ABCMdb

ABCA1 p.Glu1172Asp

None has been submitted yet.

Publications

PMID: 20800056 [PubMed] Berge KE et al: "Mutations in APOA-I and ABCA1 in Norwegians with low levels of HDL cholesterol."

No. Sentence Comment

59 of patients (het/hom)a Mutation Nucleotide Exon/Intron (i) PolyPhen prediction (score) SNP rs ID, ref.# ABCA1 Missense 8/3 R219K c.656, GNA 7 Benign (0.489) rs2230806 0/1 R282Q c.845, GNA 9 Benign (0.592) Novel 1/0 V399A c.1196, TNC 11 Benign (0.040) rs9282543 1/0 M636V c.1906, ANG 15 Benign (0.418) Novel 3/0 V771M c.2311, GNA 16 Benign (0.931) rs2066718 2/0 V825I c.2473, GNA 17 Benign (0.440) rs2066715 3/1 I883M c.2649, ANG 18 Benign (0.147) rs2066714 1/0 C887F c.2660, GNT 19 Benign (0.888) Novel 3/0 E1172D c.3516, GNC 24 Benign (0.546) rs33918808 1/0 G1216V c.3647, GNT 25 Prob damb (2.154) Ref. [18] 1/0 L1244Q c.3731, TNA 25 Prob dam (2.269) Novel 1/0 C1477F c.4430, TNA 31 Prob dam (3.688) Ref. [17] 14/1 R1587K c.4760, ANT 35 Benign (0.284) rs2230808 1/0 V1674I c.5020, GNA 37 Benign (0.821) Novel 1/0 R1680Q c.5039, GNA 37 Poss damc (1.926) Ref. [17] 1/0 N1800H c.5398, ANC 40 Poss dam (1.845) Ref. [19] Nonsense/splice 1/0 IVS4+1, GNA c.302+1, GNA i4 - 1/0 C1429X c.4287, CNA 31 - 1/0 IVS32+1, GNA c.4559+1, GNA i32 - APOA-I 7/0 R160L c.551, GNT 4 Prob dam (2.491) Ref. [21] 1/0 del182K del c.616-618 AAG 4 - Novel a Het: heterozygote, hom: homozygote. Login to comment
78 Variants R219K, V399A, V771M, V825I, I883M, E1172D, and R1587K have been reported as single nucleotide polymorphisms (SNPs) (Table 1). Login to comment
80 In addition, R219K, V771M, V825I, I883M, E1172D, and R1587K have been found in similar frequencies in patients with low or high HDL cholesterol levels [18], indicating that these variants do not cause low HDL cholesterol levels. Login to comment

PMID: 20880529 [PubMed] Candini C et al: "Identification and characterization of novel loss of function mutations in ATP-binding cassette transporter A1 in patients with low plasma high-density lipoprotein cholesterol."

No. Sentence Comment

76 Patients (gender, age) Amino acida (nucleotidea ) change TC TG LDL-c HDL-c Clinical manifestations of TD CVD Other relevant clinical data Homozygotes Patient 1 (female, 42) p.L1056P (c.3167T > C) 2.4 0.9 1.99 <0.10 Absent CAD Thrombocytopenia Patient 2 (male, 40) p.Wl747X (c.5240G > A) 1.76 1.93 0.52 0.1-0.3 Neuropathy, splenomegaly, thrombocytopenia Mild stenosis (20-30%) of coronary arteries None Patient 3 (male, 55) p.F593L (c.1779C > G) 4.4 1.4 3.6 <0.10 Absent CAD None p.E1253K (c.3757G > A) Compound heterozygotes Patient 4 (female, 63) p.Q1038X (c.3112C > T) 6.68 2.72 5.4 <0.10 Absent None None p.N1800H (c.5398A > C) [32] Patient 5 (female, 28) p.T1512M (c.4535C > T) 4.42 1.83 3.46 0.1 Absent None None p.N1800H (c.5398A > C) [32] p.C978fsX988 (c.2934delT) Patient 6 (female, 17) p.D575G (c.1724A > G) 4.96 2.84 4.35 <0.10 Absent None DM1 p.C1941R(c.5821T > C) Heterozygotes Patient 7 (male, 42) p.S100C (c.299C > G) 8.5 8.7 4.3 0.3 N.A. None None Patient 8 (male, 58) p.E1172D (c.3516G > C) [33] 6.4 2.7 4.1 0.9 N.A. None None Patient 9 (male, 35) p.S1181F (c.3542C > T) [17] 2.9 0.31 1.88 0.88 N.A. None None Patient 10 (male, 48) p.C1477R (c.4429T > C) [13] 2.01 1.4 0.92 0.46 N.A. CAD None Patient 11 (male, 68) p.V1858A (c.5573T > C) 4.9 3.78 2.41 0.75 N.A. CAD None Patient 12 (female, 36) p.N1800H (c.5398A > C) [32] 4.6 1.2 4 <0.10 N.A. None DM2, obesity Patient 13 (male, 67) p.R282X (c.844C > T) [34] 3.2 1.21 2.14 0.51 N.A. None DM2 Patient 14 (female, 42) p.W424X (c.1272G > A) 2.07 1.04 1.39 0.21 N.A. None None Patient 15 (female, 52) N.A. - (IVS11 - 1G > A) 5.51 3.51 3.28 0.56 N.A. None Hypothyroidism, hypertension Patient 16 (female, 54) N.A. - (IVS48 + 2T > C) 3.29 1.92 1.94 0.49 N.A. None DM2, hypertension a Nomenclature based on guidelines of Human Genome Variation Society. Login to comment
89 In ABCA1, we identified 14 novel and 5 known genetic variations in 16 subjects including one frameshift (p.C978fsX988), 2 splice-site (IVS11-1G > C and IVS48 + 2T > C), 4 nonsense (p.R282X, p.W424X, p.Q1038X, p.Wl747X) and 12 missense variations (p.S100C, p.D575G, p.F593L, p.L1056P, p.E1172D, p.S1181F, p.E1253K, p.C1477R, p.T1512M, p.N1800H, p.V1858A, p.C1941R). Login to comment

PMID: 19596329 [PubMed] Frikke-Schmidt R et al: "Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population."

No. Sentence Comment

2387 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K. Login to comment
2395 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87]. Login to comment
2410 Frikke-Schmidt et al. showed for the first time in a large general population sample that three out of six non-synonymous SNPs (V771M, I883M, and E1172D) were independent predictors of IHD risk - risk increases that were not reflected in levels of HDL cholesterol [85]. Login to comment
2411 By stepwise regression, V771M and I883M were shown to be the best predictors in women, whereas I883M and E1172D were most informative in men. Login to comment
2413 Additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs with up to three-fold increases in risk for specific subsets of the genotypes (Fig. 4, lower panels) [85]. Login to comment
2441 For V771M, I883M, and E1172D as single sites, heterozygotes and homozygotes for the variant allele were pooled (heterozygotes and homozygotes in red, wildtype in green). Login to comment
2444 Cumulative incidence plots are shown for cells with significant hazard ratios except for the I883M/E1172D AGCC genotype in men, because only 2 incident events occurred in this group. Login to comment
2386 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K. Login to comment
2394 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87]. Login to comment
2409 Frikke-Schmidt et al. showed for the first time in a large general population sample that three out of six non-synonymous SNPs (V771M, I883M, and E1172D) were independent predictors of IHD risk - risk increases that were not reflected in levels of HDL cholesterol [85]. Login to comment
2412 Additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs with up to three-fold increases in risk for specific subsets of the genotypes (Fig. 4, lower panels) [85]. Login to comment
2440 For V771M, I883M, and E1172D as single sites, heterozygotes and homozygotes for the variant allele were pooled (heterozygotes and homozygotes in red, wildtype in green). Login to comment
2443 Cumulative incidence plots are shown for cells with significant hazard ratios except for the I883M/E1172D AGCC genotype in men, because only 2 incident events occurred in this group. Login to comment

PMID: 18706283 [PubMed] Iatan I et al: "Effect of ABCA1 mutations on risk for myocardial infarction."

No. Sentence Comment

74 To date, the largest study examining ABCA1 single nucleotide polymorphisms (SNPs) and HDL-C is the Copenhagen City Heart Study [24], in which the relationship between six ABCA1 nonsynonymous common SNPs (R219K, V771M, M825I, I883M, E1172D, and R1587K) and HDL-C was analyzed. Login to comment
112 Additional insights into the effects of ABCA1 on MI have recently been described by Frikke-Schmidt et al. [35•] in a study where six nonsynonymous ABCA1 SNPs, R219K, V771M, V825I, I883M, E1172D, and R1587K (identified by resequencing ABCA1 in 190 individuals of Danish ancestry [24]), were genotyped in 9259 individuals from the Copenhagen City Heart Study to assess their risk of CHD (Table 2). Login to comment
113 The principal finding of the study indicated that common genetic variation in ABCA1 predicts risk of CHD in the general population, but that their association was independent of plasma HDL-C levels: SNPs predicting increased MI risk were associated with either increases (V771 and V825I) or decreases (R1587K) in HDL-C, or no effect on HDL-C (R219K, I883M, E1172D). Login to comment
115 In addition, to determine which ABCA1 SNPs were independent predictors of CHD and not caused by linkage disequilibrium among SNPs, a stepwise Cox regression approach was performed identifying V771M, I883M, and E1172D as the most important for the final IHD prediction model. Login to comment
116 Additive effects on CHD risk were also observed for the V771M/I883M and I883M/E1172D pairs. Login to comment
117 In fact, the I883M and E1172D SNPs were previously determined by Brousseau et al. [30] in a study of 2028 white men to have increased frequencies in cases compared with controls, in addition to detecting increased risk of future CHD events associated with the 1172D allele (Table 2). Login to comment
121 TD patients ( n = 5) 0.08 ± 0.05 ABCA1 heterozygous patients ( n = 77) 0.74 ± 0.24 Unaffected individuals ( n = 156) 1.31 ± 0.35 Brousseau et al. [30] / 2001 VA-HIT study, men with established CHD ( n = 1014) 0.83 ± 0.13 R219K, I883M, E1172D † Frequencies of the 3 ABCA1 variants were signifi cantly increased in VA-HIT. Login to comment
123 In VA-HIT, E1172D was associated with an increased risk of CHD. Login to comment
152 Cases: 1.70 (1.5-2.0) Ctl: 1.30 (1.1-1.6) Pasdar et al. [49] / 2007 White ischemic stroke patients ( n = 400) Cases: 1.20 ± 0.40 L158L, R219K, G316G, R1587K The ABCA1 gene was not found to be associated with ischemic stroke, but R219K had the greatest impact on lipid profi le, especially on LDL and TG White controls ( n = 487) Ctl: 1.40 ± 0.40 Nebel et al. [50] / 2007 German patients with CHD ( n = 1090) and controls ( n = 728) NA R219K, V771M, I883M † , E1172D, R1587K Only the I883M polymorphism was signifi cantly associated with CHD *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2. Login to comment
155 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Frikke-Schmidt et al. [35••] / 2008 Copenhagen City Heart Study: Women: R219K, V771M † , V825I † , I883M † , E1172D † , R1587K † Common genetic variation at the ABCA1 locus predicts IHD risk independently of plasma HDL-C levels. Login to comment
156 The V771M, I883M, and E1172D polymorphisms signifi cantly predicted IHD risk, but their association was not related to HDL-C. Login to comment
161 Taken together, the findings of this study show that three of the six nonsynonymous SNPs (V771M, I883M, and E1172D) in ABCA1 predict risk of IHD in the general population, and that ABCA1 may have proatherosclerosis effects independent of HDL-C levels [35•]. Login to comment

PMID: 18468402 [PubMed] Ergen A et al: "Investigation of ABCA1 C69T and G-191C polymorphisms in coronary artery disease."

No. Sentence Comment

75 In another study of six common polymorphisms of ABCA1, very high HDL-C was found to be associated with a higher genotype frequency for R219K and higher genotype and allelic frequency for E1172D compared with lower HDL-C (21). Login to comment

PMID: 18199144 [PubMed] Slatter TL et al: "Novel rare mutations and promoter haplotypes in ABCA1 contribute to low-HDL-C levels."

No. Sentence Comment

41 Genotyping of ABCA1 SNPs by RFLP Fourteen SNPs including five promoter SNPs (C-564T, G-407C, G-278C, G-99C, and C-14T), one 5#-UTR SNP [-76(-75) insG], six non-synonymous coding SNPs (R219K, V771M, V825I, I883M, E1172D, and R1587K) and two 3#-UTR SNPs [A-960G -383(-381)delGTT] were genotyped in the low-, mid-, and high-HDL-C groups by restriction fragment length polymorphism (RFLP) analysis. Login to comment
55 Six of the non-synonymous variants were previously reported SNPs (R219K, V771M, V825I, I883M, E1172D and R1587K). Login to comment
105 a Coding haplotypes were derived from the following six non-synonymous SNPs (left to right): R219K (G.A), V771M (G.A), V825I (G.A), I883M (A.G), E1172D (G.C), and R1587K (G.A). Login to comment

PMID: 17951323 [PubMed] Frikke-Schmidt R et al: "Genetic variation in ABCA1 predicts ischemic heart disease in the general population."

No. Sentence Comment

7 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Login to comment
8 Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Login to comment
10 A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. Login to comment
16 In the present study we included 9259 individuals from the 1991 to 1994 examination, whom we genotyped for all nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals of Danish ancestry.8 Information on diagnosis of IHD (nϭ1170; World Health Organization; International Classification of Diseases, 8th edition: codes 410 to 414; 10th edition: codes I20-I25) was collected and verified until 31st December 2000 by reviewing all hospital admissions and diagnoses entered in the national Danish Patient Registry, all causes of death entered in the national Danish Causes of Death Registry, and medical records from hospitals and general practitioners. Login to comment
29 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nϭ9028 out of nϭ9259; Table 1). Login to comment
38 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH). Login to comment
55 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium. Login to comment
57 A strong positive DЈ was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (DЈϾ0.9), whereas a strong negative DЈ was present for R219K/V825I, V771M/V825I, and V771M/I883M (DЈϽ-0.9). Login to comment
60 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAϩAA versus GG, borderline Pϭ0.06), V825I (GAϩAA versus GG; Pϭ0.02), I883M (AGϩGG versus AA, Pϭ0.01), E1172D (GCϩCC versus GG, Pϭ0.03), and for R1587K (AA versus GG, borderline Pϭ0.06), but not for R219K (Figure 2). Login to comment
61 The age adjusted hazard ratios (HRs) for IHD were: V771M (GAϩAA versus GG) 1.2 (95% confidence interval [CI] 1.0 to 1.5), V825I (GAϩAA versus GG) 1.2 (1.0 to 1.5), I883M (AGϩGG versus AA) 1.2 (1.0 to 1.4), E1172D (GCϩCC versus GG) 1.3 (1.0 to 1.6) and R1587K (AA versus GG) 1.2 (1.0 to 1.6), respectively (Table 2). Login to comment
68 Probability values are for overall log-rank tests. For V771M, V825I, I883M, and E1172D, heterozygotes and homozygotes for the variant allele were pooled (combined genotype in red, common genotype in green). Login to comment
71 There was evidence for a statistically significant interaction between gender and V771M (Pϭ0.04) in the prediction of IHD, whereas the remaining 5 SNPs did not interact with gender (all probability values Ͼ0.52). Login to comment
74 The age-adjusted odds ratios (ORs) were: V771M (GAϩAA versus GG) 1.2 (0.9 to 1.5), V825I (GAϩAA versus GG) 1.2 (0.9 to 1.4), I883M (AGϩGG versus AA) 1.2 (1.0 to 1.4), E1172D (GCϩCC versus GG) 1.1 (0.8 to 1.4), and R1587K (GA versus GG) 1.2 (1.0 to 1.4). Login to comment
77 The final prediction model included the 3 noncorrelated SNPs, V771M, I883M, and E1172D (HRs: V771M, 1.2 [1.0 to 1.6]; I883M, 1.2 [1.0 to 1.4]; E1172D, 1.2 [1.0 to 1.6]). Login to comment
78 Performing gender specific stepwise regression, V771M and I883M were the best predictors in women (HRs: V771M, 1.6 [1.2 to 2.3]; I883M, 1.3 [1.1 to 1.6]), whereas I883M and E1172D were best in men (HRs: I883M, 1.1 (1.0 to 1.4); E1172D, 1.3 (1.0 to 1.7). Login to comment
82 R1587K was associated with a decrease in HDL-C of 0.03 mmol/L (PϽ0.005), whereas R219K, I883M, and E1172D were not associated with changes in HDL-C levels (Figure 3, upper panel). Login to comment
85 Risk of Ischemic Heart Disease as a Function of ABCA1 Genotype in the Prospective Study n, % Number of Events Incidence Rate (95% CI) per 10 000 Person-Years Hazard Ratio (95% CI) Observed Expected Age Adjusted HDL-C Adjusted Multifactorially Adjusted R219K GG 4863 (54) 603 603 64 (59-70) 1 1 1 GA 3461 (39) 429 426 64 (58-71) 1.0 (0.9-1.1) 1.0 (0.9-1.1) 1.0 (0.9-1.2) AA 641 (7) 75 79 64 (50-80) 1.0 (0.8-1.2) 1.0 (0.8-1.2) 1.0 (0.8-1.3) V771M GG 8379 (93) 1023 1040 64 (60-68) 1 1 1 GAϩAA 586 (7) 84 69 75 (60-93)* 1.2 (1.0-1.5) 1.3 (1.0-1.6) 1.2 (1.0-1.5) M825I GG 7959 (89) 962 988 63 (59-67) 1 1 1 GAϩAA 1006 (11) 145 122 76 (64-89)† 1.2 (1.0-1.5) 1.2 (1.0-1.5) 1.2 (1.0-1.4) I883M AA 6934 (77) 827 864 62 (58-66) 1 1 1 AGϩGG 2031 (23) 280 245 72 (64-81)† 1.2 (1.0-1.4) 1.2 (1.1-1.4) 1.2 (1.1-1.4) E1172D GG 8469 (94) 1026 1045 63 (59-67) 1 1 1 GCϩCC 496 (6) 81 64 86 (68-106)† 1.3 (1.0-1.6) 1.3 (1.0-1.6) 1.3 (1.0-1.6) R1587K GG 5216 (58) 626 645 62 (58-67) 1 1 1 GA 3213 (36) 399 396 65 (58-71) 1.0 (0.9-1.2) 1.0 (0.9-1.2) 1.0 (0.9-1.2) AA 536 (6) 82 68 82 (65-102)* 1.2 (1.0-1.6) 1.2 (1.0-1.5) 1.3 (1.0-1.6) Nonincident cases (nϭ63) were excluded, leaving 8965 individuals for the survival analyses and Cox regression. Login to comment
89 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808). Login to comment
97 Several studies have reported associations between V825I/ I883M and increased plasma HDL-C levels8,15,16 and associations between R1587K and a decreased HDL-C or apoAI.8,14,17 For in silico prediction of ABCA1 SNPs please see the Data Supplements Expanded Results. Login to comment
98 The rare allele of the R219K SNP has previously been reported to be associated with decreased14,17 or increased risk of coronary heart disease.18 The present largest prospective results as well as a recent case-control study did not find any association with atherosclerosis susceptibility.19 In support of I883M and E1172D as 2 of the 3 most important ABCA1 SNPs for IHD prediction, a previous study of 2028 White men found increased frequencies in cases compared with controls, and also detected increased risk of future IHD events associated with the 1172D allele.18 The pairwise LD structure of the SNPs is important for the interpretation of the association results. Login to comment
102 The fact that the stepwise regression approach identified the V771M, I883M, and E1172D SNPs, which have very weak association between rare alleles (low r2 or negative DЈ), as important for the final IHD prediction model, supports that the observed findings for these 3 SNPs are not caused by LD. Login to comment
103 However, the single site result on IHD risk for V825I is most likely attributable to LD with I883M, and the findings for R1587K are most likely attributable to LD with E1172D, the latter also supported by the haplotype analysis presented in the Data Supplements, Table III and Expanded Results. Login to comment
1 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Login to comment
2 Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Login to comment
4 A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. Login to comment
23 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nafd;9028 out of nafd;9259; Table 1). Login to comment
32 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH). Login to comment
49 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 at Semmelweis University (Egyetem) on December 3, 2015 http://atvb.ahajournals.org/ Downloaded from the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium. Login to comment
51 A strong positive Db18; was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (Db18;b0e;0.9), whereas a strong negative Db18; was present for R219K/V825I, V771M/V825I, and V771M/I883M (Db18;b0d;afa;0.9). Login to comment
54 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAaf9;AA versus GG, borderline Pafd;0.06), V825I (GAaf9;AA versus GG; Pafd;0.02), I883M (AGaf9;GG versus AA, Pafd;0.01), E1172D (GCaf9;CC versus GG, Pafd;0.03), and for R1587K (AA versus GG, borderline Pafd;0.06), but not for R219K (Figure 2). Login to comment
62 Probability values are for overall log-rank tests. For V771M, V825I, I883M, and E1172D, heterozygotes and homozygotes for the variant allele were pooled (combined genotype in red, common genotype in green). Login to comment
72 Performing gender specific stepwise regression, V771M and I883M were the best predictors in women (HRs: V771M, 1.6 [1.2 to 2.3]; I883M, 1.3 [1.1 to 1.6]), whereas I883M and E1172D were best in men (HRs: I883M, 1.1 (1.0 to 1.4); E1172D, 1.3 (1.0 to 1.7). Login to comment
76 R1587K was associated with a decrease in HDL-C of 0.03 mmol/L (Pb0d;0.005), whereas R219K, I883M, and E1172D were not associated with changes in HDL-C levels (Figure 3, upper panel). Login to comment
79 Risk of Ischemic Heart Disease as a Function of ABCA1 Genotype in the Prospective Study n, % Number of Events Incidence Rate (95% CI) per 10 000 Person-Years Hazard Ratio (95% CI) Observed Expected Age Adjusted HDL-C Adjusted Multifactorially Adjusted R219K GG 4863 (54) 603 603 64 (59-70) 1 1 1 GA 3461 (39) 429 426 64 (58-71) 1.0 (0.9-1.1) 1.0 (0.9-1.1) 1.0 (0.9-1.2) AA 641 (7) 75 79 64 (50-80) 1.0 (0.8-1.2) 1.0 (0.8-1.2) 1.0 (0.8-1.3) V771M GG 8379 (93) 1023 1040 64 (60-68) 1 1 1 GAaf9;AA 586 (7) 84 69 75 (60-93)* 1.2 (1.0-1.5) 1.3 (1.0-1.6) 1.2 (1.0-1.5) M825I GG 7959 (89) 962 988 63 (59-67) 1 1 1 GAaf9;AA 1006 (11) 145 122 76 (64-89)ߤ 1.2 (1.0-1.5) 1.2 (1.0-1.5) 1.2 (1.0-1.4) I883M AA 6934 (77) 827 864 62 (58-66) 1 1 1 AGaf9;GG 2031 (23) 280 245 72 (64-81)ߤ 1.2 (1.0-1.4) 1.2 (1.1-1.4) 1.2 (1.1-1.4) E1172D GG 8469 (94) 1026 1045 63 (59-67) 1 1 1 GCaf9;CC 496 (6) 81 64 86 (68-106)ߤ 1.3 (1.0-1.6) 1.3 (1.0-1.6) 1.3 (1.0-1.6) R1587K GG 5216 (58) 626 645 62 (58-67) 1 1 1 GA 3213 (36) 399 396 65 (58-71) 1.0 (0.9-1.2) 1.0 (0.9-1.2) 1.0 (0.9-1.2) AA 536 (6) 82 68 82 (65-102)* 1.2 (1.0-1.6) 1.2 (1.0-1.5) 1.3 (1.0-1.6) Nonincident cases (nafd;63) were excluded, leaving 8965 individuals for the survival analyses and Cox regression. Login to comment
83 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808). Login to comment
92 The rare allele of the R219K SNP has previously been reported to be associated with decreased14,17 or increased risk of coronary heart disease.18 The present largest prospective results as well as a recent case-control study did not find any association with atherosclerosis susceptibility.19 In support of I883M and E1172D as 2 of the 3 most important ABCA1 SNPs for IHD prediction, a previous study of 2028 White men found increased frequencies in cases compared with controls, and also detected increased risk of future IHD events associated with the 1172D allele.18 The pairwise LD structure of the SNPs is important for the interpretation of the association results. Login to comment
96 The fact that the stepwise regression approach identified the V771M, I883M, and E1172D SNPs, which have very weak association between rare alleles (low r2 or negative Db18;), as important for the final IHD prediction model, supports that the observed findings for these 3 SNPs are not caused by LD. Login to comment

PMID: 17070530 [PubMed] Nebel A et al: "Common coding polymorphisms in the ABCA1 gene and risk of early-onset coronary heart disease in northern Germany."

No. Sentence Comment

7 In the present study, we have examined the potential association between the five known coding polymorphisms R219K, V771M, I883M, E1172D and R1587K in the ABCA1 gene and early-onset CHD in a large ethnically homogeneous sample from the northernmost province in Germany. Login to comment
25 We examined the five known ABCA1 polymorphisms R219K, V771M, I883M, E1172D and R1587K in early-onset 0021-9150/$ - see front matter (c) 2006 Elsevier Ireland Ltd. Login to comment
27 doi:10.1016/j.atherosclerosis.2006.09.022 Letter to the Editor / Atherosclerosis 193 (2007) 458-460 Table 1 Summary association statistics for common ABCA1 coding SNPs in German CHD patients and controls ABCA1 variant MAFa CHD MAFa control Pallele Pgenotype Pcarrier b ORcarrier c 95% CIcarrier d R219K (rs2230806)e 0.265 0.258 0.656 0.582 0.438 1.08 0.89-1.30 V771M (rs2066718)e 0.026 0.034 0.188 0.255 0.222 0.78 0.53-1.16 I883M (rs4149313)e 0.138 0.112 0.023 0.068 0.021 1.31 1.04-1.64 E1172D (hCV25924149)e 0.025 0.025 0.914 0.714 0.983 1.00 0.65-1.55 R1587K (rs2230808)e 0.261 0.234 0.067 0.197 0.097 1.18 0.97-1.42 a MAF, minor allele frequency. Login to comment
31 e R219K, V771M, I883M, E1172D and R1587K were typed using TaqMan® SNP Assays (Applied Biosystems, Foster City, USA). Login to comment
36 However, additional studies have indicated no relevant effects for the I883M genotype on CHD or HDH-C levels [8,10,11]. Login to comment
37 The other four SNPs R219K, V771M, E1172D and R1587K exhibited no clear effects in the German CHD samples investigated here. Login to comment
46 Table 2 Logistic regression analysis for five coding SNPs in the ABCA1 gene in German CHD patients and controls Predictora ORb 95% CIc P Gender 1.05 0.81-1.36 0.721 R219K 1.20 0.99-1.47 0.066 V771M 0.90 0.57-1.41 0.645 I883M 1.28 1.02-1.61 0.034 E1172D 0.78 0.52-1.19 0.253 R1587K 1.10 0.90-1.34 0.361 a Each marker binary classified for carriership of rare allele, gender was included as a predictive variable, logistic regression analysis was performed with the R-package [14]. Login to comment
26 doi:10.1016/j.atherosclerosis.2006.09.022 Letter to the Editor / Atherosclerosis 193 (2007) 458-460 Table 1 Summary association statistics for common ABCA1 coding SNPs in German CHD patients and controls ABCA1 variant MAFa CHD MAFa control Pallele Pgenotype Pcarrier b ORcarrier c 95% CIcarrier d R219K (rs2230806)e 0.265 0.258 0.656 0.582 0.438 1.08 0.89-1.30 V771M (rs2066718)e 0.026 0.034 0.188 0.255 0.222 0.78 0.53-1.16 I883M (rs4149313)e 0.138 0.112 0.023 0.068 0.021 1.31 1.04-1.64 E1172D (hCV25924149)e 0.025 0.025 0.914 0.714 0.983 1.00 0.65-1.55 R1587K (rs2230808)e 0.261 0.234 0.067 0.197 0.097 1.18 0.97-1.42 a MAF, minor allele frequency. Login to comment
30 e R219K, V771M, I883M, E1172D and R1587K were typed using TaqMan&#ae; SNP Assays (Applied Biosystems, Foster City, USA). Login to comment
45 Table 2 Logistic regression analysis for five coding SNPs in the ABCA1 gene in German CHD patients and controls Predictora ORb 95% CIc P Gender 1.05 0.81-1.36 0.721 R219K 1.20 0.99-1.47 0.066 V771M 0.90 0.57-1.41 0.645 I883M 1.28 1.02-1.61 0.034 E1172D 0.78 0.52-1.19 0.253 R1587K 1.10 0.90-1.34 0.361 a Each marker binary classified for carriership of rare allele, gender was included as a predictive variable, logistic regression analysis was performed with the R-package [14]. Login to comment

PMID: 17303779 [PubMed] Kiss RS et al: "Genetic etiology of isolated low HDL syndrome: incidence and heterogeneity of efflux defects."

No. Sentence Comment

47 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment
42 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment

PMID: 17383594 [PubMed] Mantaring M et al: "Genotypic variation in ATP-binding cassette transporter-1 (ABCA1) as contributors to the high and low high-density lipoprotein-cholesterol (HDL-C) phenotype."

No. Sentence Comment

3 Carrier frequencies of common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K were also assessed. Login to comment
8 Of the 6 common ABCA1 polymorphisms, very high HDL-C was associated with a higher genotype frequency for R219K (Ptrend ‫؍‬ 0.04) and higher genotype and allelic frequency for E1172D (Ptrend ‫؍‬ 0.0004, Ptrend ‫؍‬ 0.0002, respectively) compared with lower HDL-C. Login to comment
10 However, at least 1 ABCA1 polymorphism (eg, E1172D) may contribute to the high HDL-C phenotype. Login to comment
36 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA. Login to comment
54 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated. Login to comment
58 Mild differences in allele frequency were also identified between the highest and lowest HDL-C groups for V771M (23% vs 10%; Ptrend ϭ 0.04) and I883M (36% vs 20%; Ptrend ϭ 0.05). Login to comment
59 The least common variant, E1172D, was most prevalent in subjects with HDL-C Ͼ 100 mg/dL (2.6 mmol/L), and significant differences in both genotype and allele frequency were found between the HDL-C groups (Ptrend ϭ 0.0004 and Ptrend ϭ 0.0002, respectively). Login to comment
60 Overall, carriers of E1172D were more likely to have higher HDL-C and apoAI in association with lower TG levels (Table IV). Login to comment
72 Although evaluation of 22 biologically unrelated subjects with extremely high HDL-C (mean, 139 mg/dL [6.2 mmol/L]) disclosed no mutations in ABCA1, the polymorphism E1172D was more commonly observed (allele frequency, 18%) compared with lower HDL groups (allele frequency, 0-0.03%). Login to comment
74 The authors are aware of only 1 other study that evaluated E1172D in subjects with high HDL-C and found significantly higher levels in female carriers compared with wild-type.7 Kinetic studies may resolve differences between E1172D and wild-type on HDL-apoA-I fractional catabolic rates. Login to comment
75 Previously, Clee et al had also observed that E1172D was found exclusively in carriers of R1587K.8 However, an individual with E1172D in the absence of R1587K (ie, R/R wild-type) was identified, confirmed by direct sequencing, suggesting that E1172D is not in complete linkage disequilibrium with R1587K. Login to comment
77 Genotype and allele frequencies for 6 common ABCA1 polymorphisms in subgroups with HDL-C defined as very high (n ϭ 22), high (n ϭ 34), average (n ϭ 36), or low (n ϭ 32) R219K Genotype frequencies P value Allele frequencies P valueR/R R/K K/K R K Very high 31.8% 45.5% 22.7% 0.04 0.55 0.45 0.20 High 45.7% 51.4% 2.9% 0.71 0.29 Average 43.2% 56.8% 0.0% 0.72 0.28 Low 50.0% 40.0% 10.0% 0.70 0.30 V771M V/V V/M M/M V M Very high 59.0% 36.0% 4.5% 0.11 0.77 0.23 0.04 High 85.7% 14.3% 0.0% 0.93 0.07 Average 86.1% 13.9% 0.0% 0.93 0.07 Low 80.0% 20.0% 0.0% 0.90 0.10 V825I V/V V/I I/I V I Very high 77.3% 22.7% 0.0% 0.58 0.89 0.11 0.62 High 88.6% 11.4% 0.0% 0.94 0.06 Average 88.9% 11.1% 0.0% 0.94 0.06 Low 82.8% 17.2% 0.0% 0.92 0.08 I883M I/I I/M M/M I M Very high 40.9% 45.5% 13.6% 0.29 0.64 0.36 0.05 High 60.0% 34.3% 5.7% 0.78 0.22 Average 73.0% 24.3% 2.7% 0.85 0.15 Low 66.7% 26.7% 6.7% 0.80 0.20 E1172D E/E E/D D/D E D Very high 68.2% 31.8% 0.0% 0.0004 0.82 0.18 0.0002 High 94.3% 5.7% 0.0% 0.97 0.03 Average 94.6% 5.4% 0.0% 0.97 0.03 Low 100.00% 0.0% 0.0% 1.00 0.00 R1587K R/R R/K K/K R K Very high 31.8% 50.0% 18.2% 0.16 0.57 0.43 0.07 High 65.6% 25.0% 9.4% 0.78 0.22 Average 55.6% 41.7% 2.8% 0.76 0.24 Low 51.9% 33.3% 14.8% 0.69 0.31 of R219K may have a basis for reduced CVD risk as previously suggested.8-11,24 CONCLUSION The data extend previous findings that novel mutations in ABCA1 are associated with the low rather than the high HDL-C (FHA) phenotype. Login to comment
78 However, because the E1172D polymorphism may be associated with high HDL-C, further study is warranted to assess its potential clinical significance vis- à-vis CVD risk. Login to comment
35 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA. Login to comment
53 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated. Login to comment

PMID: 15935359 [PubMed] Hodoglugil U et al: "Common polymorphisms of ATP binding cassette transporter A1, including a functional promoter polymorphism, associated with plasma high density lipoprotein cholesterol levels in Turks."

No. Sentence Comment

104 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start. Login to comment
109 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl ± S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 ± 8.4 (205) 41.0 ± 7.9 (365) 39.9 ± 7.6 (158) 35.6 ± 7.4 (339) 35.5 ± 6.5 (635) 34.9 ± 6.5 (294) G-407C 41.3 ± 11.2 (82) 40.7 ± 7.7 (101) 40.7 ± 12.2 (37) 35.7 ± 6.9 (88) 35.3 ± 6.7 (96) 35.4 ± 7.4 (49) G-99C 40.7 ± 7.5 (505) 41.0 ± 7.2 (317) 41.3 ± 8.4 (53) 35.1 ± 6.5 (654) 35.0 ± 6.3 (405) 34.9 ± 6.5 (71) C-14T 41.3 ± 9.0 (361) 41.0 ± 9.0 (417) 41.0 ± 9.4 (138) 34.8 ± 7.0b (547) 35.5 ± 7.5 (675) 36.7 ± 8.1b (194) InsG 319 41.3 ± 8.1 (641) 40.5 ± 7.7 (193) 43.1 ± 8.0 (14) 35.3 ± 6.4 (933) 34.7 ± 6.4 (332) 34.5 ± 6.5 (23) Nonsynonymous R219K 41.2 ± 9.4 (364) 40.8 ± 8.6 (480) 41.2 ± 10 (152) 35.2 ± 7.3 (574) 35.3 ± 7.3 (688) 35.2 ± 7.6 (204) V771M 40.9 ± 9.2 (896) 42.8 ± 9.3 (82) 38.7 ± 10 (3) 35.1 ± 7.2c (1330) 37.1 ± 8.0c (144) 45.7 ± 10.7 (3) V825I 40.6 ± 9.4 (842) 38.9 ± 8.5 (117) 42 (1) 35.8 ± 8.7 (1005) 37.1 ± 9.5 (140) (-) I883M 41.1 ± 9.5 (643) 40.8 ± 8.4 (372) 41.4 ± 9.1 (69) 35.0 ± 7.0 (922) 35.7 ± 8.0 (457) 35.6 ± 7.4 (69) E1172D 40.5 ± 8.8 (907) 40.5 ± 7.6 (93) 29 (1) 34.6 ± 7.3 (1129) 35.4 ± 7.6 (105) 30.7 ± 8.7 (3) R1587K 41.1 ± 9.4 (410) 40.8 ± 9.6 (433) 41.0 ± 10.1 (94) 35.9 ± 8.1 (617) 35.1 ± 7.6 (579) 35.3 ± 8.6 (155) Numbers of subjects are shown in parenthesis. Login to comment
204 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele. Login to comment
215 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes. Login to comment
230 (rare allele in LD with rare allele) was observed between pairs of V771M and InsG 319, V825I and I883M, and R1587K and E1172D. Login to comment
103 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start. Login to comment
108 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl &#b1; S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 &#b1; 8.4 (205) 41.0 &#b1; 7.9 (365) 39.9 &#b1; 7.6 (158) 35.6 &#b1; 7.4 (339) 35.5 &#b1; 6.5 (635) 34.9 &#b1; 6.5 (294) G-407C 41.3 &#b1; 11.2 (82) 40.7 &#b1; 7.7 (101) 40.7 &#b1; 12.2 (37) 35.7 &#b1; 6.9 (88) 35.3 &#b1; 6.7 (96) 35.4 &#b1; 7.4 (49) G-99C 40.7 &#b1; 7.5 (505) 41.0 &#b1; 7.2 (317) 41.3 &#b1; 8.4 (53) 35.1 &#b1; 6.5 (654) 35.0 &#b1; 6.3 (405) 34.9 &#b1; 6.5 (71) C-14T 41.3 &#b1; 9.0 (361) 41.0 &#b1; 9.0 (417) 41.0 &#b1; 9.4 (138) 34.8 &#b1; 7.0b (547) 35.5 &#b1; 7.5 (675) 36.7 &#b1; 8.1b (194) InsG 319 41.3 &#b1; 8.1 (641) 40.5 &#b1; 7.7 (193) 43.1 &#b1; 8.0 (14) 35.3 &#b1; 6.4 (933) 34.7 &#b1; 6.4 (332) 34.5 &#b1; 6.5 (23) Nonsynonymous R219K 41.2 &#b1; 9.4 (364) 40.8 &#b1; 8.6 (480) 41.2 &#b1; 10 (152) 35.2 &#b1; 7.3 (574) 35.3 &#b1; 7.3 (688) 35.2 &#b1; 7.6 (204) V771M 40.9 &#b1; 9.2 (896) 42.8 &#b1; 9.3 (82) 38.7 &#b1; 10 (3) 35.1 &#b1; 7.2c (1330) 37.1 &#b1; 8.0c (144) 45.7 &#b1; 10.7 (3) V825I 40.6 &#b1; 9.4 (842) 38.9 &#b1; 8.5 (117) 42 (1) 35.8 &#b1; 8.7 (1005) 37.1 &#b1; 9.5 (140) (-) I883M 41.1 &#b1; 9.5 (643) 40.8 &#b1; 8.4 (372) 41.4 &#b1; 9.1 (69) 35.0 &#b1; 7.0 (922) 35.7 &#b1; 8.0 (457) 35.6 &#b1; 7.4 (69) E1172D 40.5 &#b1; 8.8 (907) 40.5 &#b1; 7.6 (93) 29 (1) 34.6 &#b1; 7.3 (1129) 35.4 &#b1; 7.6 (105) 30.7 &#b1; 8.7 (3) R1587K 41.1 &#b1; 9.4 (410) 40.8 &#b1; 9.6 (433) 41.0 &#b1; 10.1 (94) 35.9 &#b1; 8.1 (617) 35.1 &#b1; 7.6 (579) 35.3 &#b1; 8.6 (155) Numbers of subjects are shown in parenthesis. Login to comment
203 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele. Login to comment
214 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes. Login to comment
229 (rare allele in LD with rare allele) was observed between pairs of V771M and InsG 319, V825I and I883M, and R1587K and E1172D. Login to comment

PMID: 16429166 [PubMed] Brunham LR et al: "Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene."

No. Sentence Comment

48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment

PMID: 16226177 [PubMed] Frikke-Schmidt R et al: "Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population."

No. Sentence Comment

107 However, at the individual level, K776N appears to have a marked impact on risk. Login to comment
109 However, several arguments favor a true observation: 1) the involved amino acid residue is completely conserved between species and relatively conserved between 12 ABCAs with very different transport functions; 2) the amino acid substitution changes the charge of the side-chain, potentially leading to structural alterations of the protein, and consequently to altered protein interactions or transport properties; 3) in the CFTR (or ABCC7), a disease-causing mutation (R347P) has been identified at a site that corresponds to residue 764 in ABCA1 (15), and thus in close vicinity to K776N; 4) the present study is of a large cohort, and therefore includes only incident cases, avoiding the normal pitfalls of case reports and case-control studies (30); 5) we observed a similar trend on risk of IHD in a separate case-control study; 6) we have previously determined effects on lipids and lipoproteins of all non-synonymous SNPs identified in ABCA1 (R219K, V771M, V825I, I883M, E1172D, R1587K). Login to comment

PMID: 15262183 [PubMed] Probst MC et al: "Screening for functional sequence variations and mutations in ABCA1."

No. Sentence Comment

197 Three other known sequence variations have been found (heterozygous R219K, heterozygous E1172D and homozygous R1587K). Login to comment

PMID: 15044381 [PubMed] Knoblauch H et al: "Haplotypes and SNPs in 13 lipid-relevant genes explain most of the genetic variance in high-density lipoprotein and low-density lipoprotein cholesterol."

No. Sentence Comment

77 SNP characteristics including SNP identification system, localization, allele frequencies, nucleotide exchange and pseudonym are shown Gene/SNP no. SNP Id. Localization Allele frequency Nucleotide exchange Pseudonym APOB apob.snp1 rs512535 Promotor 0.45 G/A G-837A apob.snp2 rs1367117 Exon/non-syn 0.32 C/T Thr71Ile apob.snp3 rs520354 Intron 0.44 T/C apob.snp4 rs679899 Exon/non-syn 0.44 C/T Ala618Val apob.snp5 rs673548 Intron 0.21 C/T apob.snp6 rs693 Exon/syn 0.50 T/C XbaI apob.snp7 rs1800479 Intron 0.16 C/G Gþ50/in27C apob.snp8 rs1801703 Exon/non-syn 0.01 C/T Val4101Met apob.snp9 rs1042034 Exon/non-syn 0.22 T/C Asn4311Ser APOE apoe.snp1 rs449647 Promotor 0.17 A/T t-491a apoe.snp2 rs405509 Promotor 0.48 C/A g-219t apoe.snp3 rs440446 Intron 0.36 G/C Variant 1163 apoe.snp4 rs769450 Intron 0.41 C/T Variant 2440 apoe.snp5 rs429358 Exon/non-syn 0.16 T/C Cys112Arg apoe.snp6 rs7412 Exon/non-syn 0.06 C/T Arg158Cys ABCA1 abca1.snp1 rs2422493 Promotor 0.45 G/A 2477c/t abca1.snp2 rs1800977 50 UTR 0.50 C/T t69c abca1.snp3 50 UTR 0.04 C/G c117g abca1.snp4 rs2575879 Intron 0.46 G/C abca1.snp5 rs1800978 50 UTR 0.01 G/C G378C abca1.snp6 rs1999429 Intron 0.03 G/T abca1.snp7 rs2230806 Exon/non-syn 0.26 C/T Arg219Lys abca1.snp8 rs2274873 Exon/syn 0.08 C/T Pro312Pro abca1.snp9 rs4149313 Exon/non-syn 0.13 T/C A3044G, Ile883Met abca1.snp10 Exon/non-syn 0.03 C/G G3911C, Glu1172Asp abca1.snp11 rs2066716 Exon/syn 0.08 G/A Thr1367Thr abca1.snp12 rs363717 30 UTR 0.20 A/G CETP cetp.snp1 rs4783961 Promotor 0.47 C/T 2971 g/a cetp.snp2 rs1800776 Promotor 0.07 G/T 2631 cetp.snp3 rs1800775 Promotor 0.49 G/T 2629 cetp.snp4 rs711752 Intron 0.45 C/T Gþ202/in1A cetp.snp5 rs708272 Intron 0.45 C/T Taq1B; Gþ279/in1A cetp.snp6 rs158478 Intron 0.46 C/A EcoNI cetp.snp7 rs1532625 Intron 0.43 G/A Cþ8/in7T cetp.snp8 rs289718 Intron 0.29 T/C cetp.snp9 rs289719 Intron 0.29 C/T cetp.snp10 rs5880 Exon/non-syn 0.04 C/G CETPu1, Ala373Pro cetp.snp11 rs5882 Exon/non-syn 0.35 A/G CETPu2 cetp.snp12 rs1801706 30 UTR 0.18 C/T Gþ84A LCAT lcat.snp1 rs1109166 Intron 0.17 A/G lcat.snp2 rs4986970 Exon/non-syn 0.04 A/T Ser232Thr lcat.snp3 rs5923 Exon/syn 0.04 G/A LCATu3 LIPC lipc.snp1 rs723967 50 regiona 0.46 G/A lipc.snp2 rs1800588 Promotor 0.28 G/A 2C480T lipc.snp3 rs1869144 Intron 0.39 A/G lipc.snp4 rs6078 Exon/non-syn 0.04 G/A LIPCu1; Val73Met lipc.snp5 rs690 Exon/syn 0.49 T/G LIPCu3; Val155Val lipc.snp6 rs6082 Exon/syn 0.08 A/G LIPCu5; Gly197Gly lipc.snp7 rs6083 Exon/non-syn 0.36 T/C LIPCu6; Asn193Ser lipc.snp8 rs6084 Exon/syn 0.44 C/G LIPCu8; Thr224Thr lipc.snp9 rs6074 Exon/syn 0.13 G/T Thr479Thr LPL lpl.snp1 Promotor 0.00 C/A G-95T lpl.snp2 rs1800590 Promotor 0.01 A/C G-93T lpl.snp3 rs1031045 Intron 0.01 C/T lpl.snp4 rs253 Intron 0.47 C/T Continued Human Molecular Genetics, 2004, Vol. 13, No. 10 995 13 candidate genes important to lipid metabolism. Login to comment
79 SNP characteristics including SNP identification system, localization, allele frequencies, nucleotide exchange and pseudonym are shown Gene/SNP no. SNP Id. Localization Allele frequency Nucleotide exchange Pseudonym APOB apob.snp1 rs512535 Promotor 0.45 G/A G-837A apob.snp2 rs1367117 Exon/non-syn 0.32 C/T Thr71Ile apob.snp3 rs520354 Intron 0.44 T/C apob.snp4 rs679899 Exon/non-syn 0.44 C/T Ala618Val apob.snp5 rs673548 Intron 0.21 C/T apob.snp6 rs693 Exon/syn 0.50 T/C XbaI apob.snp7 rs1800479 Intron 0.16 C/G G&#fe;50/in27C apob.snp8 rs1801703 Exon/non-syn 0.01 C/T Val4101Met apob.snp9 rs1042034 Exon/non-syn 0.22 T/C Asn4311Ser APOE apoe.snp1 rs449647 Promotor 0.17 A/T t-491a apoe.snp2 rs405509 Promotor 0.48 C/A g-219t apoe.snp3 rs440446 Intron 0.36 G/C Variant 1163 apoe.snp4 rs769450 Intron 0.41 C/T Variant 2440 apoe.snp5 rs429358 Exon/non-syn 0.16 T/C Cys112Arg apoe.snp6 rs7412 Exon/non-syn 0.06 C/T Arg158Cys ABCA1 abca1.snp1 rs2422493 Promotor 0.45 G/A 2477c/t abca1.snp2 rs1800977 50 UTR 0.50 C/T t69c abca1.snp3 50 UTR 0.04 C/G c117g abca1.snp4 rs2575879 Intron 0.46 G/C abca1.snp5 rs1800978 50 UTR 0.01 G/C G378C abca1.snp6 rs1999429 Intron 0.03 G/T abca1.snp7 rs2230806 Exon/non-syn 0.26 C/T Arg219Lys abca1.snp8 rs2274873 Exon/syn 0.08 C/T Pro312Pro abca1.snp9 rs4149313 Exon/non-syn 0.13 T/C A3044G, Ile883Met abca1.snp10 Exon/non-syn 0.03 C/G G3911C, Glu1172Asp abca1.snp11 rs2066716 Exon/syn 0.08 G/A Thr1367Thr abca1.snp12 rs363717 30 UTR 0.20 A/G CETP cetp.snp1 rs4783961 Promotor 0.47 C/T 2971 g/a cetp.snp2 rs1800776 Promotor 0.07 G/T 2631 cetp.snp3 rs1800775 Promotor 0.49 G/T 2629 cetp.snp4 rs711752 Intron 0.45 C/T G&#fe;202/in1A cetp.snp5 rs708272 Intron 0.45 C/T Taq1B; G&#fe;279/in1A cetp.snp6 rs158478 Intron 0.46 C/A EcoNI cetp.snp7 rs1532625 Intron 0.43 G/A C&#fe;8/in7T cetp.snp8 rs289718 Intron 0.29 T/C cetp.snp9 rs289719 Intron 0.29 C/T cetp.snp10 rs5880 Exon/non-syn 0.04 C/G CETPu1, Ala373Pro cetp.snp11 rs5882 Exon/non-syn 0.35 A/G CETPu2 cetp.snp12 rs1801706 30 UTR 0.18 C/T G&#fe;84A LCAT lcat.snp1 rs1109166 Intron 0.17 A/G lcat.snp2 rs4986970 Exon/non-syn 0.04 A/T Ser232Thr lcat.snp3 rs5923 Exon/syn 0.04 G/A LCATu3 LIPC lipc.snp1 rs723967 50 regiona 0.46 G/A lipc.snp2 rs1800588 Promotor 0.28 G/A 2C480T lipc.snp3 rs1869144 Intron 0.39 A/G lipc.snp4 rs6078 Exon/non-syn 0.04 G/A LIPCu1; Val73Met lipc.snp5 rs690 Exon/syn 0.49 T/G LIPCu3; Val155Val lipc.snp6 rs6082 Exon/syn 0.08 A/G LIPCu5; Gly197Gly lipc.snp7 rs6083 Exon/non-syn 0.36 T/C LIPCu6; Asn193Ser lipc.snp8 rs6084 Exon/syn 0.44 C/G LIPCu8; Thr224Thr lipc.snp9 rs6074 Exon/syn 0.13 G/T Thr479Thr LPL lpl.snp1 Promotor 0.00 C/A G-95T lpl.snp2 rs1800590 Promotor 0.01 A/C G-93T lpl.snp3 rs1031045 Intron 0.01 C/T lpl.snp4 rs253 Intron 0.47 C/T Continued 13 candidate genes important to lipid metabolism. Login to comment

PMID: 14962947 [PubMed] Tregouet DA et al: "In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma ApoA1 levels and myocardial infarction."

No. Sentence Comment

84 Description and Frequency of ABCA1 Gene Polymorphisms in the 2 Centers From the United Kingdom Sequence Allele Frequency† Name 5Ј Flanking Nucleotide Change 3Ј Flanking Belfast (Nϭ888) Glasgow (Nϭ725) A-1814G CAGCCTCCTG A/g GATAACAGGC 0.339 0.366 C-1801T TAACAGGCGC C/t CGCCACCACA 0.443 0.433 A-1652G CACTGCGCCC A/g GCTCAGATCC 0.350 0.364 G-1506C CTCTTCTATG G/c GTCTGTCCTG 0.203 0.205 C-1395T TGAATGTCTG C/t ATGCAGGTGG 0.428 0.425 G-1252A TGCCCTTCAA G/a GTGGCTACAA 0.095 0.088 C-1217T AGGTAGGAGA C/t CTTGTGGCCT 0.120 0.121 -1034ins/del ATATTTAGAC ϮAT ATGGTGTGTA 0.210 0.220 T-940G GGCAAACAGA T/g AAGTTGGAGG 0.486 0.483 G-803A AAATTAAAAG G/a GGGCTGGTCC 0.108 0.093 -777rpt/23nt* CTGTGTTTTTGTTTGTTTGTTTC 0.527 0.518 -777rpt/28nt CTGTGTTTTTGTTTGTTTTGTTTGTTTC 0.267 0.272 -777rpt/32nt CTGTGTTTTTGTTTGTTTGTTTTGTTTGTTTC 0.206 0.210 C-564T GAGGACTGTC C/t GCCTTCCCCT 0.456 0.472 G-407C GCGGAAAGCA G/c GATTTAGAGG 0.455 0.459 C-302T CGTCTTAGGC C/t GGCGGGCCCG 0.196 0.189 G-278C GGGGGAAGGG G/c ACGCAGACCG 0.435 0.424 C-14T GGAACTAGTC C/t CGGCAAAAAC 0.335 0.346 R219K GGCCTACCAA G/a GGAGAAACTG 0.283 0.278 G316G AGGGAGGGGG G/a CTGAAGATCA 0.114 0.095 I680I ACAACAGCAT C/a CTCTGGTTTA 0.129 0.118 V771 M GCAGGACTAC G/a TGGGCTTCAC 0.029 0.034 V825I CACCACTTCG G/a TCTCCATGAT 0.056 0.060 I883 M AGAAGAGAAT A/g TCAGAAAGTA 0.137 0.126 L1122L GAAGAACCAG C/t TGGGAACAGG 0.023 0.017 E1172D GCGACCATGA G/c AGTGACACGC 0.026 0.027 T1427T GCAGAGACAC G/a CCCTGCCAGG 0.069 0.083 R1587K CTGGACACCA G/a AAATAATGTC 0.216 0.226 *1 subject carried an additional GTTT deletion, leading to an allele of 19 nucleotides. Login to comment
124 Discussion Much attention has been focused on the association of ABCA1 gene polymorphisms with different phenotypes including lipid variables and clinical endpoints.23,25-29,39 Several studies have consistently reported an association between the R219K polymorphism and coronary artery disease.23,26,27 This polymorphism has been shown to be associated with triglycerides23 but not with HDL-C.26,27 Inconsistent results were also observed for other ABCA1 gene polymorphisms including V825I, I883 M, and E1172D. Login to comment
133 Haplotype Structure Defined by the Polymorphisms of the ABCA1 Gene Coding Region (N‫)6921؍‬ Polymorphisms Estimated Haplotype Frequencies R219K G316G (G/A) I680I (C/A) V771 M V825I I883 M L1122L (C/T) E1172D T1427T (G/A) R1587K Controls (Nϭ639) Cases (Nϭ657) R G C V V I C E G R 0.470 0.522 R G C V V I C E G K 0.089 0.085 R G C V V I C E A R 0.026 0.031 R G C V V I C D G K 0.018 0.019 R G C V V I T E G R 0.016 0.017 R G A V I M C E G R 0.015 0.015 R G A V I M C E G K 0.015 0.015 R G A V I M C E A R 0.028 0.026 K G C V V I C E G R 0.077 0.063 K G C V V I C E G K 0.041 0.037 K G A V V M C E G R 0.026 0.020 K G A V V M C E G K 0.014 0.012 K G A V V M C E A R 0.016 0.019 K A C V V I C E G R 0.042 0.035 K A C V V I C E G K 0.034 0.027 K A C M V I C E G R 0.028 0.027 The haplotype structure of the coding region of the ABCA1 gene can be completely defined by a minimal subset of 8 "tag" polymorphisms indicated in boxes. Login to comment
80 Description and Frequency of ABCA1 Gene Polymorphisms in the 2 Centers From the United Kingdom Sequence Allele Frequencyߤ Name 5b18; Flanking Nucleotide Change 3b18; Flanking Belfast (Nafd;888) Glasgow (Nafd;725) A-1814G CAGCCTCCTG A/g GATAACAGGC 0.339 0.366 C-1801T TAACAGGCGC C/t CGCCACCACA 0.443 0.433 A-1652G CACTGCGCCC A/g GCTCAGATCC 0.350 0.364 G-1506C CTCTTCTATG G/c GTCTGTCCTG 0.203 0.205 C-1395T TGAATGTCTG C/t ATGCAGGTGG 0.428 0.425 G-1252A TGCCCTTCAA G/a GTGGCTACAA 0.095 0.088 C-1217T AGGTAGGAGA C/t CTTGTGGCCT 0.120 0.121 afa;1034ins/del ATATTTAGAC afe;AT ATGGTGTGTA 0.210 0.220 T-940G GGCAAACAGA T/g AAGTTGGAGG 0.486 0.483 G-803A AAATTAAAAG G/a GGGCTGGTCC 0.108 0.093 afa;777rpt/23nt* CTGTGTTTTTGTTTGTTTGTTTC 0.527 0.518 afa;777rpt/28nt CTGTGTTTTTGTTTGTTTTGTTTGTTTC 0.267 0.272 afa;777rpt/32nt CTGTGTTTTTGTTTGTTTGTTTTGTTTGTTTC 0.206 0.210 C-564T GAGGACTGTC C/t GCCTTCCCCT 0.456 0.472 G-407C GCGGAAAGCA G/c GATTTAGAGG 0.455 0.459 C-302T CGTCTTAGGC C/t GGCGGGCCCG 0.196 0.189 G-278C GGGGGAAGGG G/c ACGCAGACCG 0.435 0.424 C-14T GGAACTAGTC C/t CGGCAAAAAC 0.335 0.346 R219K GGCCTACCAA G/a GGAGAAACTG 0.283 0.278 G316G AGGGAGGGGG G/a CTGAAGATCA 0.114 0.095 I680I ACAACAGCAT C/a CTCTGGTTTA 0.129 0.118 V771 M GCAGGACTAC G/a TGGGCTTCAC 0.029 0.034 V825I CACCACTTCG G/a TCTCCATGAT 0.056 0.060 I883 M AGAAGAGAAT A/g TCAGAAAGTA 0.137 0.126 L1122L GAAGAACCAG C/t TGGGAACAGG 0.023 0.017 E1172D GCGACCATGA G/c AGTGACACGC 0.026 0.027 T1427T GCAGAGACAC G/a CCCTGCCAGG 0.069 0.083 R1587K CTGGACACCA G/a AAATAATGTC 0.216 0.226 *1 subject carried an additional GTTT deletion, leading to an allele of 19 nucleotides. Login to comment
120 Discussion Much attention has been focused on the association of ABCA1 gene polymorphisms with different phenotypes including lipid variables and clinical endpoints.23,25-29,39 Several studies have consistently reported an association between the R219K polymorphism and coronary artery disease.23,26,27 This polymorphism has been shown to be associated with triglycerides23 but not with HDL-C.26,27 Inconsistent results were also observed for other ABCA1 gene polymorphisms including V825I, I883 M, and E1172D. Login to comment
129 Haplotype Structure Defined by the Polymorphisms of the ABCA1 Gene Coding Region (Nd1d;1296) Polymorphisms Estimated Haplotype Frequencies R219K G316G (G/A) I680I (C/A) V771 M V825I I883 M L1122L (C/T) E1172D T1427T (G/A) R1587K Controls (Nafd;639) Cases (Nafd;657) R G C V V I C E G R 0.470 0.522 R G C V V I C E G K 0.089 0.085 R G C V V I C E A R 0.026 0.031 R G C V V I C D G K 0.018 0.019 R G C V V I T E G R 0.016 0.017 R G A V I M C E G R 0.015 0.015 R G A V I M C E G K 0.015 0.015 R G A V I M C E A R 0.028 0.026 K G C V V I C E G R 0.077 0.063 K G C V V I C E G K 0.041 0.037 K G A V V M C E G R 0.026 0.020 K G A V V M C E G K 0.014 0.012 K G A V V M C E A R 0.016 0.019 K A C V V I C E G R 0.042 0.035 K A C V V I C E G K 0.034 0.027 K A C M V I C E G R 0.028 0.027 The haplotype structure of the coding region of the ABCA1 gene can be completely defined by a minimal subset of 8 "tag" polymorphisms indicated in boxes. Login to comment

PMID: 12763760 [PubMed] Singaraja RR et al: "Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene."

No. Sentence Comment

136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
147 The R219K, V771M, and I883M variants have been recognized as putative antiatherogenic polymorphisms, associated with increased HDL-C and decreased triglyceride levels (K219 and M883) and increased HDL-C and ApoA-I (M771).41,75,82 The E1172D, R1587K cSNPs have been reported to be associated with decreased HDL-C.75 Five promoter SNPs are associated with increased severity of atherosclerosis, including the -191C/-320C/-477T hap- lotype76,78 as well as the G-191C and A-1096G SNPs. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
153 The V825I, I883M, and E1172D SNPs have also been associated with increased clinical events and severity of atherosclerosis.75,77 The R219K Variant The R219K SNP has been most studied and highlights many of the difficulties associated with the study of SNPs in general. Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
139 The R219K, V771M, and I883M variants have been recognized as putative antiatherogenic polymorphisms, associated with increased HDL-C and decreased triglyceride levels (K219 and M883) and increased HDL-C and ApoA-I (M771).41,75,82 The E1172D, R1587K cSNPs have been reported to be associated with decreased HDL-C.75 Five promoter SNPs are associated with increased severity of atherosclerosis, including the afa;191C/afa;320C/afa;477T hap- lotype76,78 as well as the G-191C and A-1096G SNPs. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
145 The V825I, I883M, and E1172D SNPs have also been associated with increased clinical events and severity of atherosclerosis.75,77 The R219K Variant The R219K SNP has been most studied and highlights many of the difficulties associated with the study of SNPs in general. Login to comment

PMID: 12840658 [PubMed] Miller M et al: "Genetics of HDL regulation in humans."

No. Sentence Comment

66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.] Login to comment

PMID: 11238261 [PubMed] Clee SM et al: "Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease."

No. Sentence Comment

44 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment
48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
132 Carriers of V399A had half the frequency of a positive family history of CAD (22.2% versus 49.4%, Pϭ0.18) and trends toward an increased baseline MOD (Table 6) and less progression in MSD (-0.05Ϯ0.10 versus 0.08Ϯ0.19 mm in noncarriers, Pϭ0.16) during the trial. Login to comment
137 Carriers of the other 3 rare variants (T774P, K776N, and E1172D) showed no significant differences in lipid levels or CAD compared with their respective noncarriers (Table 6). Login to comment
148 MSD was still significantly increased in R219K carriers compared with noncarriers (2.81Ϯ0.37 versus 2.69Ϯ0.36 mm, Pϭ0.04); MOD was increased in carriers (1.78Ϯ0.39 versus 1.73Ϯ0.38 mm); and TG remained significantly decreased in carriers (1.67Ϯ0.76 versus 1.97Ϯ0.74 mmol/L, Pϭ0.02). Login to comment
149 Thus, the effects of the R219K variant described herein are not due to other cSNPs that are found in linkage disequilibrium with it. Login to comment
151 The relative risk of the V825I carriers adjusted for I883M genotype was 2.31 (95% CI, 0.78 to 6.85). Login to comment
153 The E1172D cSNP was found exclusively in carriers of the R1587K variant. Login to comment
154 Excluding carriers of E1172D (nϭ34), a trend toward decreasing HDL-C with the R1587K K allele was still evident (0.87Ϯ0.18 mmol/L in KK, 0.92Ϯ0.23 mmol/L in RK, and 0.94Ϯ0.23 mmol/L in RR, Pϭ0.19). Login to comment
156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D. Login to comment
162 not due to the nonfunctional E1172D variant, with which it is in linkage disequilibrium. Login to comment
39 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
157 not due to the nonfunctional E1172D variant, with which it is in linkage disequilibrium. Login to comment

PMID: 23139370 [PubMed] Schou J et al: "ABC transporter genes and risk of type 2 diabetes: a study of 40,000 individuals from the general population."

No. Sentence Comment

86 Genotype frequencies did not differ from those predicted by Hardy-Weinberg equilibrium (P values 0.11-0.98), except for ABCA1 E1172D (P = 0.03), in the CCHS. Login to comment

PMID: 24385509 [PubMed] Westerterp M et al: "ATP-binding cassette transporters, atherosclerosis, and inflammation."

No. Sentence Comment

59 In a Mendelian randomization approach in a prospective cohort comprising ࣈ9000 individuals, heterozygosity for the ABCA1 mutation K776N led to a 2-to-3 times higher risk of ischemic heart disease.105 Furthermore, 5 single-nucleotide polymorphisms (SNPs) inABCA1 (V771M,V825I, I883M, E1172D, R1587K) were shown to predict risk of ischemic heart disease in a cohort of 9259 individuals.106 However, the same group reported more recently that heterozygosity for 4 loss-of-function mutations (P1065S, G1216V, N1800H, R2144X) was not associated with a higher risk of ischemic heart disease in 3 prospective cohorts comprising 56ߙ886 individuals.107 It must be noted, however, that only small decreases in HDL, of ࣈ28% as opposed to ࣈ50% in previously reported ABCA1 heterozygotes, were observed.94,101-103,107 Also, the residual cholesterol efflux was substantial (74%-79% for P1065S and G1216V and 48%-49% for N1800H and R2144X for homozygous mutations compared with controls),107 whereas in patients with TD there was only 20% to 30% residual cholesterol efflux.108 In addition, LDL levels were reduced by ࣈ25%, probably offsetting the effects of reduced HDL on CVD.107 Thus, the conflicting results in these studies could be related to inclusion of relatively mild ABCA1 mutations as well as offsetting effects of reduced LDL cholesterol levels.109 In a meta-analysis of genome-wide association studies, SNPs near the ABCA1 gene have been associated with HDL and total cholesterol levels,110,111 but not with cardiovascular risk.112 Although these studies have the benefit of huge statistical power, some caution is merited in the interpretation of findings. Login to comment

PMID: 24844148 [PubMed] Koldamova R et al: "ATP-binding cassette transporter A1: from metabolism to neurodegeneration."

No. Sentence Comment

1010 Importantly, the number of non-synonymous alleles of previously identified rare variant E1172D, known to be associated with very high HDL-C levels, was more than twice higher in the control compared to the case samples. Login to comment