ABCMdb

ABCC7 p.Gly178Arg

[switch to full view]
Comments [show]

III (gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications

PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."

No. Sentence Comment

370 G178R and E193K reduced anion translocation capability [172]. Login to comment

PMID: 11242048 [PubMed] Choi JY et al: "Aberrant CFTR-dependent HCO3- transport in mutations associated with cystic fibrosis."

No. Sentence Comment

36 Similar rates were measured for the I148T, G178R, A1067T, G1244E, S1255P and G1349D mutants (see Fig. 3 for location of these mutations in CFTR), all of which are associated with CF with pancreatic insuf®- ciency. Login to comment
186 letters to nature 96 NATURE |VOL 410 |1 MARCH 2001 |www.nature.com HCO3 -/Cl- transportratio 0 0.25 0.50 0.75 1.00 WT I148T G178R R297Q G551D H620Q G970R A1067T G1244E S1255P G1349D E193K G551S A800G H949Y R1070Q Pancreatic insufficient Pancreatic sufficientD648V N CI148T G178R E193K R297Q R117H A1067T R1070Q G1244E S1255P G1349D NBD2 RD H949Y G970R CL4CL3CL2CL1 NBD1 G551D G551S H620Q D648V A800G Figure 3 The HCO3:Cl-transport ratio of CFTR mutants associated with CF. Login to comment

PMID: 11668613 [PubMed] Wong LJ et al: "Improved detection of CFTR mutations in Southern California Hispanic CF patients."

No. Sentence Comment

112 This is supported by the evidence that a similar mutation, a Gly to Arg change at position 178, is deleterious [Zielenski et al., 1991]. Login to comment

PMID: 11883825 [PubMed] Padoan R et al: "Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis."

No. Sentence Comment

40 Mutation Frequency (%) DelF508 54 N1303K 8 G542X 6.25 1717-1G ® A 2.50 R334W 1.75 2183AA ® G 1.50 R117H, L1077P, W1282X 1.25 D110E, R347P, E585X, 2789 ‡ 5G ® A 0.75 R352Q, R553X, R1066H, D1152H, R1158X, 1782delA, 1898 ‡ 1G ® A, 3659delC 0.50 G85E, R117L, G178R, D579G, H609R, Y1032C, V1153E, R1162X, 621 ‡ 1G ® T, 711 ‡ 1G ® T, 1845delAG o 1846delGA, 2143delT 0.25 Table2.Differencesinthethreestrategiesofneonatalscreening(audit1990-1999). Login to comment

PMID: 14641997 [PubMed] Raskin S et al: "High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing."

No. Sentence Comment

63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

PMID: 15371903 [PubMed] Sugarman EA et al: "CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations."

No. Sentence Comment

35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

PMID: 15371908 [PubMed] Buyse IM et al: "Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation."

No. Sentence Comment

77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment
111 The mass spectrometry chromatogram indicates the expected wild-type and mutant peaks for each mutation in the multiplex CF assay shown (31999del6, G178R, 711ϩ1T). Login to comment

PMID: 15638824 [PubMed] Castaldo G et al: "Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population."

No. Sentence Comment

55 The DGGE pattern of exon 5 in the CF patient is suggestive of a heterozygous gene variant, which was identified as the G178R missense mutation. Login to comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
64 The analysis revealed an altered pattern of exon 5 in the patient; the sequence analysis identified the G178R mutation at the heterozygous state. Login to comment
97 Due to the presence of 'local` mutations, the detection rate with commercial kits for CF chromosomes in Table 3 Mutations linked to different haplotypes possibly due to slippage events, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) by the indication of the repeats number Present study Other studies Cases Haplotype cases (n) (n. of repeats) (n) Haplotype references* (n. of repeats) R347P 4/4 16-32-13 3 16-32-13 1,2,3 1 16-31-13 3 2 17-28-13 1 1 16-45-13 1 L1077P 3/3 17-7-17 1 17-7-17 1 1 17-7-16 1 G85E 2/2 16-24-13 9 16-24-13 2,3 1 16-25-13 2 2183AA>G 14/14 16-31-13 1 16-31-13 3 4 16-30-13 1 R553X 6/11 17-55-13 3 17-58-13 3 3/11 18-55-13 1 17-57-11 1 1/11 16-55-13 2 17-55-13 1,3 1/11 16-55-11 6 17-55-11 1 1 17-52-11 1 1 17-54-11 1 1 17-56-13 3 G1244E 5/6 16-32-13 1 17-34-13 1 1/6 16-34-13 711 +1 G>T 5/5 16-25-13 7 16-25-13 1,2,3 1 16-26-13 1 G1349D 5/6 16-30-13 1/6 16-32-13 G178R 1/2 16-32-13 1 16-30-13 3 1/2 16-32-13 2 16-32-13 1 * References 1: Morral et al. 1996. Login to comment

PMID: 18597042 [PubMed] Mornon JP et al: "Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces."

No. Sentence Comment

250 G178R (involving ICL1) and G970R (involving ICL3) are two CF-causing mutations. Login to comment
251 The G178R mutant exhibits impaired anion translocation capacity [73] and the G970R mutant is probably involved in obtaining or maintaining the open state of the transporter [74]. Login to comment
255 Other CF-associated mutations of interest in ICL1 and ICL3 are (i) E193K, a mutation of an ICL1 residue that exhibits, similarly to G178R, impaired anion translocation capacity [73], and (ii) S945L, H949Yand G970R, which affect ICL3 residues and are probably involved (as G970R) in obtaining or maintaining the open state of the transporter [74]. Login to comment

PMID: 20059485 [PubMed] Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"

No. Sentence Comment

64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

PMID: 21474639 [PubMed] Rohlfs EM et al: "Cystic fibrosis carrier testing in an ethnically diverse US population."

No. Sentence Comment

131 Four mutations (p.S1255X, p.G330X, c.313delA, p.S364P) were identified only in African Americans, 8 mutations (p.G178R, p.T338I, c.262_ 263delTT, p.M1101K, c.442delA, p.K710X, p.P574H, p.Q1238X)wereidentifiedonlyinCaucasians,and3mu- tations (c.580-1GϾT, c.531delT, p.Q890X) were identified only in Hispanics. Login to comment

PMID: 9922375 [PubMed] Sheppard DN et al: "Structure and function of the CFTR chloride channel."

No. Sentence Comment

176 Furthermore, the mutations I148T and G178R could not be locked open by the nonhydrolyzable ATP analog 5؅- adenylylimidodiphosphate (AMP-PNP) (112), the mutation Information about the CFTR pore has also emerged from studies using Cl0 channel inhibitors. Login to comment

PMID: 22658665 [PubMed] Ooi CY et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis."

No. Sentence Comment

855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

PMID: 22293084 [PubMed] Yu H et al: "Ivacaftor potentiation of multiple CFTR channels with gating mutations."

No. Sentence Comment

4 These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. Login to comment
23 Other known CFTR gating mutations include G178R, G551S, G970R, G1244E, S1255P, and G1349D [9-11]. Login to comment
39 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
46 This analysis showed that, as expected for known CFTR gating mutations (G551D, G178R, G551S, G970R, G1244E, S1255P, and G1349D) [5,9-11], the amount of CFTR delivered to the cell surface was generally similar between CFTR with gating defects and normal CFTR. Login to comment
50 Ivacaftor increased the channel gating of mutant CFTR with defective channel gating The effect of ivacaftor on CFTR channel gating was monitored by quantifying the channel open probability by patch-clamp electrophysiology using membrane patches excised from FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, or G1349D-CFTR. Login to comment
52 Under these conditions, the baseline CFTR channel open probability of G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR was ≤5% of normal CFTR (Fig. 2, B; Table 1). Login to comment
53 For most mutant CFTR forms, the single channel current amplitude, a measure of channel conductance, was similar to normal CFTR (between 77% and 122% of normal CFTR), although a small but statistically significant difference in single channel current amplitude was observed for S1255P-CFTR (Table 1). Login to comment
58 Ivacaftor enhanced chloride transport through mutant CFTR with defective channel gating The impact of the increase in CFTR channel gating by ivacaftor on total chloride transport was assessed in Ussing chamber studies using FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR. Login to comment
61 Under these conditions, the baseline level of chloride transport in FRT cells expressing G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR was b10% of normal CFTR (Fig. 3; Table 2), which was consistent with the low CFTR channel open probability of these mutant CFTR forms (Table 1). Login to comment
71 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTRmRNA (%NormalCFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTRMaturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations MatureCFTR (%NormalCFTR) A B D C Mature Immature Fig. 1. Login to comment
90 In a panel of FRT cells expressing G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR, we confirmed that all these mutant CFTR forms shared similar in vitro functional characteristics that were consistent with a defect in channel gating. Login to comment
91 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects. Login to comment
93 Ivacaftor addition caused a N10-fold increase in CFTR-mediated chloride transport in FRT cells expressing G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR. Login to comment
96 Taken together, these in vitro results provide a rationale for testing the potential benefit of ivacaftor in individuals with CF who have a CFTR gating mutation other than G551D, including the G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P, and G1349D CFTR gating mutations. Login to comment
97 Evaluation of CF-associated CFTR mutations that were expected to cause protein alterations in the ATP-binding sites formed by the NBDs indicated that S549N- and S1251N-CFTR also shared similar in vitro functional characteristics with G551D-CFTR and could be classified as CFTR gating mutations. Login to comment
99 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 µM Ivacaftor * * * * * * * * * * * CFTR Mutation ChannelOpenProbability ChannelOpenProbability (%NormalCFTR) B 1pA 3sec + 10 µM Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
128 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 μM ivacaftor Baseline With 10 μM ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57±0.03 100 0.63±0.02 111 0.400±0.04 100 0.800±0.04 a 200 G551D 0.46±0.06 81 0.46±0.03 81 0.019±0.01 b 5 0.121±0.035 a 30 G178R 0.59±0.11 103 0.66±0.08 116 0.005±0.001 b 1 0.228±0.022 a 57 S549N 0.55±0.02 97 0.61±0.02 108 0.003±0.010 b 1 0.396±0.119 a 99 S549R 0.45±0.01 b 79 0.55±0.02 a 96 0.004±0.010 b 1 0.143±0.031 a 36 G551S 0.57±0.13 100 0.64±0.02 113 0.010±0.001 b 3 0.337±0.110 a 84 G970R 0.55±0.03 96 0.55±0.03 97 0.001±0.001 b 0 0.245±0.042 a 61 G1244E 0.44±0.11 77 0.54±0.08 94 0.011±0.010 b 3 0.470±0.122 a 118 S1251N 0.54±0.07 95 0.63±0.04 111 0.003±0.010 b 1 0.350±0.03 a 88 S1255P 0.70±0.03 b 122 0.71±0.02 125 0.018±0.016 b 5 0.468±0.168 a 117 G1349D 0.49±0.08 85 0.63±0.06 111 0.019±0.015 b 5 0.315±0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
130 0 100 200 300 400 -9 -8 -7 -6 -5 -4 G178R G551D G551S 0 S549N S549R Ivacaftor [Log M] 0 100 200 300 400 0 50 100 150 200 -9 -8 -7 -6 -5 -4 G970R G1244E S1255P G1349D 0 S1251N Ivacaftor [Log M] ChlorideTransport (%NormalCFTR) Normal Forskolin G178R G551S G970R G1244E 50 2 1 min S1255P Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 0 50 100 150 200 * * * * * * * * * * * * * CFTR Mutation ChlorideTransport(µA/cm2)ChlorideTransport(µA/cm2) ChlorideTransport(A/cm2) ChlorideTransport (%NormalCFTR) B G1349D G551D A F508del C S549N S549R S1251N Baseline Baseline present study, cause protein alterations in the ATP binding pockets formed by the two NBDs required for normal CFTR channel gating (Fig. 4) [2]. Login to comment
131 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27]. Login to comment
144 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment
24 Other known CFTR gating mutations include G178R, G551S, G970R, G1244E, S1255P, and G1349D [9-11]. Login to comment
40 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
47 This analysis showed that, as expected for known CFTR gating mutations (G551D, G178R, G551S, G970R, G1244E, S1255P, and G1349D) [5,9-11], the amount of CFTR delivered to the cell surface was generally similar between CFTR with gating defects and normal CFTR. Login to comment
51 Ivacaftor increased the channel gating of mutant CFTR with defective channel gating The effect of ivacaftor on CFTR channel gating was monitored by quantifying the channel open probability by patch-clamp electrophysiology using membrane patches excised from FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, or G1349D-CFTR. Login to comment
59 Ivacaftor enhanced chloride transport through mutant CFTR with defective channel gating The impact of the increase in CFTR channel gating by ivacaftor on total chloride transport was assessed in Ussing chamber studies using FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR. Login to comment
62 Under these conditions, the baseline level of chloride transport in FRT cells expressing G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR was b10% of normal CFTR (Fig. 3; Table 2), which was consistent with the low CFTR channel open probability of these mutant CFTR forms (Table 1). Login to comment
72 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTR mRNA (% Normal CFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTR Maturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations Mature CFTR (% Normal CFTR) A B D C Mature Immature Fig. 1. Login to comment
94 Ivacaftor addition caused a N10-fold increase in CFTR-mediated chloride transport in FRT cells expressing G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR. Login to comment
100 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 &#b5;M Ivacaftor * * * * * * * * * * * CFTR Mutation Channel Open Probability Channel Open Probability (% Normal CFTR) B 1pA 3sec + 10 &#b5;M Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
129 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 bc;M ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57&#b1;0.03 100 0.63&#b1;0.02 111 0.400&#b1;0.04 100 0.800&#b1;0.04 a 200 G551D 0.46&#b1;0.06 81 0.46&#b1;0.03 81 0.019&#b1;0.01 b 5 0.121&#b1;0.035 a 30 G178R 0.59&#b1;0.11 103 0.66&#b1;0.08 116 0.005&#b1;0.001 b 1 0.228&#b1;0.022 a 57 S549N 0.55&#b1;0.02 97 0.61&#b1;0.02 108 0.003&#b1;0.010 b 1 0.396&#b1;0.119 a 99 S549R 0.45&#b1;0.01 b 79 0.55&#b1;0.02 a 96 0.004&#b1;0.010 b 1 0.143&#b1;0.031 a 36 G551S 0.57&#b1;0.13 100 0.64&#b1;0.02 113 0.010&#b1;0.001 b 3 0.337&#b1;0.110 a 84 G970R 0.55&#b1;0.03 96 0.55&#b1;0.03 97 0.001&#b1;0.001 b 0 0.245&#b1;0.042 a 61 G1244E 0.44&#b1;0.11 77 0.54&#b1;0.08 94 0.011&#b1;0.010 b 3 0.470&#b1;0.122 a 118 S1251N 0.54&#b1;0.07 95 0.63&#b1;0.04 111 0.003&#b1;0.010 b 1 0.350&#b1;0.03 a 88 S1255P 0.70&#b1;0.03 b 122 0.71&#b1;0.02 125 0.018&#b1;0.016 b 5 0.468&#b1;0.168 a 117 G1349D 0.49&#b1;0.08 85 0.63&#b1;0.06 111 0.019&#b1;0.015 b 5 0.315&#b1;0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
132 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27]. Login to comment
145 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment

PMID: 19019741 [PubMed] Tang L et al: "Mechanism of direct bicarbonate transport by the CFTR anion channel."

No. Sentence Comment

101 Fig. 5 shows macroscopic currents carried by three of these mutants, two associated with loss of cellular HCO3 - transport and PI disease (G178R, H620Q) and one with retained HCO3 - transport and PS disease (G551 S) [10]. Login to comment
103 It can be seen that each of these mutants is capable of mediating HCO3 - efflux; in fact, reversal potential measurements indicate PHCO3/PCl values of 0.289±0.038 (n=3) for G178R, 0.264±0.035 (n=3) for G551S, and 0.237±0.033 (n=3) for H620Q, none of which were significantly different from the value of 0.250±0.037 (n=4) estimated from wild type under the same conditions (see Fig. 1B). Login to comment
138 Bicarbonate permeability of CF mutant forms of CFTR Example leak-subtracted macroscopic I-V relationships for G178R, G551S, and H620Q-CFTR under the same ionic conditions used in Fig. 1B. Login to comment
146 Our direct measurements of CFTR HCO3 - currents also showed no change in HCO3 - permeability in three CF-associated CFTR mutants (G178R, G551S, H620Q; Fig. 5) that were previously associated with different effects on cellular HCO3 - transport relative to Cl- transport [10]. Login to comment
147 This result suggests that loss of direct HCO3 - permeation through the channel is not responsible for the selective loss of HCO3 - transport relative to Cl- transport previously associated with the severe, PI mutations G178R and H620Q. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment
140 Non-F508del Mutations Found as Homozygous in a Sample of 3,710 Patients With Cystic Fibrosis Mutation n 711+1G>T 8 G542X 7 N1303K 7 2183delAA>G 5 W1282X 4 G551D 3 3905insT 3 R334W 2 R347P 2 1078delT 2 1811+1.6kbA>G 2 2113delA 2 Y1092X 2 R1162X 2 306insA 1 E92K 1 G178R 1 L227R 1 1677delTA 1 1717-1G>A 1 1717-8G>A 1 R553X 1 S549R(T>G) 1 R560S 1 V562I 1 Y569D 1 2711delT 1 S945L 1 R1158X 1 I1234V 1 3849+10kbC>T 1 Q1313X 1 del25kb 1 E831X 1 I175V 1 G314V 1 L1077P 1 produce a small quantity of functional protein as a result of a variable proportion of normal CFTR mRNA transcripts in addition to the abnormal ones (class V); 3) they are located in sites known to generate less severe mutants (external loops, residues lining the pore); and/or 4) they have been observed in CF with pancreatic sufficiency, CBAVD, and/or CF-related attenuated phenotypes only. Login to comment

PMID: 9305991 [PubMed] Seibert FS et al: "Disease-associated mutations in cytoplasmic loops 1 and 2 of cystic fibrosis transmembrane conductance regulator impede processing or opening of the channel."

No. Sentence Comment

3 When properly processed mutants were evaluated for functional defects by the iodide efflux method, the G178R- and E193K-CFTR-expressing cell lines showed impaired anion translocation activities. Login to comment
7 Thus, the N-terminal CLs appear not to contribute to the anion translocation pathway of CFTR; rather, mutations in CL1 can impede transition to the open state. Interestingly, the ability of the non-hydrolyzable ATP analogue adenylyl imidodiphosphate (AMP-PNP) to lock the channel into open bursts was abolished by the I148T and G178R amino acid substitutions. Login to comment
106 However, only the mutations I148T, I175V, G178R, E193K, and R297Q allowed wild-type-like maturation of the protein to the fully glycosylated 170 kDa species (band C). Login to comment
121 The only exceptions to this scheme were the G178R and E193K variants, which both produced activities that were lower than predicted from their wild-type-like maturation profile; in all five experiments analyzed, the decrease was more severe for G178R-CFTR-expressing cells. Login to comment
124 Still, to ensure that the decreased levels of activity of G178R-CFTR- and E193K-CFTR-expressing cells were not the result of a post-ER targeting defect but that the CFTR variants indeed reached their site of action, surface labeling was performed with the membrane-impermeant reagent biotin-LC-hydrazide (4042). Login to comment
128 To further characterize decreases in the anion permeation profile of G178R-CFTR and E193K-CFTR and to observe potentially small changes in the chloride channel activity of the remaining three maturation-competent mutants, the more sensitive patch-clamping method was applied. Login to comment
146 For G178R-CFTR, which had greatly reduced anion translocation capability in the iodide efflux assay, alterations in single-channel kinetics could not be identified by the patch-clamp technique. Login to comment
147 This discrepancy may originate from the additional observation that G178R-CFTR (as well as I148T-CFTR) could not be locked open by the nonhydrolyzable ATP analogue AMP-PNP. Login to comment
149 Thus, the number of channels per patch may have been underestimated for I148T-CFTR- and G178R-CFTR-expressing cells, resulting in a systematic overestimation of the Po. Login to comment
154 Two additional mutations, G178R and E193K, significantly reduced CFTR`s anion translocation capability as observed by iodide efflux assays. Login to comment
171 The finding that the two mutations in CLs 1 and 2 with the most severe effects on the chloride channel activity of CFTR introduce a positive charge into CL1 (G178R and E193K) is consistent with an important role of electrostatic interactions in the normal functioning of the loops. Login to comment
187 Note that some charge changes did allow full maturation, e.g., G178R. Login to comment
203 Mutations in CLs 1 and 3 had drastic effects on the ability of CFTR to respond to regulatory stimuli: E193K in CL1 decreased the opening rate, in agreement with the decreased Po of a CL1 deletion variant (19) and the reduced iodide efflux activity of G178R-CFTR, whereas mutations in CL3 affected the duration of the open state (21). Login to comment
217 Note that the I148T- and G178R-CFTR variants could not be locked open with AMP-PNP, so that for these mutants the number of channels in each patch may have been underestimated. Login to comment

PMID: 8968585 [PubMed] Xie J et al: "Human epithelial cystic fibrosis transmembrane conductance regulator without exon 5 maintains partial chloride channel function in intracellular membranes."

No. Sentence Comment

204 The facts that a splice mutation that deletes exon 5 was found to be a cystic fibrosis disease-causing mutant and that there is an array of cystic fibrosis mutations in the region encoded by exon 5 (L165S, K166E, R170C, 1175V, G178R, D192N, D192G, E193K; Fonknechten et al., 1992; Romey et al., 1994; Zielenski et al., 1991; Audrezet et al., 1994; Mercier et al., 1995; Cystic Fibrosis Mutation Data Base) suggest that exon 5 is important for the structure, function, or both of the CFTR chloride channel. Login to comment
205 The facts that a splice mutation that deletes exon 5 was found to be a cystic fibrosis disease-causing mutant and that there is an array of cystic fibrosis mutations in the region encoded by exon 5 (L165S, K166E, R170C, 1175V, G178R, D192N, D192G, E193K; Fonknechten et al., 1992; Romey et al., 1994; Zielenski et al., 1991; Audrezet et al., 1994; Mercier et al., 1995; Cystic Fibrosis Mutation Data Base) suggest that exon 5 is important for the structure, function, or both of the CFTR chloride channel. Login to comment

PMID: 8889582 [PubMed] Hughes D et al: "Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes."

No. Sentence Comment

74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI. Login to comment

PMID: 8844213 [PubMed] Morral N et al: "Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers."

No. Sentence Comment

105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at. Login to comment

PMID: 7526925 [PubMed] Hull J et al: "Analysis of mutations and alternative splicing patterns in the CFTR gene using mRNA derived from nasal epithelial cells."

No. Sentence Comment

16 We have detected 14 sequence changes in the CFTR gene using this technique, including 4 (G178R (8), 2184delA (Bozon, pes comm. Login to comment
31 These sequence changes included 2 mutations, G178R (8) and 2184delA (Bozon, pes comm. Login to comment

PMID: 1379210 [PubMed] Fanen P et al: "Molecular characterization of cystic fibrosis: 16 novel mutations identified by analysis of the whole cystic fibrosis conductance transmembrane regulator (CFTR) coding regions and splice site junctions."

No. Sentence Comment

89 Analysis of the Remaining Exons Other mutations or candidate mutations were detected outside the regions cited above and included D44G, 241delAT (exon 2) (Fig. l), G178R, 711 + 1 G-T (exon 5), W1063X, R1066C, Y1092X (exon 17b) (Fig. 2), and 4374 + 1 G-A (intron 23). Login to comment

PMID: 11448786 [PubMed] Wine JJ et al: "Cystic fibrosis: the 'bicarbonate before chloride' hypothesis."

No. Sentence Comment

52 Ion transport (% WT) 42 41 69 75 >100 >100 98 + 103 100 + + 120 Pancreatic sufficient Pancreatic insufficient Bicarbonate Chloride - intermediate Chloride - high Unknown WT D648V R117H R1070Q H949Y G551S H620Q I148T A1067T G178R G970R S1255P G1244E G551D G1349D 0 0.5 1 1.5 2 2.5 Current Biology ࢞F508 Dispatch R absence of the vas deferens [16]. Login to comment
76 Critical information was provided by Thilo D&#f6;rk (H620Q); R. Moss (R117H & G551D homozygotes); David Kessler, Theresa Grebe and Elizabeth Perkett (D648V); Monica Brooks and contributors to the Cystic Fibrosis Foundation Registry (G178R and G1244E); Aleksey Savov and Luba Kalaydjieva (R1070Q); and Christiane De Boeck and Harry Cuppens (G970R). Login to comment

PMID: 16963320 [PubMed] Perez MM et al: "CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent."

No. Sentence Comment

78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT. Login to comment

PMID: 23199563 [PubMed] Leonard A et al: "[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky]."

No. Sentence Comment

178 De re &#b4;centes donne &#b4;es in vitro sugge `rent que cette me &#b4;dication soit e &#b4;galement efficace sur 9 autres mutations de la me c6;me classe (G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, G1349D) [50,51]. Login to comment

PMID: 23891399 [PubMed] Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."

No. Sentence Comment

28 These include the most common CFTR gating mutation, G551D, as well as the G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D mutations [12]. Login to comment

PMID: 24030637 [PubMed] Deeks ED et al: "Ivacaftor: a review of its use in patients with cystic fibrosis."

No. Sentence Comment

35 For example, in rodent cells expressing G551D/S, G178R, S549N/R, G970R, G1244E, S1251N, S1255P or G1349D CFTR, ivacaftor increased channel open probability from B5 % of normal at baseline to 30-118 % of normal and increased chloride transport C16- fold (EC50 124-594 nmol/L). Login to comment

PMID: 24357848 [PubMed] Zvereff VV et al: "Cystic fibrosis carrier screening in a North American population."

No. Sentence Comment

80 The Table 3ߒ Frequency of 5T/7T/9T genotypes as a result of R117H reflex testing Poly-T alleles Number of detected alleles (%) CF32 panel CF69 panel 5T/5T 23 (0.44) 2 (0.73) 5T/7T 430 (8.27) 26 (9.49) 5T/9T 38 (0.73) 1 (0.37) 7T/7T 4,103 (78.93) 219 (79.92) 7T/9T 604 (11.61) 26 (9.49) 9T/9T 1 (0.02) 0 Total 5,198 (100) 274 (100) 394delTTd c.262_263delTT 3 0.10 G178Rd p.G178R 3 0.10 V520Fd p.V520F 3 0.10 2143delTd c.2012delT 2 0.06 935delAe c.803delA 2 0.06 A455Eb p.A455E 2 0.06 Q890Xd p.Q890X 2 0.06 S549Rd p.S549R 2 0.06 2869insGd c.2737insG 1 0.03 405ߙ+ߙ3A>Ce c.273ߙ+ߙ3A>C 1 0.03 G480Ce p.G480C 1 0.03 M1101Kd p.M1101K 1 0.03 Y122Xd p.Y122X 1 0.03 Total 3,088 100 a 1898ߙ+ߙ5G>Te , 444delA, G330X, S364Pe , K710X, and S1196X mutations were not detected in the target population. Login to comment

PMID: 24440181 [PubMed] De Boeck K et al: "The relative frequency of CFTR mutation classes in European patients with cystic fibrosis."

No. Sentence Comment

56 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations Large deletions and insertions 1078delT; 1717-1G࢐A; 3659delC; 621+1G࢐T Class II Defective protein processing G85E, F508del, I507del, R560T, N1303K Class III Defective protein regulation ('gating`) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R117H, R334W, R347P Class V Reduced amount of functioning protein 2789+5G࢐A, 3849+10KbC࢐T, A455E Unclassified All other mutations, including those unknown. Login to comment

PMID: 24517344 [PubMed] Raju SV et al: "Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis."

No. Sentence Comment

81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

PMID: 24727426 [PubMed] Wang Y et al: "Understanding how cystic fibrosis mutations disrupt CFTR function: from single molecules to animal models."

No. Sentence Comment

2023 Interestingly, the authors demonstrated that G178R and H620Q, two CF-PI mutations that disrupt cellular HCO3 - transport, were without effect on CFTR-mediated HCO3 - transport, arguing that CF mutations influence HCO3 --transport indirectly. Login to comment

PMID: 24832698 [PubMed] Balfour-Lynn IM et al: "Personalised medicine in cystic fibrosis is unaffordable."

No. Sentence Comment

37 It is currently licensed for use only in those with the p.Gly551Asp mutation; but a further license has been recently approved in the USA for use in other rarer gating mutations (G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, or G1349D). Login to comment

PMID: 24932877 [PubMed] Bell SC et al: "New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls."

No. Sentence Comment

547 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations: G542X, R1162X, RW1282X Deletions and insertions: CFTRdele2,3; 1078delT; 1717-1G ࢐ A; 3659delC; 621+1G N T Class II Defective protein processing G85E, F508del, I507del, R560T, A561E, R1066C, N1303K Class III Defective protein regulation (gating) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R334W, R347P, R117H Class V Reduced amount of functioning protein 2789+5G ࢐ A, 3272-26ANG, 3849+10KbC ࢐ T, A455E Class VI Reduced cell surface stability Rescued F508del, c.120del23 Unclassified All other mutations, including those unknown a F508del-CFTR pocket (at NBD1:ICL4 interface) (Farinha et al., 2013). Login to comment

PMID: 25033378 [PubMed] LaRusch J et al: "Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis."

No. Sentence Comment

269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

PMID: 25083129 [PubMed] Pettit RS et al: "CFTR Modulators for the Treatment of Cystic Fibrosis."

No. Sentence Comment

36 At 48 weeks, 67% of patients in the ivacaftor group had not had a pulmonary exacerbation compared with 41% in the Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Ramsey(2011)30 STRIVE: Randomized, double-blind, placebo-controlled G551D Age 12-53 years N = 161 FEV1 40-90% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Percent change in FEV1 from baseline to 24 wks (P < 0.001): IVA, 10.4%; PBO, -0.2% ߦ Percent change in FEV1 from baseline to 48 wks compared with PBO (P < 0.001): IVA, 10.5% ߦ Percent of patients pulmonary exacerbation-free at 48 wks: IVA, 67%; PBO, 41% ߦ Change in body weight from baseline to 48 wks: IVA, 3.1 kg; PBO, 0.4 kg ߦ Sweat chloride change from baseline to 48 wks compared with PBO (P < 0.001): IVA, -48.1 mmol/L ߦ Change in CFQ-R respiratory domain from baseline to 48 wks (P < 0.001): IVA, 5.9 pts; PBO, -2.7 pts Davies (2013)29 ENVISION: Randomized, double-blind, placebo-controlled G551D Age 6-11 years N = 52 FEV1 40-105% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Absolute change in FEV1 percentage from baseline at 48 wks compared with PBO (P < 0.001): IVA, 10% ߦ Absolute change in FEV1 percentage from baseline at 24 wks (P < 0.001): IVA, 12.6%; PBO, 0.1% ߦ Mean change in sweat chloride from baseline to 48 wks compared with PBO (P < 0.001): IVA, -54.3 mmol/L ߦ Body weight change from baseline to 48 wks compared with PBO (P < 0.001): IVA, 2.8 kg ߦ Absolute CFQ-R change from baseline to 24 wks compared with PBO (P = 0.109): IVA, 6.1 pts McKone (2013)31 PERSIST: Open-label extension G551D Age ࣙ 6 years Patients had completed 48 wks of either ENVISION or STRIVE IVA 150 mg b.i.d. 96 wks (patients received 96 wks or 144 wks of IVA depending on ENVISION or STRIVE randomization) ߦ Absolute change in percent predicted FEV1: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 9.4 &#b1; 8.3 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 9.4 &#b1; 10.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -1.2 &#b1; 7.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.5 &#b1; 11.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 10.2 &#b1; 15.7 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.3 &#b1; 12.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: -0.6 &#b1; 10.1 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.5 &#b1; 11.5 ߦ Absolute change in weight (kg): &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 3.4 &#b1; 4.9 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 4.1 &#b1; 7.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: 0.3 &#b1; 2.2 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 3 &#b1; 4.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.1 &#b1; 2.9 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 14.8 &#b1; 5.7 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 2.9 &#b1; 1.8 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.1 &#b1; 4.1 ߦ Absolute change in CFQ-R respiratory domain: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.4 &#b1; 16.8 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 6.8 &#b1; 19.6 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -3.6 &#b1; 14.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.8 &#b1; 16.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 7.4 &#b1; 17.4 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.6 &#b1; 18.9 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 0.8 &#b1; 18.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.8 &#b1; 12.8 CFTR Modulators for the Treatment of Cystic Fibrosis Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Davies (2013)32 Placebo-controlled, double-blind, crossover study G551D Age > 6 years N = 17 FEV1 > 90% LCI > 7.4 Sequence 1: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. Sequence 2: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO 28-day treatment and WO periods ߦ Average change in LCI from baseline compared with PBO (P < 0.0001): IVA, -2.16 (95% CI, -2.88 to -1.44) ߦ Average change in FEV1 from baseline compared with PBO (P = 0.0103): IVA, 8.67 (95% CI, 2.36 to 14.97) ߦ Average change in FEF25-75 from baseline compared with PBO (P = 0.0237): IVA, 16.56 (95% CI, 2.30 to 27.71) Barry (2013)34 Retrospective review G551D Age 20-31 in IVA group N = 21 FEV1 < 40% IVA 150 mg b.i.d. (n = 21); matched controls (n = 35) Median duration, 237 days ߦ Absolute FEV1 change from baseline (P = 0.0075): IVA, 0.125 L; CON, 0.01 L ߦ Percent predicted FEV1 change from baseline (P = 0.0092): IVA, 12.7%, CON, 2.2% ߦ Median weight increase from baseline: IVA, 1.8 kg; CON, 0.1 kg ߦ Median inpatient days per year decreased from 23 days to 0 days in the IVA group (P = 0.001) ߦ Median total intravenous antibiotic days per year decreased from 74 days to 38 days in the IVA group (P = 0.002) De Boeck (2013)37 KONNECTION: Randomized, double-blind, crossover, placebo-controlled Non-G551D gating mutations G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, G1349D Age ࣙ 6 years N = 39 FEV1 ࣙ 40% Treatment sequence 1: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO ࢐ open-label Treatment sequence 2: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. ࢐ open-label 8 wks of IVA or PBO; 4-8 wks WO period; 16 wks open label ߦ Absolute change from baseline percent predicted FEV1 (P < 0.0001): IVA, 7.49%; PBO, -3.19% ߦ Absolute change from baseline BMI (P < 0.0001): IVA, 0.68; PBO, 0.02 ߦ Absolute change from baseline in CFQ-R respiratory domain (P = 0.0004): IVA, 8.94 pts; PBO, -0.67 pts ߦ Absolute change from baseline in sweat chloride (mmol/L): IVA, -52.28; PBO, -3.11 Flume (2011)35 Randomized, double-blind, placebo-controlled, parallel group with open-label extension Homozygous F508del Age ࣙ 12 years Part 1: N = 140 Part 2: N = 33 42 patients were eligible for part 2 if change in FEV1 ࣙ 10% or sweat chloride decreased by at least 15 mmol/L at day 15 and week 8 Part 1: IVA 150 mg b.i.d. or PBO 16 wks Part 2: Open label IVA 150 mg b.i.d. Login to comment
56 These promising results led to an FDA label expansion to include CF patients with the following eight mutations in addition to G551D: G178R, S549R, S549N, G551S, G1244E, S1251N, S1255P, and G1349D.38 Clinical Considerations Ivacaftor was well tolerated in clinical trials. Login to comment

PMID: 25088968 [PubMed] Chen JH et al: "A cocktail drug therapy for patients with cystic fibrosis?"

No. Sentence Comment

6 More recently, VX-770 has been approved by the FDA (NDA 203188, www.fda.gov) and recommended by the EMA (EMA/CHMP/365663/2014) for use with an additional eight CF gating (class III) mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D), although, including G551D, these mutations still just occur in ~5% of CF patients worldwide. Login to comment

PMID: 25287046 [PubMed] Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."

No. Sentence Comment

355 Second, CF-causing mutations in the ICLs involve residues located at the base of the four-helix bundle assembling the four internal ICL helices (symmetric positions in ICL1 (G178E G178R) and ICL3 (G970R), which cannot be substituted by any other amino acid because of steric hindrance reasons (Fig. 7c; Online Resource 2). Login to comment

PMID: 25304080 [PubMed] Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."

No. Sentence Comment

59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

PMID: 25674778 [PubMed] Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."

No. Sentence Comment

15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

PMID: 25867140 [PubMed] Eckford PD et al: "Functional reconstitution and channel activity measurements of purified wildtype and mutant CFTR protein."

No. Sentence Comment

30 While the correctors VX-809 and VX-661 (are not yet approved for use in patients, the potentiator Kalydeco (ivacaftor; VX-770) is being used at 150 mg every 12 hr in CF patients >6 years with at least one G551D-CFTR mutation, and more recently for patients with one of G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D. Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment

PMID: 25940043 [PubMed] Corvol H et al: "Translating the genetics of cystic fibrosis to personalized medicine."

No. Sentence Comment

155 Furthermore, Kalydeco has been tested in patients carrying other class III mutations, or targeted class IVand V mutations (sharing functional similarities with the class III).58 The new trials led to an extension of the FDA and European Medical Agency approval to 8 additional gating mutations: p.Gly178Arg (p.G178R), p.Ser549Asn (p.S549N), p.Ser549Arg (p.S549R), p.Gly551Ser (p.G551S), p.Gly1244Glu (p.G1244E), p.Ser1251Asn (p.S1251N), p.Ser1255Pro (pS1255P), and p.Gly1349Asp (p.G1349D).59 Recently, ivacaftor has also been shown to benefit patients carrying the c.350G . Login to comment

PMID: 26021452 [PubMed] Corvol H et al: "[Challenges of personalized medicine for cystic fibrosis]."

No. Sentence Comment

135 Compte tenu de l`efficacite &#b4; de KalydecoW chez ces patients, le laboratoire VertexW a ensuite teste &#b4;, puis de &#b4;montre &#b4; son efficacite &#b4; chez des patients porteurs d`autres mutations de classe III, ce qui a permis cette anne &#b4;e une extension d`autorisation de mise sur le marche &#b4; (AMM) pour 8 mutations supple &#b4;mentaires : G1244E, G1349D, G178R, G551S, S1251N, S1255P, S549N et S549R [37]. Login to comment

PMID: 26087176 [PubMed] Dupuis A et al: "Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene."

No. Sentence Comment

76 Using the US and Italian data, we calculated equally low MIP scores for G178R (0.09, n = 22), S549N (0.12, n = 39), S1251N (0.07, n = 14), and G1244E (0.0, n = 3), but not for S549R (0.21, n = 14) (Supplementary Table S1 online). Login to comment
105 MIP scores were significantly different between the mutations F508del and G551D, which is in agreement with early studies of smaller numbers of patients with CF that reported a lower MI incidence in patients carrying F508del/G551D when compared with patients with CF with F508del/ F508del.28,29 We demonstrated equally low MIP scores for other class III CFTR mutations (G178R, S549N, G1244E, S1251N), further supporting the idea that class III CFTR mutations are not as severe as F508del, at least with respect to gastrointestinal development. Login to comment

PMID: 26115565 [PubMed] Mall MA et al: "Targeting ion channels in cystic fibrosis."

No. Sentence Comment

604 When tested in clinical trials, the potentiator ivacaftor (also known as VX-770) showed a marked clinical benefit, with substantial improvement of lung function, reduction of pulmonary exacerbations, and increase in body weight in CF patients with G551D and 8 additional Class III mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D) [32-35]. Login to comment

PMID: 26168933 [PubMed] Grasemann H et al: "Effect of ivacaftor therapy on exhaled nitric oxide in patients with cystic fibrosis."

No. Sentence Comment

59 Total (n = 15) Adult (n = 8) Pediatric (n = 7) Age (years), mean &#b1; SD 23.3 &#b1; 16.2 36.3 &#b1; 14.6 10.7 &#b1; 3.8 Female/male 9/6 5/3 4/3 CFTR genotypes G551D/F508del 10 4 6 G551D/not found 2 2 - G551D/2622+1GNA 1 - 1 G551D/E585X 1 1 - G178R/F508del 1 1 - CFTR, cystic fibrosis conductance regulator; SD, standard deviation. Login to comment

PMID: 26210165 [PubMed] Kotha K et al: "Concentration of fractional excretion of nitric oxide (FENO): A potential airway biomarker of restored CFTR function."

No. Sentence Comment

53 Patients enrolled in Cohort 2 (Fig. 1B) included five CF patients with rare CFTR gating mutations (S549N/S549N in three subjects, G178R/F508del in one subject, and S549R/ F508del in one subject) who were candidates for ivacaftor therapy. Login to comment
154 Genotypes of the five individual subjects were S549N/S549N (CF01-03), S549R/F508del (CF04), and G178R/F508del (CF05). Login to comment

PMID: 26500004 [PubMed] Pepermans X et al: "Identification and frequencies of cystic fibrosis mutations in central Argentina."

No. Sentence Comment

99 rs name HGVS p. name HGVS c. name Legacy name n (%) Screening panel CFTR1 database CFTR2 database rs199826652 p.Phe508del c.1521_1523delCTT F508del 94 (56.6) Yes Yes CF-causing rs113993959 p.Gly542* c.1624G N T G542X 7 (4.2) Yes Yes CF-causing No p.Asn1303Lys c.3909C N G N1303K 5 (3) Yes Yes CF-causing rs74767530 p.Arg1162* c.3484C N T R1162X 4 (2.4) Yes Yes CF-causing rs75961395 p.Gly85Glu c.254G N A G85E 3 (1.8) Yes Yes CF-causing rs78756941 NA c.489 + 1G N T 621 + 1G N T 3 (1.8) Yes Yes CF-causing rs76713772 NA c.1585-1G N A 1717-1G N A 3 (1.8) Yes Yes CF-causing No p.Lys684Serfs*38 c.2051_2052delAAinsG 2183AA N G 3 (1.8) Yes Yes CF-causing rs397508173 p.Ser4* c.11C N A S4X 2 (1.2) No Yes No rs121909011 p.Arg334Trp c.1000C N T R334W 2 (1.2) Yes Yes CF-causing rs77010898 p.Trp1282* c.3846G N A W1282X 2 (1.2) Yes Yes CF-causing rs397508141 p.Leu34_Gln39del c.100_117delTTGTCAGACATATACCAA 232del18 1 (0.6) No Yes No No p.Leu49Pro c.146 T N C L49P &#a7; 1 (0.6) No No No rs77834169 p.Arg117Cys c.349C N T R117C 1 (0.6) Yes Yes CF-causing No p.Arg117Pro c.350G N C R117P 1 (0.6) No Yes No rs80282562 p.Gly178Arg c.532G N A G178R 1 (0.6) Yes Yes CF-causing rs121908803 p.Pro205Ser c.613C N T P205S 1 (0.6) No Yes CF-causing rs121908752 p.Leu206Trp c.617 T N G L206W 1 (0.6) Yes Yes CF-causing No p.Arg347Pro c.1040G N C R347P 1 (0.6) Yes Yes CF-causing rs397508155 p.Tyr362* c.1086 T N A Y362X 1 (0.6) No Yes No rs74597325 p.Arg553* c.1657C N T R553X 1 (0.6) Yes Yes CF-causing rs1800098 + rs1800100 p.[Gly576Ala(;)Arg668Cys] c. Login to comment
126 Genotype N Frequency (%) Total N Total frequency (%) Category I: p.Phe508del/p.Phe508del p.Phe508del/p.Phe508del 30 36.1 30 36.1 Category II: p.Phe508del/Other p.Phe508del/p.Gly542* 5 6 p.Phe508del/p.Asn1303Lys 3 3.6 p.Phe508del/p.Gly85Glu 2 2.4 p.Phe508del/c.1585-1G N A 2 2.4 p.Phe508del/c.2051_2052delAAinsG 2 2.4 p.Phe508del/p.Trp1282* 2 2.4 p.Phe508del/p.Arg117Pro 1 1.2 p.Phe508del/p.Pro205Ser 1 1.2 p.Phe508del/p.Leu206Trp 1 1.2 p.Phe508del/p.Arg553* 1 1.2 p.Phe508del/p.Ser589Ile 1 1.2 p.Phe508del/p.Ser737Phe 1 1.2 p.Phe508del/p.Arg1162* 1 1.2 p.Phe508del/c.1766 + 1G N A 1 1.2 p.Phe508del/p.Leu34_Gln39del 1 1.2 p.Phe508del/p.Leu812Phefs*11 1 1.2 p.Phe508del/c.3140-26A N G 1 1.2 p.Phe508del/c.3873 + 1G N A 1 1.2 p.Phe508del/p.Ser1297Phefs*5 1 1.2 p.Phe508del/c.4242_4242 + 1delGGinsTT 1 1.2 p.Phe508del/c.489 + 1G N T 1 1.2 31 37.5 Category III: Other/other p.Gly542*/p.Asn1303Lys 1 1.2 p.Asn1303Lys/p.Gly85Glu 1 1.2 c.489 + 1G N T/p.Lys684Serfs*38 1 1.2 c.489 + 1G N T/p.Gly542* 1 1.2 p.Arg1162*/p.Ser4* 1 1.2 p.Arg1162*/p.Tyr362* 1 1.2 p.Arg334Trp/c.1585-1G N A 1 1.2 p.Arg334Trp/p.Ser821Argfs*4 1 1.2 p.Arg347Pro/p.Ser4* 1 1.2 c.2657 + 5G N A/p.Tyr852Leufs*44 # 1 1.2 p.Arg1162*/p.Leu49Pro # 1 1.2 11 13.2 Category IV: A single mutation p.Phe508del/WT 3 3.6 c.2988 + 1G N A/WT 1 1.2 p.Arg117Cys/WT 1 1.2 p.Gly178Arg/WT 1 1.2 p.[Gly576Ala(;)Arg668Cys]/TG11-5T 1 1.2 7 8.4 Category V: Wild type 4 4.8 #: new mutation submitted to CFTR1 database [1]; other = other mutation than p.Phe508del. Login to comment

PMID: 26526359 [PubMed] Amaral MD et al: "Hallmarks of therapeutic management of the cystic fibrosis functional landscape."

No. Sentence Comment

656 The FDA approval of Ivacaftor for multiple G551D like phenotypic variants including G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D [159,160] found at the cell surface with gating defects [161,162], and the FDA-approval of a combination of Lumacaftor and Ivacaftor for treatment of F508del [156] are examples of successful application of these technologies. Login to comment