ABCMdb

PMID: 9417117

Lu Y, Xiong X, Helm A, Kimani K, Bragin A, Skach WR
Co- and posttranslational translocation mechanisms direct cystic fibrosis transmembrane conductance regulator N terminus transmembrane assembly.
J Biol Chem. 1998 Jan 2;273(1):568-76., [PubMed]

Sentences

No. Mutations Sentence Comment

8 ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala Mutating charged residues Glu92 and Lys95 to alanine improved TM1 signal sequence activity as well as the ability of TM1 to independently direct CFTR N terminus topology. Login to comment 41 ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala MATERIALS AND METHODS cDNA Construction-E92A and K95A mutations were engineered into CFTR by site-directed mutagenesis using a single stranded (M-13) (plasmid pBQ 4.7) template and oligonucleotides TATATTTAGGCGCCGTCAC- CAAAGCAGT and GAAGTCACCGCTGCAGTACAGCCT as described (33). Login to comment 42 ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala AvaI/XbaI fragments containing the engineered mutations were then ligated into an AvaI/XbaI-digested pSPCFTR vector (34), generating plasmids pSPCFTR(E92A) and pSPCFTR(K95A). Login to comment 43 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala Plasmid pSPCFTR(E92A/ K95A) was generated by PCR amplification of pSPCFTR(E92A) (sense primer (SP6 promoter) ATTTAGGTGACACTATAG, and antisense primer TACTGCAGCGGTGACGGCGCCTAA), digestion of the PCR fragment with AvaI/PstI (PstI encoded in antisense oligonucleotides) and ligation of the fragment into an AvaI/PstI digested pSPCFTRK95A vector. Plasmids pSPCFTR(G85E) and pSPCFTR(G91R) are described elsewhere (33). Login to comment 44 ABCC7 p.Gly85Glu ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(E95A), and TM1.P(E92A/E95A) were constructed by PCR amplification of WT or corresponding mutant CFTR plasmids (sense primer (SP6 promoter), antisense primer TAGATAGGTCACCATAGAGCGTTCCTCCT) and ligation of HindIII/BstEII-digested PCR fragments into a HindIII/BstEII-digested vector, S.L.ST.gG.P (described in Ref. Login to comment 45 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(E95A), and TM1.P(E92A/E95A) were constructed by PCR amplification of WT or corresponding mutant CFTR plasmids (sense primer (SP6 promoter), antisense primer TAGATAGGTCACCATAGAGCGTTCCTCCT) and ligation of HindIII/BstEII-digested PCR fragments into a HindIII/BstEII-digested vector, S.L.ST.gG.P (described in Ref. 18). Login to comment 47 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys CFTR mutations ⌬;E115, E116K, E115K/E116K, and G126D were engineered by PCR overlap extension (35) using sense primers: 1) CCGGATAA- CAAGGAACGCTCTATC, 2) GATAACAAGGAGAAACGCTCTATCGCG, 3) AACAAGAAAAAACGGTCCATCGCGATTTATCTAGGC, 4) GATTTATC- TAGGCATAGACTTATGCCTTCTC, respectively, and complimentary antisense primers (not shown) to generate overlapping 5Ј and 3Ј PCR fragments. Login to comment 49 ABCC7 p.Glu115Lys PCR fragments from this "fusion" reaction were digested with AvaI/XbaI and ligated into AvaI/XbaI-digested pSPCFTR vector. Plasmids TM1-2.P encoding ⌬E115, E116K, E115K/E116K, and G126D mutations were generated by PCR amplification of respective mutant pSPCFTR plasmids using sense primer (SP6 promoter) and antisense primer 5) AAATTTGGTCAC- CTTGTTGGAAAGGAGACT. Login to comment 50 ABCC7 p.Glu115Lys Plasmids TM1-2.P encoding DE115, E116K, E115K/E116K, and G126D mutations were generated by PCR amplification of respective mutant pSPCFTR plasmids using sense primer (SP6 promoter) and antisense primer 5) AAATTTGGTCAC- CTTGTTGGAAAGGAGACT. Login to comment 52 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys Plasmids TM1-2.P encoding mutations E116K/G126D and E115K/E116K/G126D were constructed by PCR overlap extension using primers 2 and 3 and pSPCFTR(G126D) template. Login to comment 53 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys Similarly, plasmids TM1-2.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (5Ј template pSPCFTR(E92A/K95A) and 3Ј template pSPCFTR(G126D); (c) primer 3 (5Ј template pSPCFTR(E92A/ K95A) 3Ј template pSPCFTR(G126D)). Login to comment 54 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys Similarly, plasmids TM12.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (59 template pSPCFTR(E92A/K95A) and 39 template pSPCFTR(G126D); (c) primer 3 (59 template pSPCFTR(E92A/ K95A) 39 template pSPCFTR(G126D)). Login to comment 55 ABCC7 p.Gly85Glu ABCC7 p.Gly85Glu ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 5Ј PCR reactions. Login to comment 56 ABCC7 p.Gly85Glu ABCC7 p.Gly85Glu ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 59 PCR reactions. Login to comment 82 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg In contrast to WT chains, no protease-protected fragments were observed for TM1.P(G85E) or TM1.P(G91R) chains, demonstrating that these inherited cystic fibrosis-related mutations abolished the ability of TM1 to direct translocation of the P reporter (lanes 4-6 and 7-9, respectively). Login to comment 83 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg In contrast to WT chains, no protease-protected fragments were observed for TM1.P(G85E) or TM1.P(G91R) chains, demonstrating that these inherited cystic fibrosis-related mutations abolished the ability of TM1 to direct translocation of the P reporter (lanes 4-6 and 7-9, respectively). Login to comment 88 ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala We therefore examined translocation efficiency of polypeptides generated from plasmids TM1.P(E92A), TM1.P(K95A) and TM1.P(E92A/K95A). Login to comment 89 ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala As shown in Fig. 1A, lanes 10-18, the E92A and E92A/K95A mutations both improved TM1 signal sequence activity (43% and 79% of P translocated, respectively), whereas the K95A mutation by itself had little effect (10% of P translocated). Login to comment 90 ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala As shown in Fig. 1A, lanes 10-18, the E92A and E92A/K95A mutations both improved TM1 signal sequence activity (43% and 79% of P translocated, respectively), whereas the K95A mutation by itself had little effect (10% of P translocated). Login to comment 95 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(K95A), and TM1.P- (E92A/K95A) were expressed in rabbit reticulocyte lysate supplemented with canine pancreas microsomal membranes (A) or in microinjected Xenopus oocytes (B) as described under "Materials and Methods." Login to comment 96 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg ABCC7 p.Lys95Ala ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(K95A), and TM1.P- (E92A/K95A) were expressed in rabbit reticulocyte lysate supplemented with canine pancreas microsomal membranes (A) or in microinjected Xenopus oocytes (B) as described under "Materials and Methods." Login to comment 103 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala located); (ii) G85E and G91R mutations essentially abolished TM1 signal sequence activity (Ͻ5% of chains translocated); and (iii) E92A and E92A/K95A mutations improved TM1 signal sequence activity (36% and 70% of chains translocated, respectively). Login to comment 104 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala located); (ii) G85E and G91R mutations essentially abolished TM1 signal sequence activity (,5% of chains translocated); and (iii) E92A and E92A/K95A mutations improved TM1 signal sequence activity (36% and 70% of chains translocated, respectively). Login to comment 105 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg This, however, was not the case because greater than 70% of WT as well as G85E and G91R chains achieved their correct N terminus topology in the ER membrane ((33) and Fig. 4). Login to comment 106 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg This, however, was not the case because greater than 70% of WT as well as G85E and G91R chains achieved their correct N terminus topology in the ER membrane ((33) and Fig. 4). Login to comment 120 ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys To better define the role of TM2 in directing CFTR topology, we attempted to decrease TM2 signal sequence activity by introducing three mutations previously identified in cystic fibrosis patients (G126D, ⌬E115, and E116K) (39). Login to comment 121 ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys To better define the role of TM2 in directing CFTR topology, we attempted to decrease TM2 signal sequence activity by introducing three mutations previously identified in cystic fibrosis patients (G126D, DE115, and E116K) (39). Login to comment 122 ABCC7 p.Glu116Lys Mutations ⌬E115 or E116K had only minor effects on TM2 signal sequence activity based on the fraction of glycosylated chains (Fig. 3A, lanes 1-6). Login to comment 123 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment 124 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment 126 ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys PK digestion of mutant ggTM2.P chains (⌬E115, E116K, and E115K/E116K) indicated that the introduction of basic residues flanking the N terminus of TM2, altered TM2 translocation specificity and enabled TM2 to translocate C terminus flanking sequences in a subset of chains. Login to comment 127 ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys This was particularly evident for the E115K/E116K mutant (Fig. 3B, lanes 1-9, upward ar- FIG. 2. Login to comment 128 ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys This was particularly evident for the E115K/E116K mutant (Fig. 3B, lanes 1-9, upward ar- FIG. 2. Login to comment 139 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment 140 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment 143 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys ABCC7 p.Glu115Lys CFTR cDNA encoding mutations, ⌬;E115, E116K, E115K/E116K, E116K/G126D or E115K/E116K/G126D was therefore truncated at codon Asn186 , and the topology of chains was determined in RRL (Fig. 4). Login to comment 144 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg Plasmids encoding TM1 mutations, G85E and G91R (33), were also included for comparison. Login to comment 154 ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys However, TM2 mutations E116K/G126D and E115K/E116K/G126D had a relatively minor but reproducible effect on CFTR N terminus topology, 82 and 79% of WT translocation activity, respectively (Fig. 4B, lanes 16-24 and Fig. 5, A and B). Login to comment 155 ABCC7 p.Gly85Glu ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Glu116Lys ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys When the TM1 mutation G85E was introduced into chains containing E116K/G126D or E115K/E116K/G126D mutations, translocation efficiency was further reduced to 45% and 48% of WT levels, respectively (Fig. 5, A and B). Login to comment 158 ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala This conclusion was further supported by the observation that improving TM1 signal sequence activity using the mutant E92A/ K95A completely restored N terminus translocation in TM2 mutants (Fig. 5). Login to comment 159 ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys Thus an efficient signal sequence in either the TM1 or the TM2 position was sufficient to ensure proper CFTR N terminus topology. We also observed that the E115K/E116K mutation, which partially reversed TM2 translocation specificity, was more disruptive than other TM2 mutations. Login to comment 160 ABCC7 p.Gly85Glu ABCC7 p.Glu116Lys ABCC7 p.Glu115Lys Only 55% of truncated E115K/E116K chains achieved correct topology (Fig. 5C), and the G85E mutation had little effect on these chains. Login to comment 161 ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala Furthermore, even an efficient TM1 signal sequence (E92A/K95A) restored translocation efficiency to only 69% of WT levels. Login to comment 191 ABCC7 p.Gly85Glu ABCC7 p.Gly91Arg Furthermore, even chains containing a completely defective TM1 signal sequence (G85E and G91R mutants) were properly oriented in the membrane but only if a functional TM2 signal sequence was present. Login to comment 234 ABCC7 p.Lys95Ala ABCC7 p.Glu92Ala ABCC7 p.Glu92Ala Consistent with this view, we observed that full-length CFTR encoding E92A or the double mutation, E92A/ K95A, exhibited markedly reduced chloride channel activity when expressed in Xenopus oocytes.3 In addition, scanning cysteine accessibility studies have revealed that Lys95 resides on a hydrophilic surface of TM1 and likely faces the CFTR chloride channel pore, whereas Glu92 appears to face 40° away from the pore surface, suggesting that it contributes to ionic interactions within the plane of the bilayer (67). Login to comment