ABCG2 p.Ile206Leu

[switch to full view]
Comments [show]
Publications
PMID: 12544509 [PubMed] Zamber CP et al: "Natural allelic variants of breast cancer resistance protein (BCRP) and their relationship to BCRP expression in human intestine."
No. Sentence Comment
4 Of the missense mutations, exon 2 SNP (G34A) resulted in a V12M change; exon 5 SNP (C421A) resulted in a Q141K substitution; exon 6 SNP (A616C) resulted in an I206L amino acid substitution; and exon 15 SNP (A1768T) resulted in a N590Y change in the BCRP protein.
X
ABCG2 p.Ile206Leu 12544509:4:159
status: VERIFIED
Login to comment

98 Exon 6 An A.C transversion results in an Ile206 Leu change (Fig. 1).
X
ABCG2 p.Ile206Leu 12544509:98:41
status: VERIFIED
Login to comment

119 Table 1 Frequencies of BCRP alleles in different ethnic groups Position in gene AC084732Ã Position in mRNA XM_032424Ã Sequence Region Caucasians African-Americans Japanese (n ¼ 20) Chinese (n ¼ 20) SE Asians (not Chinese or Japanese) (n ¼ 20) Pacific Islanders (n ¼ 14) À18398 À29 gctct(A/G)ttaag Exon 1 0.02 (1.5%)a 0 (0%)e ND ND ND ND 34 34 tccca(G/A)tgtca Exon 2 (V12M) 0.02 (4.7%)b 0.04 (8.3%)f 0.15 (30%) 0.20 (40%) 0.45 (70%) 0.64 (85.7%) 114 114 ttaag(T/C)tttca Exon 2 0.01 (1.2%)b 0 (0%)f 0 (0%) 0 (0%) 0 (0%) 0 (0%) 239 tttta (A/G)tttac Intron 2 0.03 (5.9%)c 0.05 (9.5%)g 0.15 (30%) 0.20 (40%) 0.45 (70%) 0.64 (85.7%) 8184 369 ggtta(C/T)gtggt Exon 4 0 (0%)a 0.07 (13.3%)e ND ND ND ND 8825 421 actta(C/A)agttc Exon 5 (Q141K) 0.14 (25.9%)d 0 (8%)f 0.35 (50%) 0.35 (60%) 0.15 (20%) 0.14 (28.6%) 18186 attat(A/G)atatt Intron 5 0 (0%)c 0 (8%)g 0 (0%) 0.05 (10%) 0 (0%) 0 (0%) 18286 616 cttcc(A/C)tcttg Exon 6 (I206L) 0 (0%)a 0 (8%)e 0 (0%) 0 (0%) 0 (0%) 0 (0%) 45073 1768 gacaa(A/T)acttc Exon 15 (N590Y) 0.01 (1.5%)a 0 (8%)e ND ND ND ND Position in gene AC084732Ã Position in mRNA XM_032424Ã Sequence Region Mexican-Indians (n ¼ 10) Mexicans (n ¼ 20) Hispanic Livers (n ¼ 10) Middle Eastern (n ¼ 40) Ashkenazi Jewish (n ¼ 20) Africans North of Sahara (n ¼ 14) À18398 À29 gctct(A/G)ttaag Exon 1 ND ND ND ND ND ND 34 34 tccca(G/A)tgtca Exon 2 (V12M) 0.90 (100%) 0.10 (20%) 0.40 (60%) 0.05 (10%) 0.10 (20%) 0.14 (14.3%) 114 114 ttaag(T/C)tttca Exon 2 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 239 tttta(A/G)tttac Intron 2 0.90 (100%) 0.10 (20%) 0.40 (60%) 0.05 (10%) 0.10 (20%) 0.14 (14.3%) 8184 369 ggtta(C/T)gtggt Exon 4 ND ND ND ND ND ND 8825 421 actta(C/A)agttc Exon 5 (Q141K) 0.10 (20%) 0.05 (10%) 0.10 (20%) 0.13 (25%) 0.05 (10%) 0 (0%) 18186 attat(A/G)atatt Intron 5 0 (0%) 0.10 (20%) 0 (0%) 0 (0%) 0.05 (10%) 0.07 (14.3%) 18286 616 cttcc(A/C)tcttg Exon 6 (I206L) 0 (0%) 0 (0%) 0.10 (20%) 0 (0%) 0 (0%) 0 (0%) 45073 1768 gacaa(A/T)acttc Exon 15 (N590Y) ND ND ND ND ND ND Data reported as: allele frequency (% individuals with at least one variant allele).
X
ABCG2 p.Ile206Leu 12544509:119:954
status: VERIFIED
X
ABCG2 p.Ile206Leu 12544509:119:1955
status: VERIFIED
Login to comment

125 Unauthorized reproduction of this article is prohibited. G34A V12M Exon 2 C71T1 A24V Exon 2 623C1 F208S Exon 6 A616C I206L Exon 6 C496G1 Q166E Exon 5 C421A Q141K Exon 5 A1444G2 R482G Exon 12 G1445C3 R482T Exon 12 A1768T N590Y Exon 15 Walker A motif: amino acids 80-89 Walker B motif: amino acids 206-210 SNPs found in human samples in this study Reported in ABCP1 Drug selected variants, MXR2 and BCRP3 MXR BCRP Fig. 1 BCRP protein topology and the positions of the identified SNPs resulting in missense mutations.
X
ABCG2 p.Ile206Leu 12544509:125:117
status: VERIFIED
Login to comment

PMID: 14576842 [PubMed] Doyle LA et al: "Multidrug resistance mediated by the breast cancer resistance protein BCRP (ABCG2)."
No. Sentence Comment
127 Allelic variation as a result of SNPs results in alterations of the BCRP protein at amino acids 12 (V12M), 141 (Q141K), 206 (I206L), and 590 (N590Y), with the most frequent polymorphisms being the exon 2 SNP (G34A) and the exon 5 SNP (C421A), which produce changes in amino acids 12 and 141 (Honjo et al., 2002; Imai et al., 2002a; Zamber et al., 2003).
X
ABCG2 p.Ile206Leu 14576842:127:125
status: VERIFIED
Login to comment

PMID: 15618737 [PubMed] Itoda M et al: "Eight novel single nucleotide polymorphisms in ABCG2/BCRP in Japanese cancer patients administered irinotacan."
No. Sentence Comment
46 Information on ABCG2WBCRP single nucleotide polymorphisms (SNPs) has been published.8-10) Five naturally occurring nonsynonymous SNPs have been reported in Japanese and Caucasians: V12M, Q126Stop, Q141K, I206L, and N590Y.8-10) SNP Q126Stop was found in 3 out of 124 healthy Japanese subjects.9) Since it may be possible that ABCG2WBCRP polymorphisms are associated with the eŠectiveness and adverse eŠects of irinotecan, ABCG2WBCRP exons and their ‰anking regions were sequenced to identify Japanese speciˆc SNPs.
X
ABCG2 p.Ile206Leu 15618737:46:204
status: VERIFIED
Login to comment

PMID: 15743976 [PubMed] Vethanayagam RR et al: "Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N."
No. Sentence Comment
1 In this study, the effects of the I206L, N590Y, and D620N variants on protein expression, plasma membrane localization, and transport activity of BCRP were investigated.
X
ABCG2 p.Ile206Leu 15743976:1:34
status: VERIFIED
Login to comment

4 The expression level of I206L in the plasma membrane was approximately 45% of that of wild-type protein, whereas the N590Y and D620N levels were increased approximately 3.6-fold and 2.4-fold, respectively, as determined by immunoblotting. All three variants transported mitoxantrone, pheophorbide a, and BODIPY FL-prazosin.
X
ABCG2 p.Ile206Leu 15743976:4:24
status: VERIFIED
Login to comment

5 After normalization for differences in BCRP expression, I206L, N590Y, and D620N exhibited approximately 2-fold, 0.3-fold, and 0.5-fold wild-type efflux activities, respectively.
X
ABCG2 p.Ile206Leu 15743976:5:56
status: VERIFIED
Login to comment

7 Mitoxantrone and topotecan resistance by I206L and N590Y was approximately 2-fold and 0.3-fold of the wild-type BCRP resistance levels, respectively.
X
ABCG2 p.Ile206Leu 15743976:7:41
status: VERIFIED
Login to comment

9 After normalization to BCRP expression levels, ATPase activities of I206L were not significantly different from those of wild-type protein, whereas N590Y and D620N exhibited approximately 30% and 50% of wild-type ATPase activities, respectively.
X
ABCG2 p.Ile206Leu 15743976:9:68
status: VERIFIED
Login to comment

10 These results suggest that I206L has the lowest protein expression and the highest activity, whereas N590Y and D620N display higher expression and lower activity, relative to wild-type BCRP.
X
ABCG2 p.Ile206Leu 15743976:10:27
status: VERIFIED
Login to comment

21 Other variants such as I206L, N590Y, and D620N are generally much less frequent, with allele frequencies of approximately 1% or less (Honjo et al., 2002; Zamber et al., 2003).
X
ABCG2 p.Ile206Leu 15743976:21:23
status: VERIFIED
Login to comment

29 Functional analysis of the I206L, N590Y, and D620N variants of BCRP has not been reported so far.
X
ABCG2 p.Ile206Leu 15743976:29:27
status: VERIFIED
Login to comment

30 In the present study, we stably expressed wild-type BCRP and the variants I206L, N590Y, and D620N in HEK cells and analyzed the effects of the variants on BCRP expression, plasma membrane localization, transport, and ATPase activities, as well as drug resistance characteristics.
X
ABCG2 p.Ile206Leu 15743976:30:74
status: VERIFIED
Login to comment

45 The variants I206L, N590Y, and D620N were then generated using the QuickChange Site-directed Mutagenesis Kit (Stratagene) and the pBluescript SK(ϩ) plasmid carrying wild-type BCRP cDNA as a template, according to the manufacturer`s instructions.
X
ABCG2 p.Ile206Leu 15743976:45:13
status: VERIFIED
Login to comment

47 The primer pairs for I206L were 5Ј-CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG-3Ј and 5ЈCTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG-3Ј; the primer pairs for N590Y were 5Ј-GA- ATTTTTGGGACAATACTTCTGCCCAGGACTC-3Ј and 5Ј-GAGTCCT- GGGCAGAAGTATTGTCCCAAAAATTC-3Ј; and the primer pairs for D620N were 5Ј-GTAAAGCAGGGCATCAATCTCTCACCCTGGGGC-3Ј and 5Ј-GCCCCAGGGTGAGAGATTGATGCCCTGCTTTAC-3Ј.
X
ABCG2 p.Ile206Leu 15743976:47:21
status: VERIFIED
Login to comment

128 Results Stable Expression of Wild-Type BCRP and the I206L, N590Y, and D620N Variants in HEK Cells.
X
ABCG2 p.Ile206Leu 15743976:128:52
status: VERIFIED
Login to comment

129 To examine the effects of I206L, N590Y, and D620N on protein expression, plasma membrane localization, and function of BCRP, we generated the three variants by site-directed mutagenesis.
X
ABCG2 p.Ile206Leu 15743976:129:26
status: VERIFIED
Login to comment

133 Figure 1A shows a typical immunoblot of whole cell lysates prepared from various cell lines (482R-13, 482R-21, I206L-13, I206L-20, N590Y-1, N590Y-13, D620N-9, and D620N-10) that express the highest levels of BCRP.
X
ABCG2 p.Ile206Leu 15743976:133:111
status: VERIFIED
X
ABCG2 p.Ile206Leu 15743976:133:121
status: VERIFIED
Login to comment

134 The cell lines 482R-21, I206L-13, N590Y-1, and D620N-9 were used in all subsequent experiments.
X
ABCG2 p.Ile206Leu 15743976:134:24
status: VERIFIED
Login to comment

136 Expression levels of wild-type BCRP and its variants I206L, N590Y, and D620N in stably transfected HEK cells.
X
ABCG2 p.Ile206Leu 15743976:136:53
status: VERIFIED
Login to comment

143 A typical immunoblot of the plasma membrane preparations showed that I206L, N590Y, and D620N were expressed at levels of approximately 0.45-fold, 3.6-fold, and 2.4-fold those of the wild-type protein (482R), respectively (Fig. 1B).
X
ABCG2 p.Ile206Leu 15743976:143:69
status: VERIFIED
Login to comment

148 The I206L, N590Y, and D620N Variants Were Predominantly Routed to the Plasma Membrane.
X
ABCG2 p.Ile206Leu 15743976:148:4
status: VERIFIED
Login to comment

149 To explore whether the variants might influence plasma membrane localization of BCRP, the 482R-21, I206L-13, N590Y-1, and D620N-9 cells were examined by immunofluorescent confocal microscopy.
X
ABCG2 p.Ile206Leu 15743976:149:99
status: VERIFIED
Login to comment

150 Cells transfected with cDNAs of wild-type BCRP (482R-21) and the three variants (I206L-13, N590Y-1, and D620N-9) showed strong plasma membrane staining (Fig. 2), suggesting that, similar to wild-type BCRP, all three variants were predominantly routed to the plasma membrane.
X
ABCG2 p.Ile206Leu 15743976:150:81
status: VERIFIED
Login to comment

153 To further confirm cell surface expression of the variants, the 482R, I206L, N590Y, and D620N cells were incubated with the phycoerythrin-labeled anti-BCRP surface mAb 5D3 and the IgG negative control.
X
ABCG2 p.Ile206Leu 15743976:153:70
status: VERIFIED
Login to comment

158 The relative levels of I206L, N590Y, and D620N on the cell surface were calculated from three independent experiments to be approximately 0.79-fold, 3.1-fold, and 1.3-fold those of wild-type BCRP, respectively.
X
ABCG2 p.Ile206Leu 15743976:158:23
status: VERIFIED
Login to comment

168 Selected areas of HEK cells expressing wild-type BCRP (482R) and the variants I206L, N590Y, and D620N are shown.
X
ABCG2 p.Ile206Leu 15743976:168:78
status: VERIFIED
Login to comment

182 The cells expressing I206L exhibited apparent efflux activities comparable to those of the cells expressing wild-type BCRP for all three fluorescence compounds tested, whereas the cells expressing N590Y and D620N showed higher efflux activities.
X
ABCG2 p.Ile206Leu 15743976:182:21
status: VERIFIED
Login to comment

184 After normalization, the efflux activities of I206L were approximately 2to 3-fold those of wild-type BCRP for the three fluorescent substrates, and the efflux activities were reduced by approximately 60 to 70% and 40 to 50% for N590Y and D620N, respectively (Table 1).
X
ABCG2 p.Ile206Leu 15743976:184:46
status: VERIFIED
Login to comment

195 The I206L cells showed apparent resistance levels to MX and topotecan comparable to those of the cells expressing wild-type BCRP; however, after normalizing to the BCRP levels, I206L demonstrated an approximately 2-fold increase in resistance to MX and topotecan compared with wild-type BCRP.
X
ABCG2 p.Ile206Leu 15743976:195:4
status: VERIFIED
X
ABCG2 p.Ile206Leu 15743976:195:177
status: VERIFIED
Login to comment

201 A similar pattern of the effects of MX, prazosin, and FTC on the basal ATPase activities of I206L, N590Y, and D620N was observed.
X
ABCG2 p.Ile206Leu 15743976:201:92
status: VERIFIED
Login to comment

202 After normalizing to the BCRP levels, the basal ATPase activity of I206L and its ATPase activities in the presence of MX and prazosin were approximately 3 times higher than the respective activities of wild-type BCRP; however, the differences between the ATPase activities of I206L and those of wild-type protein were not statistically significant.
X
ABCG2 p.Ile206Leu 15743976:202:67
status: VERIFIED
X
ABCG2 p.Ile206Leu 15743976:202:276
status: VERIFIED
Login to comment

223 In the present study, we examined the I206L, N590Y, and D620N TABLE 1 FTC-inhibitable efflux activities of HEK cells expressing wild-type BCRP and its variants The FTC-inhibitable efflux activities of fluorescent compounds are represented by the differences (⌬F) in the median fluorescence between the FTC/efflux histograms and the efflux histograms.
X
ABCG2 p.Ile206Leu 15743976:223:38
status: VERIFIED
Login to comment

228 MX PhA BODIPY-Prazosin Rhodamine 123 (⌬F) ⌬F Ratio ⌬F Ratio ⌬F Ratio pcDNA 0 11.4 Ϯ 7.1 0 0 482R-21 42.5 Ϯ 8.4 1.0 121.9 Ϯ 27.5 1.0 127.0 Ϯ 51.5 1.0 0 I206L-13 52.8 Ϯ 3.0 2.76 131.7 Ϯ 17.3 2.40 127.2 Ϯ 80.2 2.23 0 N590Y-1 64.7 Ϯ 4.7* 0.42 149.3 Ϯ 22.2 0.34 147.5 Ϯ 97.1 0.32 0 D620N-9 67.1 Ϯ 7.1* 0.63 168.2 Ϯ 29.8* 0.55 149.1 Ϯ 68.7 0.47 0 * Indicates that the un-normalized ⌬F values for the 482R cells are significantly different (p Ͻ 0.05) from the N590Y or D620N cells as calculated by Student`s t test. variants.
X
ABCG2 p.Ile206Leu 15743976:228:203
status: VERIFIED
Login to comment

229 I206L, N590Y, and D620N were stably expressed in HEK cells.
X
ABCG2 p.Ile206Leu 15743976:229:0
status: VERIFIED
Login to comment

230 The immunoblots of the plasma membranes revealed a markedly lower protein level for I206L compared with wild-type BCRP, whereas the levels of N590Y and D620N were increased (Fig. 1B).
X
ABCG2 p.Ile206Leu 15743976:230:84
status: VERIFIED
Login to comment

233 The mechanism of lower expression for I206L is not known but might be related to the location of position 206 in the functionally important Walker B motif of the NBD in BCRP.
X
ABCG2 p.Ile206Leu 15743976:233:38
status: VERIFIED
Login to comment

235 Likewise, the I206L variant may also affect maturation and hence decrease protein expression of BCRP.
X
ABCG2 p.Ile206Leu 15743976:235:14
status: VERIFIED
Login to comment

236 The apparent transport activities of the cells expressing I206L were not significantly changed (Fig. 4; Table 1); however, after normalization to the BCRP level, I206L exhibited efflux activities and drug resistance capabilities approximately 2 to 3 times higher than those of wild-type protein (Tables 1 and 2).
X
ABCG2 p.Ile206Leu 15743976:236:58
status: VERIFIED
X
ABCG2 p.Ile206Leu 15743976:236:162
status: VERIFIED
Login to comment

237 One possible explanation for the increased transport activities of I206L is that the affinity of substrates to I206L and/or transport (turnover) efficiency of the variant is augmented.
X
ABCG2 p.Ile206Leu 15743976:237:67
status: VERIFIED
X
ABCG2 p.Ile206Leu 15743976:237:111
status: VERIFIED
Login to comment

238 Although not statistically significant, the ATPase activities of I206L were also found to be increased approximately 3-fold compared with wild-type protein (Fig. 6).
X
ABCG2 p.Ile206Leu 15743976:238:65
status: VERIFIED
Login to comment

239 These results suggest that, similar to the mutants in the Walker B motif in MRP1, the I206L variant can reduce protein expression and influence BCRP activity.
X
ABCG2 p.Ile206Leu 15743976:239:86
status: VERIFIED
Login to comment

247 The cells expressing wild-type BCRP (Œ), the variants I206L (‚), N590Y (Ⅺ), and D620N (छ), and the vector control cells (F) were exposed to MX (A), topotecan (B), daunorubicin (C), and rhodamine 123 (D) at the various concentrations indicated.
X
ABCG2 p.Ile206Leu 15743976:247:60
status: VERIFIED
Login to comment

256 MX Topotecan Daunorubicin Rhodamine 123 IC50 RR Ratio IC50 RR Ratio IC50 RR IC50 RR nM nM nM nM pcDNA 32.5 Ϯ 3.1 8.5 Ϯ 1.0 34.2 Ϯ 4.1 5797.9 Ϯ 1209.4 482R-21 226.3 Ϯ 27.4 7.0 1.0 122.8 Ϯ 23.3 14.4 1.0 40.0 Ϯ 1.7 1.2 10281.0 Ϯ 1445.4 1.7 I206L-13 209.7 Ϯ 19.5 6.5 2.06 124.9 Ϯ 17.1 14.7 2.25 25.6 Ϯ 2.8 0.7 8829.4 Ϯ 1454.8 1.5 N590Y-1 287.9 Ϯ 24.0* 8.9 0.35 130.5 Ϯ 17.8 15.4 0.30 19.9 Ϯ 2.3 0.6 7867.9 Ϯ 3691.1 1.3 D620N-9 271.9 Ϯ 33.3* 8.4 0.48 278.3 Ϯ 18.9* 32.7 0.91 31.6 Ϯ 1.8 0.9 15469.3 Ϯ 1762.5 2.6 * Indicates that the un-normalized IC50 values of the 482R cells are significantly different (p Ͻ 0.05) from the N590Y or D620N cells as calculated by Student`s t test. ATPase activities of both N590Y and D620N were also decreased to approximately 30 to 50% of the wild-type activities (Fig. 6).
X
ABCG2 p.Ile206Leu 15743976:256:285
status: VERIFIED
Login to comment

269 These data suggest that, whereas ATPase activities of BCRP could be affected by mutations in the NBD (e.g., Q141K and I206L), mutations in other regions including the TM segments (e.g., G406L/G410L) and extracellular loops (e.g., N590Y and D620N) can also influence ATP hydrolysis.
X
ABCG2 p.Ile206Leu 15743976:269:118
status: VERIFIED
Login to comment

270 The I206L variant was identified so far only in Hispanic livers with a 20% allele frequency from a small number of samples (Zamber et al., 2003).
X
ABCG2 p.Ile206Leu 15743976:270:4
status: VERIFIED
Login to comment

273 The in vitro analysis in this study revealed that, after normalization to the BCRP expression levels, the specific activities of I206L, N590Y, and D620N were significantly altered as compared with wild-type BCRP; however, the overall efflux activities and drug resistance profiles of the cells expressing these variants remained essentially unchanged.
X
ABCG2 p.Ile206Leu 15743976:273:129
status: VERIFIED
Login to comment

PMID: 15882131 [PubMed] Lepper ER et al: "Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2."
No. Sentence Comment
157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region.
X
ABCG2 p.Ile206Leu 15882131:157:708
status: NEW
Login to comment

PMID: 16146333 [PubMed] Mao Q et al: "Role of the breast cancer resistance protein (ABCG2) in drug transport."
No. Sentence Comment
161 For example, in a Japanese population studied, 39% to 50% are heterozygous and 7% are homozygous for the variant Q141K.95,96 In a Chinese population, 60% are heterozygous for Q141K.95 Several other variants such as I206L, N590Y, and D620N are much less frequent with allele frequencies of ~1%.95,97 For instance, N590Y is present in ~1.5% of Caucasians.95 I206L is found only in Hispanic populations so far.95 D620N is detected in 1.1% of all DNA samples examined with unknown genetic origin.97 In addition, a polymorphism in exon 4 that results in a substitution of stop codon for Gln at position 126 has also been identified.96 Amino acid changes at position 482 that were found in some drug-selected resistant cell lines have so far not been identified in normal populations or in DNA samples from cancer patients.49 In vitro functional characterization of the variants V12M and Q141K produced contradicting results.
X
ABCG2 p.Ile206Leu 16146333:161:215
status: NEW
X
ABCG2 p.Ile206Leu 16146333:161:356
status: NEW
Login to comment

PMID: 16158227 [PubMed] Krishnamurthy P et al: "The ABC transporter Abcg2/Bcrp: role in hypoxia mediated survival."
No. Sentence Comment
127 The SNPs in Bcrp that produce non-synonymous changes (i.e., amino acid substitutions) are at amino acids 12 (V12M), 141 (Q141K), 206 (I206L), and 590 (N590Y).
X
ABCG2 p.Ile206Leu 16158227:127:134
status: VERIFIED
Login to comment

PMID: 16160819 [PubMed] Ishikawa T et al: "Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design."
No. Sentence Comment
113 These contradictory expression and localization data for ABCG2 variants indicate that differences in transfection conditions (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably Table 2 Frequencies of ABCG2 alleles in different ethnic groups Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) V12M c.34G>A Japanese 29 9 1 19.0 Imai et al. (2002) Japanese 10 - - 15.0 Zamber et al. (2003) Japanese 220 61 8 17.5 Kobayashi et al. (2005) Chinese 10 - - 20.0 Zamber et al. (2003) Southeast Asians 10 - - 45.0 Zamber et al. (2003) Pacific Islanders 7 - - 64.0 Zamber et al. (2003) Swedish 60 2 0 1.7 B¨ackstr¨om et al. (2003) Dutch 100 11 1 6.5 Bosch et al. (2005) Caucasian 86 - - 2.0 Zamber et al. (2003) Caucasian 150 27 2 10.3 Mizuarai et al. (2004) Caucasian 150 11 0 3.7 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 10.0 Zamber et al. (2003) Middle Eastern 20 - - 5.0 Zamber et al. (2003) Africans North of Sahara 7 - - 14.0 Zamber et al. (2003) African American 150 17 1 6.3 Kobayashi et al. (2005) Mexicans 10 - - 10.0 Zamber et al. (2003) Hispanic Livers 5 - - 40.0 Zamber et al. (2003) Mexican Indians 5 - - 90.0 Zamber et al. (2003) Q126Stop c.376C>T Japanese 124 3 0 1.2 Imai et al. (2002) Japanese 60 2 0 1.7 Itoda et al. (2003) Japanese 220 4 0 0.9 Kobayashi et al. (2005) Caucasian 150 0 0 0.0 Mizuarai et al. (2004) Caucasian 150 0 0 0.0 Kobayashi et al. (2005) African American 150 0 0 0.0 Kobayashi et al. (2005) Q141K c.421C>A Japanese 124 48 9 26.6 Imai et al. (2002) Japanese 10 - - 35.0 Zamber et al. (2003) Japanese 220 90 27 32.7 Kobayashi et al. (2005) Chinese 95 43 11 34.2 de Jong et al. (2004) Chinese 10 - - 35.0 Zamber et al. (2003) Southeast Asians 10 - - 15.0 Zamber et al. (2003) Pacific Islanders 7 - - 14.0 Zamber et al. (2003) Swedish 60 10 1 10.0 B¨ackstr¨om et al. (2003) Dutch 100 20 2 12.0 Bosch et al. (2005) Caucasian 85 - - 14.0 Zamber et al. (2003) Caucasian 172 33 3 11.3 de Jong et al. (2004) Caucasian 150 22 2 8.7 Mizuarai et al. (2004) Caucasian 150 25 4 11.0 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 5.0 Zamber et al. (2003) Middle Eastern 20 - - 13.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African, Sub-Saharan 938 14 1 0.9 de Jong et al. (2004) African American 24 - - 0.0 Zamber et al. (2003) African American 150 5 1 2.3 Kobayashi et al. (2005) African American 94 8 1 5.3 de Jong et al. (2004) Mexicans 10 - - 5.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 10.0 Zamber et al. (2003) R160Q c.479G>A Dutch 100 1 0 0.5 Bosch et al. (2005) I206L c.616A>C Japanese 10 - - 0.0 Zamber et al. (2003) Chinese 10 - - 0.0 Zamber et al. (2003) Southeast Asians 10 - - 0.0 Zamber et al. (2003) Pacific Islanders 7 - - 0.0 Zamber et al. (2003) Caucasian 65 - - 0.0 Zamber et al. (2003) Table 2 Continued Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) Ashkenazi Jewish 10 - - 0.0 Zamber et al. (2003) Middle Eastern 20 - - 0.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African American 15 - - 0.0 Zamber et al. (2003) Mexicans 10 - - 0.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 0.0 Zamber et al. (2003) F431L c.1291T>C Japanese 60 1 0 0.8 Itoda et al. (2003) S441N c.1322G>A Japanese 100 1 0 0.5 Kobayashi et al. (2005) F489L c.1465T>C Japanese 60 1 0 0.8 Itoda et al. (2003) Japanese 100 1 0 0.5 Kobayashi et al. (2005) R575Stop c.1723C>T Dutch 100 1 0 0.5 Bosch et al. (2005) N590Y c.1768A>T Caucasian 65 - - 1.0 Zamber et al. (2003) Caucasian 150 1 0 0.3 Mizuarai et al. (2004) African Americans 15 - - 0.0 Zamber et al. (2003) D620N c.1858G>A Dutch 100 1 0 0.5 Bosch et al. (2005) affect the cellular processing and sorting of these proteins.
X
ABCG2 p.Ile206Leu 16160819:113:2728
status: NEW
Login to comment

118 For this purpose, we have created variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) by site-directed mutagenesis.
X
ABCG2 p.Ile206Leu 16160819:118:101
status: NEW
Login to comment

130 After the normalization of expression levels, the V12M and T153M variants showed increased levels of MTX transport activity, whereas the I206L, N590Y, and D620N variants had lower transport activities.
X
ABCG2 p.Ile206Leu 16160819:130:137
status: NEW
Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."
No. Sentence Comment
210 In different ethnic groups, seven naturally-occurring non-synonymous SNPs have been reported: V12M, Q126Stop, Q141K, I206L, F431L, S441N, F489L, N590Y and D620N.
X
ABCG2 p.Ile206Leu 16259577:210:117
status: VERIFIED
Login to comment

213 Some of the above sequence variations showed an allele frequency of ~ 1% in distinct populations, Q126stop and F489L in the Japanese and N590Y in the Caucasian population [129-131,134,135], whereas most of the mutations were only detected in single individuals (e.g., I206L, F431L, S441N, D620N).
X
ABCG2 p.Ile206Leu 16259577:213:268
status: VERIFIED
Login to comment

250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins.
X
ABCG2 p.Ile206Leu 16259577:250:52
status: VERIFIED
Login to comment

255 For this purpose, variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G and R482T) were created by site-directed mutagenesis (Figure 3).
X
ABCG2 p.Ile206Leu 16259577:255:85
status: VERIFIED
Login to comment

267 The V12M and T153M variants showed increased levels of MTX transport activity, whereas the I206L, N590Y and D620N variants had lower transport activities.
X
ABCG2 p.Ile206Leu 16259577:267:91
status: VERIFIED
Login to comment

318 W T G 51C D 620N R 482G R 482T N 590Y E334stop I206L Q 166E T153M Q 141K Q 126stop V12M ATP-dependentMTXtransport (nmol/min/mgprotein) 2.0 1.5 1.0 0.5 0.0 5.
X
ABCG2 p.Ile206Leu 16259577:318:47
status: VERIFIED
Login to comment

PMID: 16303243 [PubMed] Yanase K et al: "Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development."
No. Sentence Comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain.
X
ABCG2 p.Ile206Leu 16303243:92:575
status: NEW
Login to comment

PMID: 16337740 [PubMed] Cervenak J et al: "The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology."
No. Sentence Comment
109 To date, altogether eight non-synonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.114TOC, c.369COT, c.474COT, c.1098GOA, c.1425AOG) missense mutations, one nonsense (Q126X), and one frameshift (c.1515delC) mutations were identified in the coding region of ABCG2 in healthy individuals or in patients [43-46,49,63-65].
X
ABCG2 p.Ile206Leu 16337740:109:55
status: VERIFIED
Login to comment

112 Some of the above sequence variations showed an allele frequency of about 1% in distinct populations (Q126X, F489L in the Japanese and N590Y in the Caucasian population [45-47,49,64]), while most of the mutations were only detected in single individuals (missense mutations: I206L, F431L, S441N, D620N, and a frameshift mutation: c.1515delC [44-46,49]).
X
ABCG2 p.Ile206Leu 16337740:112:275
status: VERIFIED
Login to comment

PMID: 16399366 [PubMed] Ishikawa T et al: "High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics."
No. Sentence Comment
115 For this purpose, variant forms (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) have been created by site‐ directed mutagenesis with the QuikChange site‐directed mutagensis kit (Stratagene, La Jolla, CA).
X
ABCG2 p.Ile206Leu 16399366:115:76
status: NEW
Login to comment

PMID: 16402910 [PubMed] Krishnamurthy P et al: "Role of ABCG2/BCRP in biology and medicine."
No. Sentence Comment
297 Two other SNPs produced amino acid changes in exon 6 (A616C and I206L) and exon 15 (a 1768T and N590Y) (45).
X
ABCG2 p.Ile206Leu 16402910:297:64
status: NEW
Login to comment

PMID: 16608919 [PubMed] Tamura A et al: "Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport."
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Ile206Leu 16608919:2:189
status: NEW
Login to comment

82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan).
X
ABCG2 p.Ile206Leu 16608919:82:894
status: NEW
Login to comment

144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis.
X
ABCG2 p.Ile206Leu 16608919:144:165
status: NEW
Login to comment

214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Ile206Leu 16608919:214:189
status: NEW
Login to comment

224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein.
X
ABCG2 p.Ile206Leu 16608919:224:491
status: NEW
Login to comment

PMID: 16702730 [PubMed] Maekawa K et al: "Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population."
No. Sentence Comment
89 On the other hand, several nonsynonymous SNPs reported in other ethnic groups were not detected: 805CÀT (Pro269Ser) found in Chinese at a 0.037 frequency,20) 1858GÀA (Asp620Asn) in undeˆned (combined) ethnicities14) (0.011) and in a Dutch population21) (0.005), 616AÀC (Ile206Leu) in Hispanics (0.100), and 1768AÀT (Asn590Tyr) in Caucasians (0.010).18) Thus, these SNPs are either ethnic-speciˆc or rare.
X
ABCG2 p.Ile206Leu 16702730:89:290
status: VERIFIED
Login to comment

PMID: 16877258 [PubMed] Wakabayashi K et al: "Human ABC transporter ABCG2 in xenobiotic protection and redox biology."
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells.
X
ABCG2 p.Ile206Leu 16877258:176:167
status: NEW
Login to comment

PMID: 17015488 [PubMed] Sarkadi B et al: "Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system."
No. Sentence Comment
997 In healthy individuals or patients, altogether eight nonsynonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.
X
ABCG2 p.Ile206Leu 17015488:997:81
status: VERIFIED
Login to comment

PMID: 17159598 [PubMed] Deeken JF et al: "Toward individualized treatment: prediction of anticancer drug disposition and toxicity with pharmacogenetics."
No. Sentence Comment
326 These SNPs occur at mRNA positions 34 (V12M; exon 2), 421 (Q141K, exon 16), 616 (I206L, exon 6) and 1768 (N590Y, exon 15).
X
ABCG2 p.Ile206Leu 17159598:326:81
status: VERIFIED
Login to comment

328 The SNPs of V12M, I206L and N590Y have not to date been found to confer an alteration in protein expression or function.
X
ABCG2 p.Ile206Leu 17159598:328:18
status: VERIFIED
Login to comment

331 Table 12 Ethnic frequencies (%) of allelic variants in ABCG2 gene Allelic variant Caucasians African-Americans Asians Hispanics Africans Middle Easterns V12M 2 4 20-45 40 5 Q141K 11-14 2.3-5.0 15-35 10 1.0 13 I206L 0 0 0 10 0 N590Y 1 Sources: [150-153].
X
ABCG2 p.Ile206Leu 17159598:331:209
status: VERIFIED
Login to comment

PMID: 17228519 [PubMed] Tamura A et al: "Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system."
No. Sentence Comment
142 Finally, the acquired mutants R482G and R482T form another group, which is characteristic Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 9 Table 3 Remarks mRNA Protein Author Ref Host cell Vector Expression SNP expression expression Imai et al. (15) PA317 pHaL-IRES-DHFR bicistronic Stable V12M Similar to WT Similar to WT - - retrovirus vector plasmid - Q141K Similar to WT Lower than WT Mizuarai et al. (18) LLC-PK1 pcDNA3.1(+) Stable V12M Similar to WT N.D. - - - - Q141K Similar to WT N.D. Morisaki et al. (25) HEK293 pcDNA3.1 Stable V12M Vary among clones Vary among clones - - - - Q141K Vary among clones Vary among clones - - - - D620N Vary among clones Vary among clones Kondo et al. (26) LLC-PK1/ pcDNA3.1/ Stable/ V12M N.D. Similar to WT - HEK293 Adenovirus Transient Q141K N.D. 30 - 40% of WT - - - - A149P N.D. Similar to WT - - - - R163K N.D. Similar to WT - - - - Q166E N.D. Similar to WT - - - - P269S N.D. Similar to WT - - - - S441N N.D. Lower than WT Vethanayagam (27) HEK293 pcDNA3.1/myc-His(-) Stable I206L N.D. Vary among clones et al. - - - - N590Y N.D. Vary among clones - - - - D620N N.D. Vary among clones N.D.: No data Table 2.
X
ABCG2 p.Ile206Leu 17228519:142:1092
status: VERIFIED
Login to comment

PMID: 17373578 [PubMed] Yoshioka S et al: "The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein."
No. Sentence Comment
42 The cells were selected with 120 ng/mL of methotrexate, and the resulting mixed populations of resistant cells were designated as PA/WT, PA/V12M, PA/ G51C, PA/Q141K, PA/T153M, PA/I206L, PA/F208S, PA/ S248P, PA/F431L, PA/N590Y and PA/D620N, respectively. The PA/F208S clones and PA/F431L clones were obtained by limiting dilution.
X
ABCG2 p.Ile206Leu 17373578:42:179
status: VERIFIED
Login to comment

43 Cell Growth Inhibition Assay Anticancer agent resistance levels in both the parental PA317 cells and in the various BCRP transfectants were Table I. Frequencies of Germ-line Mutations/SNPs Within The BCRP Gene Variation Frequency (%) Number Population Reference Nucleotide Amino acid G34A V12M 19 29 Japanese 17 G151T G51C 0.1a 350 Japanese C376T Q126Stop 1.2 124 Japanese 17 C421A Q141K 26.6 124 Japanese 17 C458T T153M 3.3 30 Cell line 32 C496G Q166E 0.3a 200 Japanese A616C I206L 20 10 Hispanic 33 T623C F208S 0.3a 200 Japanese T742C S248P 0.5a 200 Japanese T1291C F431L 0.6b 260 Japanese 34 A1768T N590Y 1.1 88 Caucasians 33 G1858A D620N 1.1 90 unknown 35 a Determined in this study.
X
ABCG2 p.Ile206Leu 17373578:43:477
status: VERIFIED
Login to comment

45 V12M Q141K D620N N590Y F431L S248P F208S I206L T153M G51C Q166E OUT MEMBRANE IN Fig. 1.
X
ABCG2 p.Ile206Leu 17373578:45:41
status: VERIFIED
Login to comment

80 RESULTS Expression of BCRP in PA317 Transfectants The germ-line mutations and resulting amino acid substitutions examined in this study were as follows; G151T (G51C), C458T (T153M), C496G (Q166E), A616C (I206L), T623C (F208S), T742C (S248P), T1291C (F431L), A1768T (N590Y) and G1858A (D620N).
X
ABCG2 p.Ile206Leu 17373578:80:204
status: VERIFIED
Login to comment

81 G51C, T153M, Q166E, I206L, F208S and S248P are located in the intracellular domain of the protein (Fig. 1 and Table I).
X
ABCG2 p.Ile206Leu 17373578:81:20
status: VERIFIED
Login to comment

90 The remaining transfectants PA/G51C, PA/ I206L, PA/S248P, and PA/N590Y expressed BCRP at levels that were comparable to PA/WT cells (Fig. 2a).
X
ABCG2 p.Ile206Leu 17373578:90:41
status: VERIFIED
Login to comment

97 Each of the other transfectants (PA/G51C, PA/I206L, PA/S248P, PA/F431L, and PA/N590Y cells) showed similar cell surface BCRP expression levels to PA/WT (Fig. 2d).
X
ABCG2 p.Ile206Leu 17373578:97:45
status: VERIFIED
Login to comment

104 Additional transfectants (PA/G51C, PA/Q166E, PA/I206L, PA/S248P, and PA/N590Y cells) showed no change in their drug resistance profiles to SN-38 compared with PA/WT cells (Table II).
X
ABCG2 p.Ile206Leu 17373578:104:48
status: VERIFIED
Login to comment

128 DISCUSSION In our current study, we have examined the effect of the nine germ-line mutations/SNPs, G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP, resulting in the amino acid changes G51C, T153M, Q166E, I206L, F208S, S248P, F431L, N590Y, D620N, respectively, on BCRP protein expression and function.
X
ABCG2 p.Ile206Leu 17373578:128:230
status: VERIFIED
Login to comment

130 The resulting mixed populations of cells were designated a PA/WT, PA/V12M, PA/G51C, PA/Q141K, PA/ T153M, PA/I206L, PA/F208S, PA/S248P, PA/F431L, PA/ N590Y and PA/D620N.
X
ABCG2 p.Ile206Leu 17373578:130:108
status: VERIFIED
Login to comment

143 G51C, T153M, Q166E, I206L, F208S, and S248P are located in the intracellular domain, and F431L, N590Y, and D620N reside in the transmembrane domain.
X
ABCG2 p.Ile206Leu 17373578:143:20
status: VERIFIED
Login to comment

145 The I206L BCRP and F208S BCRP mutants harbor amino acid substitutions within the Walker B region, which is likely to have a significant impact upon the functioning of the ATP binding site.
X
ABCG2 p.Ile206Leu 17373578:145:4
status: VERIFIED
Login to comment

149 On the other hand, PA/I206L cells show similar levels of BCRP expression and the resistance to SN-38 as PA/WT cells.
X
ABCG2 p.Ile206Leu 17373578:149:22
status: VERIFIED
Login to comment

150 Further studies are ongoing to evaluate the ATP-binding and -hydrolyzing activity of I206L BCRP and F208S BCRP mutants.
X
ABCG2 p.Ile206Leu 17373578:150:85
status: VERIFIED
Login to comment

PMID: 18249138 [PubMed] Hazai E et al: "Homology modeling of breast cancer resistance protein (ABCG2)."
No. Sentence Comment
245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand.
X
ABCG2 p.Ile206Leu 18249138:245:798
status: NEW
Login to comment

PMID: 18363541 [PubMed] Tamura A et al: "Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems."
No. Sentence Comment
230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A.
X
ABCG2 p.Ile206Leu 18363541:230:105
status: NEW
Login to comment

231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids.
X
ABCG2 p.Ile206Leu 18363541:231:69
status: NEW
Login to comment

245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells.
X
ABCG2 p.Ile206Leu 18363541:245:167
status: NEW
Login to comment

252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative).
X
ABCG2 p.Ile206Leu 18363541:252:278
status: NEW
Login to comment

PMID: 18370855 [PubMed] Polgar O et al: "ABCG2: structure, function and role in drug response."
No. Sentence Comment
82 Some of these are in the coding region of ABCG2 and alter the protein sequence, such as V12M, Q141K, I206L and N590Y.
X
ABCG2 p.Ile206Leu 18370855:82:101
status: VERIFIED
Login to comment

175 Membrane Out In 200 100 300 400 500 600 ATP site N-terminus C-terminus V12M Q141K I206L GXXXG, G406/G410 R482 G553 C603 N596 N590Y protein synthesis.
X
ABCG2 p.Ile206Leu 18370855:175:82
status: VERIFIED
Login to comment

PMID: 18454051 [PubMed] Saraiya B et al: "Sequential topoisomerase targeting and analysis of mechanisms of resistance to topotecan in patients with acute myelogenous leukemia."
No. Sentence Comment
91 For ABCG2, primers were designed to amplify regions containing the following four SNPs: G34A (V12M, exon 1), C376T (stop, exon 3), A616C (I206L, exon 5), C421A (Q141K, exon 12), and A1768T (N590Y, exon 14).
X
ABCG2 p.Ile206Leu 18454051:91:138
status: VERIFIED
Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."
No. Sentence Comment
250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult.
X
ABCG2 p.Ile206Leu 18464048:250:469
status: VERIFIED
Login to comment

PMID: 18598762 [PubMed] Han Y et al: "Modulation of breast cancer resistance protein (BCRP/ABCG2) by non-basic chalcone analogues."
No. Sentence Comment
378 Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
X
ABCG2 p.Ile206Leu 18598762:378:79
status: NEW
Login to comment

PMID: 18668433 [PubMed] Koshiba S et al: "Human ABC transporters ABCG2 (BCRP) and ABCG4."
No. Sentence Comment
225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007).
X
ABCG2 p.Ile206Leu 18668433:225:151
status: NEW
Login to comment

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."
No. Sentence Comment
85 Exon Polymorphism Effect dbSNP Cell Expression Function Reference mRNA ( ) Protein (n.s.) Membrane localization (n.s.) Drug sensitivity (n.s.) Mitoxantrone efflux (n.s.) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity (n.s.) Mizuarai et al. [88] Sf9 Protein ( ) ATPase activity (n.s.) Hoechst 33342 efflux ( ) Morisaki et al. [92] Exon 2 114T>C synonymous rs12721640 Exon 4 369C>T synonymous rs2231139 PA317 mRNA (n.s.) Protein ( ) Drug sensitivity ( ) Intracellular uptake ( ) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (n.s.) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] LLC-PK1 Apical localization (n.s.) Kondo et al. [94] mRNA ( ) Protein (n.s.) Membrane localization (impaired) Drug sensitivity ( ) Mitoxantrone efflux ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] HEK293 Protein ( ) Transport activity (n.s.) Kondo et al. [94] Protein (n.s.) ATPase activity ( ) Mizuarai et al. [88] 421C>A Gln141Lys rs2231142 Sf9 Protein (n.s.) ATPase activity ( ) Hoechst 33342 efflux (n.s.) Morisaki et al. [92] LLC-PK1 Apical localization (n.s.) Exon 5 496C>G Gln166Glu rs1061017 HEK293 Protein (n.s.) Transport activity (n.s.) Kondo et al. [94] 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 HEK293 Protein ( or n.s.) Membrane localization (n.s.) Efflux activity ( ) Drug sensitivity ( ) ATPase activity (n.s.) Vethanayagam et al. [95] 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334stop rs3201997 Exon 14 2204T>A Phe571Ile rs9282571 SLC15A1 CHO Cephalexin uptake (n.s.)61G>A Val21Ile rs8187818 Cos7 Cephalexin uptake (n.s.) Substrate selectivity (n.s.) CHO Cephalexin uptake ( ) Cos7 Cephalexin uptake ( ) Substrate selectivity (VAC inhibition?)
X
ABCG2 p.Ile206Leu 18673259:85:1351
status: VERIFIED
Login to comment

94 Exon Polymorphism Effect dbSNP Subject Expression Function Reference 114T>C synonymous rs12721640 369C>T synonymous rs2231139 421C>A Gln141Lys rs2231142 Patient (Caucasian) 9-nitrocamptotecin PK (CC CA) 9-aminocamptotecin PK [AUC/Dose] (CC<CA) Zamboni et al. [55] Nasopharyngeal cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) Zhou et al. [56] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CA AA) Colombo et al. [58] Cancer patient Irinotecan PK (CC CA+AA) SN-38 PK (CC CA+AA) SN-38G PK (CC CA+AA) de Jong et al. [90] Patient (Japanese) Placental mRNA (CC CA AA) Placental protein (CC>CA>AA) Kobayashi et al. [91] Cancer patient Diflomotecan PK [AUC, Cmax] (CC<CA), [F] (CC>CA) Sparreboom et al. [96] Healthy (Chinese) Rosuvastatin PK [AUC, Cmax] (CC<CA+AA), [CL/F] (CC>CA+AA), [T1/2, Tmax] (CC CA+AA) Zhang et al. [97] Exon 4 496C>G Gln166Glu rs1061017 564A>G synonymous rs3116439 616A>C Ile206Leu rs12721643 617T>G Ile206Ser 617T>C Ile206Thr 617T>A Ile206Asn rs28365037 Exon 6 623T>C Phe208Ser rs1061018 Exon 7 742T>C Ser248Pro rs3116448 Exon 9 1000G>T Glu334Stop rs3201997 Exon 14 1711T>A Phe571Ile rs9282571 SLC15A1 61G>A Val21Ile rs8187818Exon 3 83T>A Phe28Tyr rs8187817 258G>A synonymous rs8187823 330C>T synonymous rs8187822 350G>A Ser117Asn rs2297322 351C>A Ser117Arg rs8187821 Exon 5 364G>A Val122Met rs8187820 Exon 7 501C>T synonymous rs3737087 Exon 11 843G>A synonymous r8187812 Exon 15 1147G>A Asp383Asn rs1782674 1179C>T synonymous rs8187836Exon 16 1256G>C Gly419Ara rs4646227 1347T>C synonymous rs1339067 Allelic mRNA imbalance (2030%) Anderle et al. [101] 1348G>A Val450Ile rs2274828 1352C>A Thr451Asn rs8187838 Exon 17 1375C>T Arg459Cys rs2274827 Exon 18 1446A>G synonymous rs8187828 (Table 3) contd….
X
ABCG2 p.Ile206Leu 18673259:94:933
status: VERIFIED
Login to comment

103 On the other hand, the Ile206Leu variant, induced by 616A>C SNP, which occurred at lower allele frequency, exhibited approximately 2-fold wild-type efflux activity in HEK293 cells, whereas its ATPase activities were not significantly different from wild-type protein [95].
X
ABCG2 p.Ile206Leu 18673259:103:23
status: VERIFIED
Login to comment

PMID: 18681776 [PubMed] Cusatis G et al: "Pharmacogenomic importance of ABCG2."
No. Sentence Comment
27 Several other SNPs have been identified in coding regions of the gene, and at least three additional nonsynonymous SNPs have been identified, occurring at positions 34 (V12M, exon 2), 616 (I206L, exon 6) and 1768 (N590Y, exon 15).
X
ABCG2 p.Ile206Leu 18681776:27:189
status: VERIFIED
Login to comment

PMID: 18824523 [PubMed] Merino G et al: "Natural allelic variants of bovine ATP-binding cassette transporter ABCG2: increased activity of the Ser581 variant and development of tools for the discovery of new ABCG2 inhibitors."
No. Sentence Comment
121 For example, the I206L variant exhibits 2 to 3 times higher efflux activities and drug resistance capabilities than that of wild-type protein (Vethanayagam et al., 2005).
X
ABCG2 p.Ile206Leu 18824523:121:17
status: VERIFIED
Login to comment

218 Vethanayagam RR, Wang H, Gupta A, Zhang Y, Lewis F, Unadkat JD, and Mao Q (2005) Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
X
ABCG2 p.Ile206Leu 18824523:218:160
status: VERIFIED
Login to comment

PMID: 18855611 [PubMed] Zhou SF et al: "Clinical pharmacogenetics and potential application in personalized medicine."
No. Sentence Comment
618 Only a small portion of them are non-synonymous (V12M, Q141K, Q166E, I206L, F208S, S248P, D296H, L525R, A528T, F571I, and Y590N) and there is one frameshift (1515delC) mutation observed in the coding region of ABCG2.
X
ABCG2 p.Ile206Leu 18855611:618:69
status: VERIFIED
Login to comment

628 Several other variants such as I206L, N520Y and D620N are much less frequent with allele frequencies of ~1%.
X
ABCG2 p.Ile206Leu 18855611:628:31
status: VERIFIED
Login to comment

PMID: 19111841 [PubMed] Noguchi K et al: "Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy."
No. Sentence Comment
874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain.
X
ABCG2 p.Ile206Leu 19111841:874:437
status: NEW
Login to comment

PMID: 19827267 [PubMed] Ishikawa T et al: "Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics."
No. Sentence Comment
222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004).
X
ABCG2 p.Ile206Leu 19827267:222:52
status: NEW
Login to comment

232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7.
X
ABCG2 p.Ile206Leu 19827267:232:147
status: NEW
X
ABCG2 p.Ile206Leu 19827267:232:355
status: NEW
Login to comment

PMID: 19835554 [PubMed] Franke RM et al: "Pharmacogenetics of drug transporters."
No. Sentence Comment
104 Several other SNPs have been identified in coding regions of the gene, and at least three additional non-synonymous SNPs have been identified occurring at positions 34 (V12M; exon 2), 616 (I206L, exon 6), and 1768 (N590Y, exon 15).
X
ABCG2 p.Ile206Leu 19835554:104:189
status: VERIFIED
Login to comment

PMID: 19949923 [PubMed] Aszalos A et al: "Flow cytometric evaluation of multidrug resistance proteins."
No. Sentence Comment
260 Three other variants, I206L, N590Y, and D620N, were studied by Vethanayagam et al.
X
ABCG2 p.Ile206Leu 19949923:260:22
status: NEW
Login to comment

PMID: 19949928 [PubMed] Ross DD et al: "Impact of breast cancer resistance protein on cancer treatment outcomes."
No. Sentence Comment
87 found the I206L allele to have high transporter activity but low protein expression when transfected into human embryonic kidney (HEK) cells, whereas the N590L and D620N had higher expression but lower activity (85).
X
ABCG2 p.Ile206Leu 19949928:87:10
status: VERIFIED
Login to comment

PMID: 21103975 [PubMed] Meyer zu Schwabedissen HE et al: "In vitro and in vivo evidence for the importance of breast cancer resistance protein transporters (BCRP/MXR/ABCP/ABCG2)."
No. Sentence Comment
257 No effect on the in vitro transport activity was seen for the missense mutations c.445G>C (p.A149P; AF 0.01), c.458C>T (p.T153M; AF 0.033) c.496C>G (p.Q166E, AF not determined) c.616A>C (I206L AF not determined), c.488G>A (p.R163K AF 0.006), c.805C>T (p.P269S AF 0.006), and c.1711T>A (p.F571L, AF 0.005) (Kondo et al. 2004; Tamura et al. 2006).
X
ABCG2 p.Ile206Leu 21103975:257:187
status: VERIFIED
Login to comment

252 There is profound variability in the minor allele frequencies (AF) of those polymorphisms among populations of different ethnicities, and some of the polymorphisms have been described in single individuals only, such as the c.616A>C, p.I206L (Zamber et al. 2003), the c.2062G>A (p.D620N) (Honjo et al. 2002), and the frameshift mutation c.1515delC (p.AFFVM505-509 ASSLstop) (Itoda et al. 2003).
X
ABCG2 p.Ile206Leu 21103975:252:236
status: VERIFIED
Login to comment

PMID: 21188243 [PubMed] Ishikawa T et al: "Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis."
No. Sentence Comment
167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90].
X
ABCG2 p.Ile206Leu 21188243:167:167
status: NEW
Login to comment

177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms.
X
ABCG2 p.Ile206Leu 21188243:177:133
status: NEW
X
ABCG2 p.Ile206Leu 21188243:177:333
status: NEW
Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."
No. Sentence Comment
6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined.
X
ABCG2 p.Ile206Leu 20103563:6589:134
status: NEW
Login to comment

PMID: 20799350 [PubMed] Kelly L et al: "Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains."
No. Sentence Comment
72 Predictions of the Functional Effects of 40 nsSNPs in ABC Transporters Comon name HUGO name Mutation NBD Prediction BSEP ABCB11 E592Q NBD1 Neutral BSEP ABCB11 N591S NBD1 Neutral BSEP ABCB11 Q558H NBD1 Neutral BSEP ABCB11 V444A NBD1 Neutral BSEP ABCB11 E1186K NBD2 Disease MDR1 ABCB1 P1051A NBD2 Neutral MDR1 ABCB1 S1141T NBD2 Neutral MDR1 ABCB1 T1256K NBD2 Disease MDR1 ABCB1 V1251I NBD2 Neutral MDR1 ABCB1 W1108R NBD2 Disease MRP2 ABCC2 I670T NBD1 Disease MRP2 ABCC2 L849R NBD1 Disease MRP2 ABCC2 C1515Y NBD2 Disease MRP3 ABCC3 D770N NBD1 Neutral MRP3 ABCC3 K718M NBD1 Neutral MRP3 ABCC3 T809M NBD1 Disease MRP3 ABCC3 V765L NBD1 Disease MRP3 ABCC3 Q1365R NBD2 Disease MRP3 ABCC3 R1297H NBD2 Disease MRP3 ABCC3 R1348C NBD2 Disease MRP3 ABCC3 R1381S NBD2 Disease MRP4 ABCC4 G487E NBD1 Disease MRP4 ABCC4 K498E NBD1 Neutral MRP4 ABCC4 R1220Q NBD2 Neutral MRP4 ABCC4 T1142M NBD2 Neutral MRP4 ABCC4 V1071I NBD2 Neutral MRP6 ABCC6 I1330L NBD1 Neutral MRP6 ABCC6 I742V NBD1 Neutral MRP6 ABCC6 P664S NBD1 Neutral MRP6 ABCC6 R724K NBD1 Neutral MRP6 ABCC6 R769K NBD1 Neutral MRP6 ABCC6 A1291T NBD2 Neutral MRP6 ABCC6 E1369K NBD2 Neutral MRP6 ABCC6 G1327E NBD2 Disease MRP6 ABCC6 L1416R NBD2 Disease MRP6 ABCC6 R1268Q NBD2 Disease MRP6 ABCC6 R1461H NBD2 Disease MXR ABCG2 I206L NBD1 Neutral MXR ABCG2 P269S NBD1 Disease MXR ABCG2 Q141K NBD1 Neutral nsSNPs.
X
ABCG2 p.Ile206Leu 20799350:72:1262
status: NEW
Login to comment

PMID: 21821808 [PubMed] Real R et al: "Analysis of the effect of the bovine adenosine triphosphate-binding cassette transporter G2 single nucleotide polymorphism Y581S on transcellular transport of veterinary drugs using new cell culture models."
No. Sentence Comment
256 Another ABCG2 variant, I206L [so far, only identified in Hispanic livers (Zamber et al., 2003)], also exhibits 2 to 3 times greater drug resistance capacity than that of wild-type protein (Vethanayagam et al., 2005).
X
ABCG2 p.Ile206Leu 21821808:256:23
status: NEW
Login to comment

257 These authors suggest that the increased transport activity of I206L could be the result of greater affinity of substrates or augmented transport efficiency for this protein variant.
X
ABCG2 p.Ile206Leu 21821808:257:63
status: NEW
Login to comment

480 Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
X
ABCG2 p.Ile206Leu 21821808:480:79
status: NEW
Login to comment

PMID: 24777822 [PubMed] Jani M et al: "Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics."
No. Sentence Comment
95 Histone deacetylase inhibitors rescue newly synthesized transporter proteins and prevent aggresome targeting by disturbing TableÊf;1ߒߙMajor non-synonymous single-nucleotide polymorphisms found in the ABCG2 coding region Allele frequencies presented in this table do not reflect interethnic differences Mutation Position in BCRP Cellular effects of SNP Allele frequency % References 34G>A, V12M (rs2231137) N-terminus Lower expression, no impact on function 0-29.8 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 151G>T, G51C N-terminus Slightly overexpressed, decreased transport activity 0.1 Tamura et al. (2006), Yoshioka et al. (2007) 376C>T, Q126X (rs7255271) NBD No expression, no activity 0-1.7 Tamura et al. (2006), Mizuarai et al. (2004), Itoda et al. (2003), Imai et al. (2002), Kobayashi et al. (2005), Kondo et al. (2004) 421C>A, Q141K (rs2231142) NBD Lower expression, decreased transport activity, substrate specificity altered 0-35.7 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 458C>T, T153 M NBD Slightly lower expression, no impact on function 3.3 Tamura et al. (2006), Mizuarai et al. (2004) 479G>A, R160Q NBD Not determined 0.5 Bosch et al. (2005), Tamura et al. (2006) 496C>G, Q166E (rs1061017) NBD Slightly lower expression, no impact on function 0-1.1 Tamura et al. (2006), Kondo et al. (2004), Yoshioka et al. (2007) 616A>C, I206L (rs12721643) NBD Well expressed, decreased transport activity 0-10.0 Tamura et al. (2006), Zamber et al. (2003), Vethanayagam et al. (2005), Ieiri (2012a) 623T>C, F208 (rs1061018) NBD No expression, no transport activity 0.9-3.9 Tamura et al. (2006) 742T>C, S248P (rs3116448) NBD Well expressed, no transport activity 0.5 Tamura et al. (2006), Yoshioka et al. (2007) 1000G>T, E334X (rs3201997) NBD No expression, no transport activity Not determined Tamura et al. (2006), Ishikawa et al. (2005) 1291T>C F431L ECL1 Lower expression, substrate specificity altered 0.6-0.8 Tamura et al. (2006), Itoda et al. (2003), Yoshioka et al. (2007) 1322G>A, S441 N ECL1 Slightly lower expression, no transport activity 0.5 Tamura et al. (2006), Kobayashi et al. (2005), Kondo et al. (2004) 1465T>C, F489L TM3 Slightly lower expression, no transport activity 0.5-0.8 Tamura et al. (2006), Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F506S TM4 Not determined 0.5 Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F507L 1515delC, V508L 1515delC, M509X 1711T>A, F571I (rs9282571) TM5 Well expressed, substrate specificity altered 0.5 Tamura et al. (2006) 1723C>T, R575X TM5 Not determined 0.5 Tamura et al. (2006) 1768A>T, N590Y (rs34264773) ECL3 Slightly overexpressed, substrate specificity altered 0-9.7 Tamura et al. (2006), Mizuarai et al. (2004), Zamber et al. (2003), Vethanayagam et al. (2005) 1858G>A, D620 N (rs34783571) ECL3 Slightly overexpressed, substrate specificity altered 0-11.1 Tamura et al. (2006), Bosch et al. (2005), Honjo et al. (2002), Vethanayagam et al. (2005) the trafficking along microtubules (Basseville et al. 2012).
X
ABCG2 p.Ile206Leu 24777822:95:1629
status: NEW
Login to comment

PMID: 25036722 [PubMed] Szafraniec MJ et al: "Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2)."
No. Sentence Comment
201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells.
X
ABCG2 p.Ile206Leu 25036722:201:177
status: NEW
Login to comment

PMID: 25236865 [PubMed] Mao Q et al: "Role of the breast cancer resistance protein (BCRP/ABCG2) in drug transport--an update."
No. Sentence Comment
218 V12M resulting from the 34G>A SNP and other variants (e.g., I206L, F208S, N590Y, and D620N) display expression levels and drug resistance profiles comparable to wild-type BCRP (100,101).
X
ABCG2 p.Ile206Leu 25236865:218:60
status: NEW
Login to comment