patients with oral CIC Patient ID Oral contraceptive Age (yr) Exposure time Liver parameters Comments Genotypes of SNPs ALT AP gGT tBili tBA Clinical features Histology ABCB11 1331T>C (V444A) ABCC2 3600T>A (V1188E) ABCC2 4581G>A (C1515Y) (ULN) (ULN) (ULN) (ULN) (ULN) 11 30 ʼg ethinylestradiol/ 75 ʼg gestodene 32 nd 4.9 1.7 1 10.9 22.3 Jaundice Intrahepatic cholestasis CC TT GG 2 30 ʼg ethinylestradiol/ 150 ʼg levonorgestrel 15 21 d 1 3 1 4.2 nd Jaundice, nausea, pruritus Extensive intrahepatic cholestasis CC TT GG 3 35 ʼg ethinylestradiol/ 50 ʼg levonorgestrel 40 2 yr 3.9 2.8 3.6 0.5 1.6 Pruritus Bland CC TT GG 4 35 ʼg ethinylestradio/ 2 mg cyproteron 34 nd 1 1.3 nd 2.8 1.6 Jaundice Extensive canalicular cholestasis, mild portal inflamation CC TA GA 1 Patient exhibited previous episodes of ICP.
X
ABCC2 p.Cys1515Tyr 18176959:90:257
status: NEW
Login to comment

105 DISCUSSION We investigated the risk association between different ABCB11 and ABCC2 polymorphisms in ICP and CIC, and correlated different genotypes with serum bile acid levels Table 4 Genotype distribution of non-synonymous ABCB11 variant site 1331T>C in patients and controls Genotype SNP ICPold ICPnew ICPtotal Pregnant controls Caucasian controls n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI ABCB11 1331T>C (V444A) 21 (100) 21 (100) 42 (100) 40 (100) 205 (100) TT (VV) - - 2 (9.5) 0.0-22.1 2 (4.8) 0.0-13.9 7 (17.5) 5.7-29.3 38(18.5) 13.2-23.9 CC (AA) 14 (67.7) 46.5 -86.8 10 (47.6) 26.3-69.0 24 (57.1) 36.0-78.3 8 (20) 7.6-32.4 66 (32.2) 25.8-38.6 TC (VA) 7 (33.3) 13.2-53.5 9 (42.9) 21.7-64.0 16 (38.1) 17.3-58.9 25 (62.5) 47.5-77.5 101 (49.3) 42.4-56.1 Frequency C allele 35 (83.3) 67.4-99.3 29 (69.0) 49.3-88.8 64 (76.2) 58.0-94.4 41 (51.3) 35.8-66.7 233 (56.8) 50.1-63.6 Frequency T allele 7 (16.7) 0.7-32.6 13 (31.0) 11.2-50.7 20 (23.8) 5.6-42.0 39 (48.8) 33.3-64.2 177 (43.2) 36.4-50.0 ABCC2 3563T>A (V1188E) 16 (100) 17 (100) 33 (100) 42 (100) 110 (100) TT (VV) 15 (93.8) 71.3-98.6 13 (76.5) 52.3-90.4 28 (84.8) 68.9-93.3 37 (88.1) 74.3-96.1 95 (86.4) 68.9-93.3 AA (EE) - - - - - - - - 1 (0.9) 0.0-5.0 TA (VE) 1 (3.1) 0.0-15.8 4 (23.5) 9.6-47.7 5 (15.2) 6.7-31.1 5 (11.9) 3.9-25.7 14 (12.7) 7.1-20.5 ABCC2 4544G>A (C1515Y) 16 (100) 17 (100) 33 (100) 42 (100) 110 (100) GG (CC) 15 (93.8) 71.3-98.6 13 (76.5) 52.3-90.4 28 (84.8) 68.9-93.3 36 (85.7) 71.4-94.6 95 (86.4) 68.9-93.3 AA (YY) - - - - - - - - 1 (0.9) 0.0-5.0 GA (CY) 1 (3.1) 0.0-15.8 4 (23.5) 9.6-47.7 5 (15.2) 6.7-31.1 6 (14.3) 5.4-28.6 14 (12.7) 7.1-20.5 Results are given with 95 percent confidence interval (95% CI).
X
ABCC2 p.Cys1515Tyr 18176959:105:1351
status: NEW
Login to comment

31 Furthermore, two non-synonymous ABCC2 polymorphisms (V1188E and C1515Y) showed significant differences in hepatic MRP2 expression levels compared to the wildtype sequence, which could be relevant for the extent of BSEP trans inhibition[25] .
X
ABCC2 p.Cys1515Tyr 18176959:31:64
status: NEW
Login to comment

59 ABCC2: Three non-synonymous polymorphisms with a potential impact on MRP2 function and expression were chosen for genotyping[25] : 1249G>A variant (V417I, rs2273697), 3563T>A (V1188E, rs17222723) and 4544G>A (C1515Y, rs8187710).
X
ABCC2 p.Cys1515Tyr 18176959:59:209
status: NEW
Login to comment

82 Table 1 Primers and probes of real-time PCR for allelic discrimination of ABCC2 SNPs in Caucasians cDNA position 1 SNP Exon Amino acid change Eense-/antisense primer Probes 2 1249 G>A 10 V417I 5'-CCAACTTGGCCAGGAAGGA-3'/ VIC 5'-CTGTTTCTCCAACGGTGTA-3' 5'-GGCATCCACAGACATCAGGTT-3' FAM 5'-ACTGTTTCTCCAATGGTGTA-3' 3563 T>A 25 V1188E 5'-GCACCAGCAGCGATTTCTG-3'/ VIC 5'-ACACAATGAGGTGAGGAT-3' 5'-AGGTGATCCAGGAAAAGACACATTT-3' FAM 5'-ACAATGAGGAGAGGAT-3' 4544 G>A 32 C1515Y 5'-GTAATGGTCCTAGACAACGGGAAG-3'/ VIC 5'-AGAGTGCGGCAGCC-3' 5'-CCAGGGATTTGTAGCAGTTCTTCAG-3' FAM 5'-ATTATAGAGTACGGCAGCC-3' 1 cDNA sequence from GenBank accession numbers NM_000392 starting at the ATG; 2 For each SNP two probes were designed and labeled with the fluorescent reporter dyes VIC (allele 1) and FAM (allele 2).
X
ABCC2 p.Cys1515Tyr 18176959:82:455
status: NEW
Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."
No. Sentence Comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined.
X
ABCC2 p.Cys1515Tyr 20103563:7118:755
status: NEW
Login to comment

7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined.
X
ABCC2 p.Cys1515Tyr 20103563:7115:741
status: NEW
Login to comment

PMID: 22565165 [PubMed] Grover S et al: "Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs."
No. Sentence Comment
116 Of all the blocks, block 1 (rs1885301-rs2804402) in the promoter region and Table 2 (continued) N dbSNP ida Positionb Allelesc Gene location (effect) Function MAF 33 rs3758395 chr10:101602004 c.3741 + 154T > C Intron 26 0.190 34 rs17216177 chr10:101603522 c.3742 - 34T > C Intron 26 0.000 35 rs3740066 chr10:101604207 c.3972C > T Exon 28 (Ile1324Ile) m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of irinotecan (ABCC2*2 containing C allele) [34] 0.327 36 rs72558202 chr10:101605538 c.4145A > G Exon 29 (Gln1382Arg) 0.000 37 rs3740065 chr10:101605693 c.4146 + 154A > G Intron 29 0.211 38 rs56296335 chr10:101610393 c.4348G > C Exon 31 (Ala1450Ser) k Activity, kexpression and impaired membrane localization [40] 0.000 39 rs3740063 chr10:101610723 c.4508 + 170T > C Intron 31 0.345 40 rs8187710 chr10:101611294 c.4544G > A Exon 32 (Cys1515Tyr) m Expression [41] 0.017 452 Pharmacogenetics and Genomics 2012, Vol 22 No 6 block 2 (rs4919395-rs2756104-rs4148385-rs2180990- rs35191126) spanning introns 1 and 2, separated by a 1.5 kb region, were smaller spanning .5 and 6 kb regions, respectively.
X
ABCC2 p.Cys1515Tyr 22565165:116:965
status: NEW
Login to comment

PMID: 22318656 [PubMed] Deo AK et al: "Interindividual variability in hepatic expression of the multidrug resistance-associated protein 2 (MRP2/ABCC2): quantification by liquid chromatography/tandem mass spectrometry."
No. Sentence Comment
88 SNP-1, SNP-2, and SNP-3 represent -24CϾT (rs717620), 68693GϾA(C1515Y; rs8187710) and 21214GϾA(V417I; rs2273697), respectively.
X
ABCC2 p.Cys1515Tyr 22318656:88:74
status: NEW
Login to comment

90 DEO ET AL. atUnivOfNCAcqSrvcsonOctober4,2012dmd.aspetjournals.orgDownloadedfrom 64260GϾT(V1430V; rs1137968), 67932CϾT(H1496H; rs8187707), and 68693GϾA(C1515Y; rs8187710) in the promoter, coding and noncoding regions.
X
ABCC2 p.Cys1515Tyr 22318656:90:170
status: NEW
Login to comment

PMID: 22290738 [PubMed] Arlanov R et al: "Functional characterization of protein variants of the human multidrug transporter ABCC2 by a novel targeted expression system in fibrosarcoma cells."
No. Sentence Comment
5 Western blotting revealed lower (30-65%) ABCC2 expression for D333G, R1174H, and R1181L as compared with wild type (WT; 100%), whereas the linked variant V1188E/C1515Y resulted in higher expression (150%).
X
ABCC2 p.Cys1515Tyr 22290738:5:161
status: NEW
Login to comment

8 Contrary to protein data, the double variant V1188E/ C1515Y decreased specific transport activity for GS-MF and GS-MCB by 40%.
X
ABCC2 p.Cys1515Tyr 22290738:8:53
status: NEW
Login to comment

10 D333G, R1174H, R1181L, N1244K, P1291L, and double variant V1188E/C1515Y have been identified as most promising for further clinical evaluation.
X
ABCC2 p.Cys1515Tyr 22290738:10:65
status: NEW
Login to comment

42 Materials and Methods Construction of Enhanced Green Fluorescent Protein (EGFP) Tagged and Untagged hABCC2(V1188E/C1515Y) Expression Plasmids A 5.3-kB cDNA encoding the human ABCC2 variant V1188E/C1515Y (GenBank accession number U49248.1) was subcloned into the vector pGEM3 provided by Professor Dr Piet Borst, The Netherlands Cancer Institute, Amsterdam, The Netherlands [Evers et al., 1998].
X
ABCC2 p.Cys1515Tyr 22290738:42:114
status: NEW
X
ABCC2 p.Cys1515Tyr 22290738:42:196
status: NEW
Login to comment

46 The resulting plasmid was ABCC2(V1188E/C1515Y)- EGFP.pEGFP-N1.
X
ABCC2 p.Cys1515Tyr 22290738:46:39
status: NEW
Login to comment

48 The PCR fragment was cloned into the SpeI/NotI site of ABCC2(V1188E/C1515Y)-EGFP.pEGFP-N1 obtaining ABCC2(V1188E/C1515Y).pEGFP-N1 without an EGFP tag.
X
ABCC2 p.Cys1515Tyr 22290738:48:68
status: NEW
X
ABCC2 p.Cys1515Tyr 22290738:48:113
status: NEW
Login to comment

173 Because V1188E and C1515Y are linked, only the double variant V1188E/C1515Y was investigated.
X
ABCC2 p.Cys1515Tyr 22290738:173:19
status: NEW
X
ABCC2 p.Cys1515Tyr 22290738:173:69
status: NEW
Login to comment

178 ABCC2 Missense Variants Selected for Study on Expression, Localization, and Function rs# NCBI Genetic variationa Amino acid Ethnicity Allele frequency (%) Nb Data source Predicted phenotypec rs927344 c.116T>A F39Y AA 2.3 86 Current study Benign AA 2 200 pharmGKB KO 0 94 Current study rs17222674 c.998A>G D333G AA 0 88 Current study Probably damaging AA 1 200 pharmGKB KO 0 94 Current study rs7080681 c.1058G>A R353H AA 6.7 90 Current study Benign AA 3.5 200 pharmGKB KO 0 94 Current study rs17222589 c.1457C>T T486I AA 0 84 Current study Benign KO 3.7 82 Current study JA 5 20 pharmGKB JA 2.3 144 Itoda et al. (2002) rs17222632 c.2009T>C I670T AA 1.1 92 Current study Benign AA 1.5 200 pharmGKB KO 0 92 Current study rs41318029 c.2761G>A G921S AA 0 84 Current study Benign KO 0 92 Current study CA 1 120 NCBI dbSNP rs45441199 c.3107T>C I1036T AA 0 96 Current study Benign AA 0.5 200 pharmGKB KO 0 94 Current study CA 0.5 198 pharmGKB CA 1 120 NCBI dbSNP rs139188247 c.3521G>A R1174H AA 2.3 86 Current study Probably damaging KO 0 94 Current study JA 1 144 Itoda et al. (2002) rs8187692 c.3542G>T R1181L AA 5.8 86 Current study Probably damaging AA 8.5 200 pharmGKB KO 0 96 Current study rs17222723 c.3563T>A V1188E AA 5.8 86 Current study Benign AA 6.5 200 pharmGKB KO 0 96 Current study CA 7.5 200 pharmGKB c.3732T>G N1244K JA 1.5 144 Itoda et al. (2002) Possibly damaging rs17216317 c.3872C>T P1291L AA 4.7 86 Current study Probably damaging AA 2 86 pharmGKB KO 0 86 Current study CA 0.5 196 pharmGKB rs8187710 c.4544G>A C1515Y AA 13 92 Current study Benign AA 19.6 194 pharmGKB KO 0 94 Current study CA 8 198 pharmGKB AA, African-American; CA, Caucasian; KO, Korean; JA, Japanese.
X
ABCC2 p.Cys1515Tyr 22290738:178:1524
status: NEW
Login to comment

182 R1181L (range 30-55% of WT, P < 0.01), whereas higher expression was found for the double variant V1188E/C1515Y (150% of WT, P < 0.01) (Supp. Fig. S5).
X
ABCC2 p.Cys1515Tyr 22290738:182:105
status: NEW
Login to comment

183 Cellular Localization of ABCC2 WT and Variants in HEK 293 Cells The variable ABCC2 expression in HEK 293 cells carrying the D333G, R1174H, R1181L, and V1188E/C1515Y variants suggests that processing or protein stability of ABCC2 could be affected by these variants.
X
ABCC2 p.Cys1515Tyr 22290738:183:158
status: NEW
Login to comment

204 Interestingly, the variable noninhibited EGFP value measured by the peak channel was approximately 800-fold for ABCC2 (WT) and approximately 500-fold (R1174H) and 1500- fold (V1188E/C1515Y) for ABCC2 variants compared with nonfluorescing cells (HT1080).
X
ABCC2 p.Cys1515Tyr 22290738:204:182
status: NEW
Login to comment

205 With the exception of V1188E/C1515Y, the degree of downregulation after 72 hr did not seem to depend upon the type of variant construct used and the particular clone analyzed.
X
ABCC2 p.Cys1515Tyr 22290738:205:29
status: NEW
Login to comment

206 The EGFP value was approximately 10-fold for ABCC2 (WT and 11 variants) compared with 20-fold for the ABCC2 double variant V1188E/C1515Y.
X
ABCC2 p.Cys1515Tyr 22290738:206:130
status: NEW
Login to comment

210 D333G, R1174H, and R1181L exhibited a 40%, 70%, and 35% reduction in protein expression, respectively, whereas the double variant V1188E/C1515Y resulted in a 150% increase in protein expression compared with WT (P < 0.01).
X
ABCC2 p.Cys1515Tyr 22290738:210:137
status: NEW
Login to comment

217 The D333G, R353H, T486I, G921S, and P1291L variants showed a lower transport activity for GS-MCB (71%, 60%, 75%, 63%, and 51% of WT, P < 0.01) but not for GS-MF, whereas the variants F39Y, I1036T, and V1188E/C1515Y did not alter ABCC2-mediated transport for either substrate.
X
ABCC2 p.Cys1515Tyr 22290738:217:208
status: NEW
Login to comment

231 Notably, the double variant V11888E/C1515Y showed the highestproteinexpressionlevelbutcauseda40%decreaseinspecific efflux of GS-MCB and GS-MF.
X
ABCC2 p.Cys1515Tyr 22290738:231:36
status: NEW
Login to comment

236 EGFP Kinetics of the ABCC2 Variants D333G, R1174H, R1181L, and V1188E/C1515Y To elucidate whether protein stability will affect degradation of ABCC2 after adding of doxycycline (1 μg/ml), we investigated EGFP kinetics of the ABCC2 D333G, R1174H, R1181L, and V1188E/C1515Y variants expressed by Rht14-10 cells.
X
ABCC2 p.Cys1515Tyr 22290738:236:70
status: NEW
X
ABCC2 p.Cys1515Tyr 22290738:236:271
status: NEW
Login to comment

238 No differences in EGFP kinetics for the ABCC2 variants D333G, R1174H, R1181L, and V1188E/C1515Y were detected, indicating no changes in protein stability (Supp. Fig. S11).
X
ABCC2 p.Cys1515Tyr 22290738:238:89
status: NEW
Login to comment

252 Compared with the ABCC2 reference sequence, the expression of ABCC2wasreducedforthethreemissensevariantsD333G,R1174H, and R1181L (range 30-65% of WT), whereas the double variant V1188E/C1515Y revealed a significantly higher expression (150% of WT).
X
ABCC2 p.Cys1515Tyr 22290738:252:185
status: NEW
Login to comment

253 Altered protein expression of the ABCC2 variants D333G, R1174H, R1181L, and V1188E/C1515Y seems not to be the direct consequence of impaired or increased protein stability (Supp. Fig. S11), thereby suggesting alteration in synthesis or stability of the mutant ABCC2 mRNA.
X
ABCC2 p.Cys1515Tyr 22290738:253:83
status: NEW
Login to comment

266 Interestingly, although the double variant V1188E/C1515Y showed the greatest expression of ABCC2 protein (150% of WT), this did not result in an increased specific efflux of GS-MF and GS-MCB because transport activities were virtually similar to WT.
X
ABCC2 p.Cys1515Tyr 22290738:266:50
status: NEW
Login to comment

272 The selected variants R1174H, R1181L, and V1188E (linked to C1515Y) from the present study, in addition to two recently identified variants that cause Dubin-Johnson syndrome (R1150H, I1173F), are located at the same gene region between the transmembrane helices TM15 and TM16.
X
ABCC2 p.Cys1515Tyr 22290738:272:60
status: NEW
Login to comment

279 The total allele frequency for all functionally relevant ABCC2 protein variants (D333G, R1174H, R1181L, V1188E/C1515Y, and P1291L) was highest in the African-American subjects, at approximately 20%.
X
ABCC2 p.Cys1515Tyr 22290738:279:111
status: NEW
Login to comment

281 The double variant V1188E/C1515Y has been associated with differences in tissue expression by several in vivo studies, resulting in possible consequences for disease susceptibility and/or drug response, underscoring the clinical importance of ABCC2 V1188E/C1515Y [Elens et al., 2009; Grisk et al., 2009; Meier et al., 2005; Ni et al., 2010; Sookoian et al., 2009; Wojnowski et al., 2005].
X
ABCC2 p.Cys1515Tyr 22290738:281:26
status: NEW
X
ABCC2 p.Cys1515Tyr 22290738:281:256
status: NEW
Login to comment

300 Conservation of the ABCC2 Missense Variants Among Other ABCC Orthologs and Homologs Protein Speciesa F39Y D333G R353H T486I I670T G921S I1036T R1174H R1181L V1188E N1244K P1291L C1515Y ABCC2 Human F D R T I G I R R V N P C Mouse F D P K V S I R R K N P Y Rat F D S N V S I R R K N P Y Rabbit F D P N V G L R R I N P Y Rhesus F D R T M S I R R V N P Y ABCC1 Human Y D T T V G I R R L Y P Y Mouse Y D R T V G A R R L Y P C Rat Y D R T V V V R R L Y P C Macaque Y D T T V G I R R L Y P Y Dog Y D K T V G I R R L Y P C ABCC3 Human Y D P A V G F R D T Y E F Mouse Y N P T V V L R D T Y P F Rat Y D P T V G L R D A Y P F ABCC4 Human - E Y S V R L R R A Y P Y ABCC5 Human - Q A Y C P I H E E Y P E ABCC6 Human Y D P H V K I R P A A P S ABCC11 Human - C E K C T C H D R I Q F Multiple sequence alignment was performed using ClustalW (www.ebi.ac.uk/clustalw).
X
ABCC2 p.Cys1515Tyr 22290738:300:178
status: NEW
Login to comment

303 V1188E/C1515Y variants showed the greatest alterations in function and/or expression in the ScIn in vitro system.
X
ABCC2 p.Cys1515Tyr 22290738:303:7
status: NEW
Login to comment

PMID: 22027652 [PubMed] Elens L et al: "Functional defect caused by the 4544G>A SNP in ABCC2: potential impact for drug cellular disposition."
No. Sentence Comment
1 The 4544G > A (rs8187710) single nucleotide polymorphism (SNP), which is coding for a C1515Y substitution, has been previously associated with susceptibility to cholestatic liver disease, doxorubicin cardiotoxicity, nonalcoholic fatty liver disease, decreased graft function after renal transplantation and tenofovir-induced proximal nephropathy.
X
ABCC2 p.Cys1515Tyr 22027652:1:86
status: NEW
Login to comment

9 Conclusion The C1515Y amino acid substitution caused by the 4544G > A SNP in ABCC2 impairs its ATPase activity and is associated with higher cellular accumulation of ABCC2 substrates.
X
ABCC2 p.Cys1515Tyr 22027652:9:15
status: NEW
Login to comment

PMID: 21451505 [PubMed] Franke RM et al: "Effect of ABCC2 (MRP2) transport function on erythromycin metabolism."
No. Sentence Comment
55 (b) Correlation of observed 14CO2 production over the course of 1 h from the same patients, with predicted values obtained from a binomial equation originally derived from data obtained in healthy volunteers.23 Table 1  Description and allele frequencies of the investigated ABCC2 variants ABCC2 genotype Position Effecta Functionb NCBI ID p q ABCC2 -1549G>A 5'-Flanking - Unknown rs1885301 0.843 0.157 ABCC2 -1019A>G 5'-Flanking - Unknown rs2804402 0.617 0.383 ABCC2 -24C>T 5' UTR - Decreased rs717620 0.832 0.168 ABCC2 1249G>A Exon 10 V417I Unknown rs2273697 0.791 0.209 ABCC2 IVS26 -34T>C Intron 26 Exon 26 Unknown rs8187698 0.939 0.061 ABCC2 3972C>T Exon 28 I1324I Unknown rs3740066 0.640 0.360 ABCC2 4544G>Ac Exon 32 C1515Y Unknown rs8187710 0.971 0.029 Hardy-Weinberg notation for allele frequencies.
X
ABCC2 p.Cys1515Tyr 21451505:55:736
status: NEW
Login to comment

PMID: 21072184 [PubMed] Ni W et al: "Flavopiridol pharmacogenetics: clinical and functional evidence for the role of SLCO1B1/OATP1B1 in flavopiridol disposition."
No. Sentence Comment
214 This is a non-synonymous SNP resulting in a C1515Y alteration and is part of a haplotype with the rs17222723 SNP (also a non-synonymous SNP with a V1188E residue change).
X
ABCC2 p.Cys1515Tyr 21072184:214:44
status: NEW
Login to comment

PMID: 20082599 [PubMed] Jemnitz K et al: "ABCC2/Abcc2: a multispecific transporter with dominant excretory functions."
No. Sentence Comment
396 Finally, the effect Table 5.  Pharmacokinetics of substrates affected by ABCC2/Abcc2. Compound Assay Data References Endogenous compounds E2-17-beta-Gluc In vitro (CMV) and in vivo (biliary excretion after i.v.) experiments Impaired in EHBR rats Morikawa et al., 2000 Hydroxy-nonenal-gluc Biliary clearance No detectable excretion in EHBR rats Ji et al., 2002 Drugs and drug metabolites Acetaminophen sulfate IPL Rate constant of biliary excretion was decreased by 90% in TR- rats, a further 50% decrease upon GF admin Zamek-Gliszczynski et al., 2005 Acetaminophen, sulfate, and glucuronide IPL A- sulf 20-30% in TRA- Gluc; A-GS negligible in TR- Xiong et al., 2000 Acetaminophen, glutathione, -mercapturate, and glucuronide Biliary excretion after i.v. administration Biliary conc of A-GSH negligible; A-Gluc; A-NAC significantly reduced in TR- Chen et al., 2003a Acetaminophene glucuronide Single-pass liver perfusion (wild type vs. TR- ) 500-fold lower excretion rate in TR- liversXiong et al., 2002 Azithromycin Bolus injection, biliary excretion 60% lower in EHBR rats (0.7 vs. 1.2% in SD) Sugie et al., 2004 Cefoperazone Biliary and urinary excretion Biliary excretion decreased by 90% in EHBR rats Kato et al., 2008 Cisplatin In vitro and i.p. in vivo xenograft experiments Lentiviral RNAi adm knocked down ABCC2 exp to cca 20%; cisp accumulation 3-4-fold incr; reduced IC50 4-5-fold; worked in vivo Xie et al., 2008 Diclofenac glucuronide Liver perfusion (wild type vs. TR- ) 30-fold lower excretion in TR- livers Seitz et al., 1998 [D-penicillamine2,5]enkephalin (DPDPE) Sandwich hepatocytes Biliary clearance decreased by 83% Hoffmaster et al., 2005 Doxorubicin IPL Biliary excretion decreased by 30% in TR- rats Gaugg et al., 2001 In vitro (K562/ADR) and in vivo (biliary clearance) Biliary excretion reduced in EHBR rats Asakura et al., 2004 Clinical Val1188Glu-Cys1515Tyr haplotype associated with acute anthracycline cardiotoxicity (ACT) Wojnowski et al., 2005 E3040 (6-hydroxy-5,7-dimethyl-2- methylamino-4-(3-pyridylmethyl) benzothiazole) and glucuronide IPL and VT In EHBR biliary clearance of E3040G was 1/30 of wild type Takenaka et al., 1995 Enalapril; enalaprilate IPL Biliary excretion reduced to almost zero in EHBR rat Liu et al., 2006 Ezetimibe and glucuronide Intestinal secretion upon rifampicin treatm.
X
ABCC2 p.Cys1515Tyr 20082599:396:1884
status: NEW
Login to comment

PMID: 19857663 [PubMed] Pazik J et al: "Multidrug resistance-associated protein 2 gene (ABCC2) variant in kidney allograft recipients."
No. Sentence Comment
11 The 4544GϾA variant of ABCC2 (rs8187710) leads to an amino acid alteration from cysteine to tyrosine at position 1515.
X
ABCC2 p.Cys1515Tyr 19857663:11:86
status: NEW
Login to comment

PMID: 19480556 [PubMed] Aleksunes LM et al: "Application of multivariate statistical procedures to identify transcription factors that correlate with MRP2, 3, and 4 mRNA in adult human livers."
No. Sentence Comment
189 For example, two polymorphisms in MRP2 (V1188E, C1515Y) are associated with increased expression of MRP2 in human liver (Meier et al. 2006).
X
ABCC2 p.Cys1515Tyr 19480556:189:48
status: NEW
Login to comment

PMID: 19214140 [PubMed] Grisk O et al: "Multidrug resistance-related protein 2 genotype of the donor affects kidney graft function."
No. Sentence Comment
187 Genetic analyses All samples were genotyped for five ABCC2 variants ( - 24C > T, 1249G > A [V417I], 3972C > T, 4544G > A [C1515Y], 3563T > A [V1188E]).
X
ABCC2 p.Cys1515Tyr 19214140:187:122
status: NEW
Login to comment

189 In line with previous data [16], there was complete linkage disequilibrium between polymorphisms 3563T > A [V1188E] and 4544G > A [C1515Y].
X
ABCC2 p.Cys1515Tyr 19214140:189:131
status: NEW
Login to comment

PMID: 18509327 [PubMed] Baker SD et al: "Pharmacogenetic pathway analysis of docetaxel elimination."
No. Sentence Comment
42 Visual genotyping of the CYP3A locus We next used the Centre d`Etude du Polymorphisme Humain (CEPH) HapMap samples (http://www.cephb.fr/cephdb/) Table 2  Description and allele frequencies of the studied variants Allele frequencya Gene (allele)b dbSNP ID Region Effectc p q SLCO1B3   334T>G(*2) rs4149117 Exon3 S112A 0.147 0.853   439A>G(*3) N/A Exon4 T147A 0.995 0.005   699G>A(*4) rs7311358 Exon6 M233I 0.159 0.841   767G>C(*5) N/A Exon7 G256A 0.811 0.189   1559A>C(*6) N/A Exon11 H520P 1.00 0   1679T>C(*7) rs12299012 Exon11 V560A 0.984 0.016 CYP3A4   -392A>G(*1B) rs2740574 5'-Flanking - 0.951 0.049 CYP3A5   6986A>G(*3C) rs776746 Intron3 Frameshift 0.076 0.924 ABCB1   1236C>T(*8) rs1128503 Exon12 G412G 0.539 0.461   2677G>T/A(*7) rs2032582 Exon21 A893S/T 0.556 0.422/0.022   3435C>T(*6) rs1045642 Exon26 I1145I 0.478 0.522 ABCC2   -1019A>G rs2804402 5'-Flanking - 0.614 0.386   -24C>T rs717620 5'-UTR - 0.815 0.185   1249G>A rs2273697 Exon 10 V417I 0.789 0.211   IVS26 -34T>C rs8187698 Intron 26 Exon 26 0.946 0.054   3972C>T rs3740066 Exon28 I1324I 0.647 0.353   4544G>Ad rs8187710 Exon32 C1515Y 0.967 0.033 UTR, untranslated region; dbSNP, single-nucleotide polymorphism database.
X
ABCC2 p.Cys1515Tyr 18509327:42:1223
status: NEW
Login to comment

PMID: 18597651 [PubMed] Levesque E et al: "Pharmacokinetics of mycophenolate mofetil and its glucuronide metabolites in healthy volunteers."
No. Sentence Comment
102 Nucleotide position Polymorphism Amino acid Reported impact Present study Ref. Observed frequency PK effect* Promoter -24C>T ↓ mRNA expression 0.24 25% ↑ AcMPAG [28] Exon 10 1219C>T Leu407Leu ‡ 0.01 - 1234A>G Arg412Gly ↓ Activity 0 - [33] 1249G>A Val417Ile ↓ or = expression 0.21 NS [29,30] 1289A>G Lys430Arg Unknown 0 - [32] 1446C>G Thr482Thr ↑ mRNA expression 0.01 - [32] Exons 25/32 3563T>A/ 4544G>A Val1188Glu/ Cys1515Tyr ↑ Expression 0.04 NS [31] Exon 28 3972C>T Ile1324Ile Altered mRNA stability 0.43 NS [34] *Multivariate analysis ‡In-vitro functional impact not evaluated The PK parameters of the ABCC2 codon 482 variant are presented in Figure 1C.
X
ABCC2 p.Cys1515Tyr 18597651:102:457
status: NEW
Login to comment

PMID: 18334920 [PubMed] Haenisch S et al: "Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol."
No. Sentence Comment
17 So far, the polymorphism -24C > T in the 50 -untranslated region, the nonsynonymous single nucleotide polymorphisms (SNPs) c.1249G > A (V417I), c.3563T > A (V1188E), c.4544G > A (C1515Y), and the synonymous SNPs 1446C > G (Thr482Thr) and 3972C > T (I1324I) were subjects of evaluations [15-17].
X
ABCC2 p.Cys1515Tyr 18334920:17:179
status: NEW
Login to comment

47 The SNPs -24C > T (rs717620), -23G > A (rs17216156) in the 50 -UTR, c.1446C > G (T482T), recently described by Niemi et al. [17], c.1457C > T (T486I, rs45518933), c.3542G > T (R1181L, rs8187692), c.3561G > A (E1187E, rs45622934), c.3563T>A (V1188E rs17222723), c.4544G>A (C1515Y, rs8187710) were determined by pyrosequencing using the PSQ 96HS system (Biotage, Uppsala, Sweden).
X
ABCC2 p.Cys1515Tyr 18334920:47:272
status: NEW
Login to comment

PMID: 18974617 [PubMed] Ho WF et al: "Genetic variations of the ABCC2 gene in the Chinese, Malay, and Indian populations of Singapore."
No. Sentence Comment
54 Among the reported variations, the ones that may be of functional relevance include -24CÀT,7,25) 1249GÀA (Val417Ile),5) 3563TÀA (Val1188Glu),5,26-28) 3972CÀT (Ile1324Ile),25) and 4544GÀA (Cys1515Tyr).26,28) The -24CÀT polymorphism was found to associate with increased plasma methotrexate concentrations in pediatric leukemia patients.7) We have also previously observed a trend for a genotypic-phenotypic correlation between -24CÀT polymorphism and increased irinotecan AUC(0, /).29) -24CÀT and 3972CÀT (Ile1324Ile) were linked to higher response rates to irinotecan and longer progression-free survival in patients with advanced non-small cell lung cancer.25) However, a study on the disposition of nitrocamptothecin and its aminocamptothecin metabolite in relation to the 3972CÀT variation revealed no significant association.30) 3563TÀA (Val1188Glu) and 4544GÀA (Cys1515Tyr) were correlated with high MRP2 expression,28) and increased susceptibility for anthracycline-induced cardiotoxicity.26) 3563TÀA (Val1188Glu) was also significantly associated with pruritus in primary biliary cirrhosis.27) Genetic polymorphisms in ABCC2 might thus constitute a risk factor for the development of acquired forms of cholestatic liver diseases.28) Mutations in the transmembrane domain: 1249GÀA (Val417Ile), 1457CÀT (Thr486Ile), and 3563TÀA (Val1188Glu) could affect their substrate specificities though their transporter activities might not be completely disrupted.5) All reported nonsynonymous variations detected in this study were predicted to be benign using the PolyPhen program.
X
ABCC2 p.Cys1515Tyr 18974617:54:213
status: NEW
X
ABCC2 p.Cys1515Tyr 18974617:54:927
status: NEW
Login to comment

PMID: 17376120 [PubMed] Simon C et al: "Intestinal expression of cytochrome P450 enzymes and ABC transporters and carbamazepine and phenytoin disposition."
No. Sentence Comment
27 The role of ABCC2 polymorphisms on MRP2 expression is less well established, but recent data indicate that hepatic MRP2 expression is influenced by two SNPs in positions 1188 (V1188E) and 1515 (C1515Y) of the MRP2 protein.
X
ABCC2 p.Cys1515Tyr 17376120:27:194
status: NEW
Login to comment

PMID: 16847695 [PubMed] Nies AT et al: "The apical conjugate efflux pump ABCC2 (MRP2)."
No. Sentence Comment
151 These Abcc2-deficient mice are apparently healthy and fertile, as are Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references damaging transport function [47] Exon 30 c.4175_4180del6 p.R1392_M1393del2 DJS No ABCC2 protein in liver [170] Impaired sorting and trafficking [79] [79, 170] Exon 31 c.4348 G>A p.A1450T Possibly damaging Reduced protein levels [50] T: 0.010 [62] [62] Exon 31 c.4430 C>T p.T1477M Benign T: 0.006 [51] Exon 32 c.4544 G>A p.C1515Y Benign A: 0.047 rs8187710 A: 0.116 rs17222568 NCBI National Center for Biotechnology Information, SNP single nucleotide polymorphism, DJS Dubin-Johnson syndrome a As recommended by the Human Genome Variation Society (http://www.hgvs.org/mutnomen) and by ref [26], nucleotide position +1 is the A of the ATG of the translation initiation codon in the ABCC2 cDNA sequence, "c."
X
ABCC2 p.Cys1515Tyr 16847695:151:679
status: NEW
Login to comment

152 These Abcc2-deficient mice are apparently healthy and fertile, as are Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references damaging transport function [47] Exon 30 c.4175_4180del6 p.R1392_M1393del2 DJS No ABCC2 protein in liver [170] Impaired sorting and trafficking [79] [79, 170] Exon 31 c.4348 G>A p.A1450T Possibly damaging Reduced protein levels [50] T: 0.010 [62] [62] Exon 31 c.4430 C>T p.T1477M Benign T: 0.006 [51] Exon 32 c.4544 G>A p.C1515Y Benign A: 0.047 rs8187710 A: 0.116 rs17222568 NCBI National Center for Biotechnology Information, SNP single nucleotide polymorphism, DJS Dubin-Johnson syndrome a As recommended by the Human Genome Variation Society (http://www.hgvs.org/mutnomen) and by ref [26], nucleotide position +1 is the A of the ATG of the translation initiation codon in the ABCC2 cDNA sequence, "c."
X
ABCC2 p.Cys1515Tyr 16847695:152:679
status: NEW
Login to comment

PMID: 17241877 [PubMed] Daly AK et al: "Genetic susceptibility to diclofenac-induced hepatotoxicity: contribution of UGT2B7, CYP2C8, and ABCC2 genotypes."
No. Sentence Comment
33 PCR-RFLP Assay Primers and Conditions Gene and polymorphism Primers Annealing temperature Restriction enzyme PCR product and digestion pattern UGT2B7 C-161T GTGAACAGATCATTTACCTTCATTTGTCTT 1 min at 53°C BbsI C allele 239 bp and 20 bp (rs17551675) CAATTCCCAGAGCTAAAGCAAAAGCTCAGT T allele 259 bp (not digested) UGT2B7 A-79G GTGAACAGATCATTTACCTTCATTTGTCTT 1 min at 53°C HpyCH4III A allele 210 bp and 49 bp (no rs listed) CAATTCCCAGAGCTAAAGCAAAAGCTCAGT G allele 259 bp (not digested) UGT2B7 C801T ACAATGCGGAAAGCTGACG 1 min at 57°C FokI C allele 126 bp (not digested) (H268Y)(rs7439366) CTTAGGCAGGGGTTTGGCA T allele 84 bp and 24 bp CYP2C8 G416A TTTTTATTAGGAATCATTTC 1 min at 48°C BseRI G allele 110 bp, 40 bp and 20 bp (R139K)(rs11572080) AGTCACCCACCCTTGGTTTT A allele150 bp and 20 bp CYP2C8 C792G AAAAATGTTGCTCTTACACG 1 min at 55°C TaqI C allele 90 bp and 35 bp (I264M)(rs1058930) ATTTTACCTGCTCCATTTTG G allele 125 bp (not digested) CYP2C8 A1196G ACTACTTCTCCTCACTTCTG 1 min at 57°C SSCP assay 277 bp product (K399R)(rs10509681) TGCCATGTAAATTCCAACTA ABCC2 G-1023A TTAGCTAGGATACTGCATGGG 1 min at 62°C StyI G allele 306 bp and 204 bp (rs17216114) GTGGCATCAGTCGCTAGAAA A allele 510 bp (not digested) ABCC2 C-24T TGTCCATCCACTGTTTCAATG 1 min at 58°C TaqI C allele 174 bp and 19 bp (rs717620) CTGGACTGCGTCTGGATC T allele 193 bp (not digested) ABCC2 G1249A TCACTTCCTGAGCTTCCTCTTC 1 min at 62°C HpyCH4III G allele 165 bp, 118 bp, 12 bp (V417I)(rs2273697) TGGGATTACAAGCACCATCA A allele 165 bp, 130 bp ABCC2 T3563A CCCCAGTCTTCTCATTGGTC 1 min at 62°C HphI T allele 216 bp, 120 bp, 23 bp, (V1188E)(rs8187694) CACCTGTTGGAGGTGATCCA A allele 216 bp, 141 bp, 23 bp ABCC2 G4544A TCCTGGTTATTCTTATAAATGCCTA 1 min at 60°C RsaI G allele 307 bp, 71 bp, 22 bp (C1515Y)(rs8187710) ACAATCGAGGGGTTTCTCAA A allele 196 bp, 111 bp, 71 bp, 22 bp A mismatch in the primer sequence is indicated by an underlined nucleotide.
X
ABCC2 p.Cys1515Tyr 17241877:33:1787
status: NEW
Login to comment

PMID: 17083032 [PubMed] Izzedine H et al: "Association between ABCC2 gene haplotypes and tenofovir-induced proximal tubulopathy."
No. Sentence Comment
73 The 3563 TrA SNP (Val1188Glu; rs8187694) in exon 25 and the 4544 GrA SNP (Cys1515Tyr; rs8187710) in exon 32 of ABCC2 were genotyped by restriction fragment-length Table 2.
X
ABCC2 p.Cys1515Tyr 17083032:73:74
status: NEW
Login to comment

77 (%) P Group 1 (n p 13) Group 2 (n p 17) ABCC2 Exon 1, -24 CrT (rs717620) … Genotype .29 CC 9 (69) 11 (64) CT 3 (23) 5 (29) TT 1 (8) 1 (6) Allele C 21 (80.8) 27 (79.4) T 5 (19.2) 7 (20.6) Exon 9, 1058 GrA (rs7080681) Arg353His Genotype .43 GG 12 (92) 17 (100) GA 1 (8) 0 AA 0 0 Allele G 25 (96.2) 34 (100) A 1 (3.8) 0 Exon 10, 1249 GrA (rs2273697) Val417Ile Genotype .02 GG 3 (23) 11 (64) GA 9 (69) 6 (35) AA 1 (8) 0 Allele G 15 (57.7) 28 (82.4) A 11 (42.3) 6 (17.6) Exon 25, 3563 TrA (rs8187694) Val1188Glu Genotype .01 TT 13 (100) 10 (59) TA 0 6 (35) AA 0 1 (6) Allele T 26 (100) 26 (76.5) A 0 8 (23.5) Exon 28, 3972 CrT (rs3740066) Ile1324Ile Genotype .96 CC 6 (46) 8 (47) CT 4 (31) 7 (41) TT 3 (23) 2 (12) Allele C 16 (61.5) 23 (67.7) T 10 (38.5) 11 (32.3) Exon 32, 4544 GrA (rs8187710) Cys1515Tyr Genotype .01 GG 13 (100) 10 (59) GA 0 6 (35) AA 0 1 (6) Allele G 26 (100) 26 (76.5) A 0 8 (23.5) ABCC4 Exon 5, 559GrT (rs11568658) Gly187Trp Genotype .07 GG 10 (77) 17 (100) GT 3 (23) 0 TT 0 0 Allele G 23 (88.5) 34 (100) T 3 (11.5) 0 (continued) 1485 Table 2.
X
ABCC2 p.Cys1515Tyr 17083032:77:797
status: NEW
Login to comment

166 In a study by Wojnowski et al. [39], the 2 missense polymorphisms 3563 TrA (Val1188Glu) and 4544 GrA (Cys1515Tyr) in ABCC2 were associated with anthracycline- induced cardiotoxicity; these SNPs were found at a similar allelic frequency in our study patients (23.5% vs. 15% [39]) but were observed only in group 2 and not in group 1.
X
ABCC2 p.Cys1515Tyr 17083032:166:102
status: NEW
Login to comment

PMID: 17112803 [PubMed] Rau T et al: "High-dose methotrexate in pediatric acute lymphoblastic leukemia: impact of ABCC2 polymorphisms on plasma concentrations."
No. Sentence Comment
106 DNA sequence Amino acid change Genotype Frequency of W allele W/W W/R R/R Exon 1 C-24T rs717620 GAAGAGTCTT C/T GTTCCAGACG - 38 20 1 0.81 (0.73-0.87) Exon 10 G1249A rs2273697 GGAGTACACC G/A TTGGAGAAAC Val417Ile 37 22 0 0.81 (0.73-0.87) Exon 21 T2780G - CTGAAGTCCC T/G GAGAAACTCC Leu927Arg 58 1 0 0.992 (0.95-0.998) Intron 21 C2883ϩ11T - GTGAACACCA C/T ACAGAAAAGT - 58 1 0 0.992 (0.95-0.998) Exon 24 C3298T - TCAGTCCTTG C/T GCAGCTGGATT Arg1100Cys 58 1 0 0.992 (0.95-0.998) Exon 24 G3299A - TCAGTCCTTGC G/A CAGCTGGATT Arg1100His 58 1 0 0.992 (0.95-0.998) Intron 27 A3844-73G - GTTCTATGAC A/G CGAGTCCTGG - 53 6 0 0.949 (0.89-0.98) Exon 28 C3972T rs3740066 CTTGTGACAT C/T GGTAGCATGG Ile1324Ile 22 32 5 0.64 (0.55-0.72) Intron 29 G4146ϩ11C rs8187703 GTGAGCTCTA G/C AACTTACTCG - 53 6 0 0.949 (0.89-0.98) Exon 30 G4290T rs7904678 CCCACGAAGT G/T ACAGAGGCTG Val1430Val 53 6 0 0.949 (0.89-0.98) Exon 31 C4488T rs8187707 ACAGGCTGCA C/T ACCATCATGG His1496His 53 6 0 0.949 (0.89-0.98) Intron 31 G4508ϩ12A rs8187708 TGAGTGTAGG G/A GGACAGGGCT - 53 6 0 0.949 (0.89-0.98) Exon 32 G4544A rs8187710 ATTATAGAGT G/A CGGCAGCCCT Cys1515Tyr 53 6 0 0.949 (0.89-0.98) DNA, Deoxyribonucleic acid.
X
ABCC2 p.Cys1515Tyr 17112803:106:1123
status: NEW
Login to comment

134 In both the reference and patient population the polymorphisms A3844-73G, G4146ϩ11C, G4290T (Val1430Val), C4488T (His1469His), G4508ϩ12A, and G4544A (Cys1515Tyr) were in complete linkage disequilibrium.
X
ABCC2 p.Cys1515Tyr 17112803:134:162
status: NEW
Login to comment

PMID: 11901087 [PubMed] Itoda M et al: "Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28."
No. Sentence Comment
29 It was strongly suggested that functional changes by the V417I, S789F, D883N, Q1019H, N1244K, S1367C, and C1515Y alterations seemed to be worth assessing because the TM1 to TM5 domains (200 N-terminal amino This study was supported in part by the Program for Promotion of Fundamental Studies in Health Sciences (MPJ-6) of the Organization for Pharmaceutical Safety and Research of Japan.
X
ABCC2 p.Cys1515Tyr 11901087:29:106
status: NEW
Login to comment

57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region.
X
ABCC2 p.Cys1515Tyr 11901087:57:925
status: NEW
Login to comment

PMID: 21606946 [PubMed] Ansari M et al: "Polymorphism in multidrug resistance-associated protein gene 3 is associated with outcomes in childhood acute lymphoblastic leukemia."
No. Sentence Comment
52 A false discovery rate correction was performed to adjust for multiple comparisons using Q-value Table 1 Identity of polymorphisms, details of PCR and ASO hybridization Polymorphisms PCR ASO Gene dbSNP Position Variation Primers Probes MRP2 rs1885301 À1519 A/G F: 50 -TCATATACCTGTTGGCCATT-30 50 -TATAGTATGTTGTGGATA-30 R: 50 -GTATGGACCTTGTTACTGAT-30 50 -TATAGTATATTGTGGATA-30 rs7910642 À993 G/A F: 50 -TTAGCTAGGATACCGCATGG-30 50 -AGGCCAAGGCAGAAGGA-30 R: 50 -ATGTTTTCTGTAGGGACGGG-30 50 -AGGCCAAGACAGAAGGA-30 rs2804402 À989 C/T F: 50 -ATGTTTTCTGTAGGGACGGG-30 50 -AACAATCCTTCTGCCTTG-30 R: 50 -TTAGCTAGGATACCGCATGG-30 50 -AACAATCCTCCTGCCTTG-30 rs717620 À24 G/A F: 50 -CCACTTGTTCTGAGTCTGAG-30 50 -TCTGGAACGAAGACTC-30 R: 50 -GGTCATCCTTTACGGAGAAC-30 50 -TCTGGAACAAAGACTC-30 rs2273697 1249 G/A (Val417Ile) F: 50 -GTGTCCATATGGAGCACATC-30 50 -AGTACACCGTTGGAGA-30 R: 50 -TACAAGCACCATCACCCCAA-30 50 -AGTACACCATTGGAGA-30 rs17222723 3563 T/A (Val1188Glu) F: 50 -ATGGTGGATGCCTCATGACT-30 50 -CAATGAGGTGAGGATTG-30 R: 50 -GTGTGTGGCCAGAGTGAATT-30 50 -CAATGAGGAGAGGATTG-30 rs8187710 4544 A/G (Cys1515Tyr) F: 50 -TCAGGGTAATGGTCCTAGAC-30 50 -TATAGAGTGCGGCAGCC-30 R: 50 -TCCTTTTCTAACCCATGGGG-30 50 -TATAGAGTACGGCAGCC-30 MRP3 rs1989983 À1696 A/G F: 50 -CATGACCAGGGTCATGGAAG-30 50 -TCCCAGAGGCATCAAGG-30 R: 50 -GCTAATCTGAGAGGTCCCCA-30 50 -TCCCAGAGACATCAAGG-30 rs9895420 À189 A/T F: 50 -GTGGGAGCGCCTGTGTATCC-30 50 -TCCCCCTGGCTTGGCCCA-30 R: 50 -AGTGCCTCTGGGTCCGGTCT-30 50 -TCCCCCTGGCATGGCCCA-30 rs4793665 À140 C/T F: 50 -GTGGGAGCGCCTGTGTATCC-30 50 -AAGGGCCCCCCCACCTCT-30 R: 50 -AGTGCCTCTGGGTCCGGTCT-30 50 -AAGGGCCCCCCTACCTCT-30 rs11568591 3890 G/A (Arg1297His) F: 50 -ATCTGCCCCTCCTGCCAGGC-30 50 -TATTCTGTGCGCTACCG-30 R: 50 -CGCCTACCCCACGCGTACCT-30 50 -TATTCTGTGCACTACCG-30 MRP5 rs7627754 À1629 A/T F: 50 -GAACTTGGGAGTAGGAAAGA-30 50 -GAATAATAAATATTCAAA-30 R: 50 -GGCTGCTCAAGTTTCCTATT-30 50 -GAATAATAATTATTCAAA-30 rs1520195 À1155 T/C F: 50 -TGGATGCACCAGTCTGTTTG-30 50 -ACTAGCTAGCTGTTATAA-30 R: 50 -CTCACCCCGCCGTATTTTTT-30 50 -ACTAGCTAGTTGTTATAA-30 rs562 5638 C/T F: 50 -CACTCCCTTCCCAGAGAATT-30 50 -CCATTCAATTGATGACAG-30 R: 50 -AAGAGACCTACCTCAGGTTG-30 50 -CCATTCAACTGATGACAG-30 Abbreviations: ASO, allele-specific oligonucleotide; F, forward; MRP, multidrug resistance-related protein; R, reverse; SNP, single-nucleotide polymorphism.
X
ABCC2 p.Cys1515Tyr 21606946:52:1092
status: NEW
Login to comment

131 Several polymorphisms have been widely studied in MRP2 gene including 50 UTR C-24 T substitution and non-synonymous G1249A, T3563A and G4544A variations leading to Val417Ile, Val1188Glu and Cys1515Tyr amino-acid replacements, respectively.
X
ABCC2 p.Cys1515Tyr 21606946:131:190
status: NEW
Login to comment

135 MRP2 Val417Ile was associated with an increased intestinal efflux and a significant decreased bioavailability of the b-blocker talinolol,44,49 in line with the observation of a higher gastrointestinal toxicity of MTX in African Americans treated for rheumatoid arthritis.50 Val1188Glu and Cys1515Tyr correlated with higher mRNA and protein expression in liver51 and with anthracycline-induced cardiotoxicity in non-Hodgkin lymphoma patients.52 We did not find significant association of these polymorphisms with endpoints studied in our ALL patients.
X
ABCC2 p.Cys1515Tyr 21606946:135:289
status: NEW
Login to comment

PMID: 20799350 [PubMed] Kelly L et al: "Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains."
No. Sentence Comment
72 Predictions of the Functional Effects of 40 nsSNPs in ABC Transporters Comon name HUGO name Mutation NBD Prediction BSEP ABCB11 E592Q NBD1 Neutral BSEP ABCB11 N591S NBD1 Neutral BSEP ABCB11 Q558H NBD1 Neutral BSEP ABCB11 V444A NBD1 Neutral BSEP ABCB11 E1186K NBD2 Disease MDR1 ABCB1 P1051A NBD2 Neutral MDR1 ABCB1 S1141T NBD2 Neutral MDR1 ABCB1 T1256K NBD2 Disease MDR1 ABCB1 V1251I NBD2 Neutral MDR1 ABCB1 W1108R NBD2 Disease MRP2 ABCC2 I670T NBD1 Disease MRP2 ABCC2 L849R NBD1 Disease MRP2 ABCC2 C1515Y NBD2 Disease MRP3 ABCC3 D770N NBD1 Neutral MRP3 ABCC3 K718M NBD1 Neutral MRP3 ABCC3 T809M NBD1 Disease MRP3 ABCC3 V765L NBD1 Disease MRP3 ABCC3 Q1365R NBD2 Disease MRP3 ABCC3 R1297H NBD2 Disease MRP3 ABCC3 R1348C NBD2 Disease MRP3 ABCC3 R1381S NBD2 Disease MRP4 ABCC4 G487E NBD1 Disease MRP4 ABCC4 K498E NBD1 Neutral MRP4 ABCC4 R1220Q NBD2 Neutral MRP4 ABCC4 T1142M NBD2 Neutral MRP4 ABCC4 V1071I NBD2 Neutral MRP6 ABCC6 I1330L NBD1 Neutral MRP6 ABCC6 I742V NBD1 Neutral MRP6 ABCC6 P664S NBD1 Neutral MRP6 ABCC6 R724K NBD1 Neutral MRP6 ABCC6 R769K NBD1 Neutral MRP6 ABCC6 A1291T NBD2 Neutral MRP6 ABCC6 E1369K NBD2 Neutral MRP6 ABCC6 G1327E NBD2 Disease MRP6 ABCC6 L1416R NBD2 Disease MRP6 ABCC6 R1268Q NBD2 Disease MRP6 ABCC6 R1461H NBD2 Disease MXR ABCG2 I206L NBD1 Neutral MXR ABCG2 P269S NBD1 Disease MXR ABCG2 Q141K NBD1 Neutral nsSNPs.
X
ABCC2 p.Cys1515Tyr 20799350:72:498
status: NEW
Login to comment

PMID: 16504381 [PubMed] Kerb R et al: "Implications of genetic polymorphisms in drug transporters for pharmacotherapy."
No. Sentence Comment
209 Nonsynonymous SNPs that occur with a frequency of clearly more than 1% have only reported for ABCC2: Val471Ile (1249GOA; 14% in African American,13% in Asian,and 24% in Caucasian), Phe981Leu (2943COG; 4% in Caucasian), and Cys1515Tyr (4544GOA; 2% in Caucasian), as well as for ABCC3, His68Tyr (202COT; 2% in Caucasian) and Arg1297His (3890GOA, 5% in Caucasian).
X
ABCC2 p.Cys1515Tyr 16504381:209:223
status: NEW
Login to comment

PMID: 21929509 [PubMed] Semsei AF et al: "ABCC1 polymorphisms in anthracycline-induced cardiotoxicity in childhood acute lymphoblastic leukaemia."
No. Sentence Comment
121 This study found an association between chronic anthracycline-induced cardiotoxicity and a polymorphism in the NAD(P)H oxidase subunit NFC4 (rs1883112), and between: acute anthracycline-induced cardiotoxicity and the NAD(P)H oxidase subunits CYBA (rs4673) and RAC2 (rs1305 8338); and the ABC transporter ABCC1 Gly671Val variant (which is rs45511401) and the Val1188Glu-Cys1515Tyr (rs8187694- rs8187710) haplotype of the ABCC2 gene.
X
ABCC2 p.Cys1515Tyr 21929509:121:369
status: NEW
Login to comment

PMID: 23396606 [PubMed] Vulsteke C et al: "Genetic variability in the multidrug resistance associated protein-1 (ABCC1/MRP1) predicts hematological toxicity in breast cancer patients receiving (neo-)adjuvant chemotherapy with 5-fluorouracil, epirubicin and cyclophosphamide (FEC)."
No. Sentence Comment
70 ABCC2/MRP2 Multidrug resistance-associated protein 2 Drug transporter implicated in energy-dependent transport of cytotoxic agents out of the cell rs8187710 c.4544G>A Cys1515Tyr A-allele carriers predispose to acute anthracycline-induced cardiotoxicity (Wojnowski et al. [17]).
X
ABCC2 p.Cys1515Tyr 23396606:70:167
status: NEW
Login to comment

PMID: 24732756 [PubMed] Ulzurrun E et al: "Selected ABCB1, ABCB4 and ABCC2 polymorphisms do not enhance the risk of drug-induced hepatotoxicity in a Spanish cohort."
No. Sentence Comment
63 Samples and controls were genotyped for the ABCB1 c.1236T.C (p.Gly412Gly, rs1128503), c.3435T.C (p.Ile1145Ile, rs1045642), ABCB4 c.1954A.G (p.Arg652Gly, rs2230028) and ABCC2 c.-1549A.G (rs1885301), c.-24C.T (rs717620), c.1249G.A (p.Val417Ile, rs2273697), c.3972C.T (p.Ile1324Ile, rs3740066) and c.4544G.A (p.Cys1515Tyr, rs8187710) using a validated 59-nuclease PCR based assay with allele specific fluorescent probes (TaqMan SNP Genotyping Assays, Applied Biosystems, Foster City, CA, USA) as previously described [23].
X
ABCC2 p.Cys1515Tyr 24732756:63:308
status: NEW
Login to comment