ABCMdb

ABCC7 p.Glu116Lys

ClinVar:	c.346G>A , p.Glu116Lys ? , not provided c.346G>C , p.Glu116Gln ? , not provided
CF databases:	c.346G>A , p.Glu116Lys (CFTR1) D , A missense mutation in exon 4 of the CFTR gene was detected by DGGE and identified by direct sequencing. The nucleotide position 478 is chnaged from G to A, leading to a subsitution of glutamic acid for lysine at position 116. This mutation abolishes a MnI restriction site. The mutation on the other chromosome is the deletion of [delta]F508 c.346G>C , p.Glu116Gln (CFTR1) ? , This mutation was detected in a thirty year old male with UAVD by multiplex heteroduplex analysis on the MDE gel matrix and direct sequencing. The patient was also heterozygous for the [delta]F508 mutation. Clinical Data: UAVD, borderline sweat test, chronic sinusitis
Predicted by SNAP2:	A: N (72%), C: D (59%), D: N (87%), F: D (71%), G: N (61%), H: D (63%), I: N (61%), K: N (61%), L: N (57%), M: D (63%), N: N (78%), P: N (57%), Q: N (82%), R: N (57%), S: N (78%), T: N (78%), V: N (66%), W: D (75%), Y: D (66%),
Predicted by PROVEAN:	A: N, C: D, D: N, F: D, G: N, H: N, I: N, K: N, L: D, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, V: N, W: N, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Disease-associated mutations in the extracytoplasm... J Biol Chem. 2001 May 4;276(18):14848-54. Epub 2001 Feb 6. Hammerle MM, Aleksandrov AA, Riordan JR
Disease-associated mutations in the extracytoplasmic loops of cystic fibrosis transmembrane conductance regulator do not impede biosynthetic processing but impair chloride channel stability.
J Biol Chem. 2001 May 4;276(18):14848-54. Epub 2001 Feb 6., 2001-05-04 [PMID:11278813]

Abstract [show]
Consistent with its function as a chloride channel regulated entirely from the cytoplasmic side of the plasma membrane, the cystic fibrosis transmembrane conductance regulator (CFTR) glycoprotein exposes little of its mass on the exterior surface of cells. The first and fourth extracytoplasmic loops (ELs) contain approximately 15 and 30 residues, respectively; the other four ELs are extremely short. To examine the influence of missense mutants in ELs detected in patients with cystic fibrosis, we have expressed them in mammalian (baby hamster kidney (BHK21)) cells and assessed their biosynthetic processing and chloride channel activity. In contrast to previous findings that 18 of 30 disease-associated missense mutations in cytoplasmic loops caused retention of the nascent polypeptides in the endoplasmic reticulum, all the EL mutants studied matured and were transported to the cell surface. This pronounced asymmetry is consistent with the notion that endoplasmic reticulum quality control of nascent CFTR is exerted primarily on the cytoplasmic side of the membrane. Although this set of EL mutations has little effect on CFTR maturation, most of them seriously compromise its chloride channel activity. Substitutions at six different positions in EL1 and single positions in EL2 and EL4 all destabilized the open state, some of them severely, indicating that the ELs contribute to the stability of the CFTR ion pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 TABLE I Oligonucleotide primers used to generate mutations Mutation Primer S108F GGAAGAATCATAGCTTtCTATGACCCGGATAAC Y109C AGAATCATAGCTTCCTgTGACCCGGATAACAAG D110H ATCATAGCTTCCTATcACCCGGATAACAAGGAG P111A ATAGCTTCCTATGACgCGGATAACAAGGAGGAA P111L ATAGCTTCCTATGACCtGGATAACAAGGAGGAA E116K CCGGATAACAAGGAGaAACGCTCTATCGCGATT R117C GATAACAAGGAGGAAtGCTCTATCGCGATTTAT R117H GATAACAAGGAGGAACaCTCTATCGCGATTTAT R117L GATAACAAGGAGGAACtCTCTATCGCGATTTAT R117P GATAACAAGGAGGAACcCTCTATCGCGATTTAT E217G ATGGGGCTAATCTGGGgGTTGTTACAGGCGTCT T908N TATGCAGTGATTATCAaCAGCACCAGTTCGTAT P1013L GTCGCAGTTTTACAACtCTACATCTTTGTTGCA FIG. 2. Login to comment
86 However, in the case of E116K the surface signal is disproportionally weaker relative to the immunoblot indicating that it could be somewhat impeded in transport to the cell surface. Login to comment
118 B, squares, P111A; circles, P111L; triangles, E116K. Login to comment
135 The mutation five residues further in the C-terminal direction resulted in a charge reversal (E116K). Login to comment
142 Both R117C and R117L had very unstable open states like S108F and E116K with the cysteine substitution able to maintain openings FIG. 4. Login to comment
171 For example a nucleotide binding domain mutation, G551D, precludes virtually all TABLE II Relative charge transport capacity of mutants Mutants S108F Y109C D110H P111L P111A E116K R117H R117C R117L R117P E217G T908N P1013L Imutant/Iwt 100% 11 15 27 173 105 12 80 27 5 11 10 48 170 FIG. 5. Login to comment
183 The charge-reversal mutation, E116K, at the immediately preceding position had a remarkably similar effect to that of the most perturbing substitutions of Arg-117. Login to comment

[hide] Non-classic cystic fibrosis associated with D1152H... Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15. Burgel PR, Fajac I, Hubert D, Grenet D, Stremler N, Roussey M, Siret D, Languepin J, Mely L, Fanton A, Labbe A, Domblides P, Vic P, Dagorne M, Reynaud-Gaubert M, Counil F, Varaigne F, Bienvenu T, Bellis G, Dusser D
Non-classic cystic fibrosis associated with D1152H CFTR mutation.
Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15., [PMID:19843100]

Abstract [show]
BACKGROUND: Limited knowledge exists on phenotypes associated with the D1152H cystic fibrosis transmembrane conductance regulator (CFTR) mutation. METHODS: Subjects with a D1152H allele in trans with another CFTR mutation were identified using the French Cystic Fibrosis Registry. Phenotypic characteristics were compared with those of pancreatic insufficient (PI) and pancreatic sufficient (PS) cystic fibrosis (CF) subjects in the Registry (CF cohort). RESULTS: Forty-two subjects with D1152H alleles were identified. Features leading to diagnosis included chronic sinopulmonary disease (n = 25), congenital absence of the vas deferens (n = 11), systematic neonatal screening (n = 4), and genetic counseling (n = 2). Median age at diagnosis was 33 [interquartile range (IQR, 24-41)] years in D1152H subjects. Median sweat chloride concentrations were 43.5 (39-63) mmol/l in D1152H subjects and were markedly lower than in PI and PS CF subjects (p < 0.05). Bronchiectasis was present in 67% of D1152H subjects, but Pseudomonas aeruginosa colonization and pancreatic insufficiency were present in <30% of subjects. Estimated rates of decline in forced expiratory volume in 1 s (FEV(1)) were lower in D1152H subjects vs PI CF subjects (p < 0.05). None of the D1152H subjects identified since 1999 had died or required lung transplantation. CONCLUSIONS: When present in trans with a CF-causing mutation, D1152H causes significant pulmonary disease, but all subjects had prolonged survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Diagnostic features in 42 D1152H subjects according to the other CFTR mutation class Subject Sex (M/F) Other CFTR mutation Sweat Cl- mean (mmol/l) Age at diagnosis (years) Presentation at diagnosis Class I mutations 1 F W1282X 58 4 Pneumonia recurrent bronchitis 2 F W1282X 25 74 Bronchiectasis 3 M W1282X 43 33 CBAVD 4 M G542X 48 39 CBAVD 5 M G542X 72 27 CBAVD 6 F S1206X 18 13 Recurrent bronchitis+ diarrhea 7 F 394delTT 19 41 Bronchiectasis 8 F 394delTT 25 18 Bronchiectasis 9 F Q552X 56 43 Bronchiectasis Class II mutations 10 F F508del 13 42 Bronchiectasis 11 F F508del 40 32 Bronchiectasis 12 F F508del 52 23 Bronchiectasis 13 M F508del 51 15 Bronchiectasis 14 F F508del 100 24 Bronchiectasis 15 M F508del 79 26 Bronchiectasis 16 F F508del - 43 Bronchiectasis 17 M F508del - 23 Bronchiectasis 18 F F508del 19 55 Bronchiectasis 19 F F508del 25 33 Bronchiectasis 20 F F508del 78 15 Bronchiectasis 21 M F508del 90 40 Bronchiectasis 22 F F508del 44 42 Bronchiectasis 23 M F508del 88 11 Bronchiectasis 24 F F508del 63 47 Bronchiectasis 25 F F508del 43 33 Bronchiectasis 26 M F508 del 62 49 Bronchiectasis 27 M F508del 20 - CBAVD 28 M F508del - 27 CBAVD 29 M F508del 42 36 CBAVD 30 M F508del 36 34 CBAVD 31 M F508del 40 36 CBAVD 32 M F508del 41 30 CBAVD 33 M F508del 82 9 Asymptomatic genetic counseling 34 M F508del - 0 Neonatal screening 35 F F508del 53 0 Neonatal screening 36 F F508del 35 0 Neonatal screening 37 M F508del 35 0 Neonatal screening Class III mutation 38 F S549N 75 31 Bronchiectasis Class IV mutations 39 M E116K 80 41 ABPA+ diarrhea 40 M D1152H 34 34 CBAVD 41 M R1070Q 56 38 CBAVD Class V mutation 42 M 3849+10kbC>T 31 40 Asymptomatic genetic counseling ABPA, allergic bronchopulmonary aspergillosis; CBAVD, congenital bilateral absence of the vas deferens. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 While ⌬F508 was homozygous in six subjects, seven other less common alleles (G542X, W1204X, R75X, V232D, E116K, T501A, 3272-26 AϾG) were also seen in the homozygous state. Login to comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 g D44G, 300delA, W57X, 405+1G>A, D110H, E116K, 541del4, 542del7, L137R, 621+2T>G, I175V, H199R, H199Y, C225X, V232D, Q290X, E292X, G314V, T338I, 1221delCT, W401X, Q452P, I502T, 1716+2T>C, G544S, R560S, A561E, V562I, Y569D, 1898+3A>G, 1898+5G>A, G628R(G>A), 2143delT, G673X, R851X, Q890X, S977F, 3129del4, 3154delG, 3271+1G>A, G1061R, R1066L, R1070W, 3601-17T>C, S1196X, 3732delA, G1249R, 3898insC, 4374+1G>A, del25kb. Login to comment

[hide] Co- and posttranslational translocation mechanisms... J Biol Chem. 1998 Jan 2;273(1):568-76. Lu Y, Xiong X, Helm A, Kimani K, Bragin A, Skach WR
Co- and posttranslational translocation mechanisms direct cystic fibrosis transmembrane conductance regulator N terminus transmembrane assembly.
J Biol Chem. 1998 Jan 2;273(1):568-76., [PMID:9417117]

Abstract [show]
Transmembrane topology of most eukaryotic polytopic proteins is established cotranslationally at the endoplasmic reticulum membrane through the action of alternating signal and stop transfer sequences. Here we demonstrate that the cystic fibrosis transmembrane conductance regulator (CFTR) achieves its N terminus topology through a variation of this mechanism that involves both co- and posttranslational translocation events. Using a series of defined chimeric and truncated proteins expressed in a reticulocyte lysate system, we have identified two topogenic determinants encoded within the first (TM1) and second (TM2) membrane-spanning segments of CFTR. Each sequence independently (i) directed endoplasmic reticulum targeting, (ii) translocated appropriate flanking residues, and (iii) achieved its proper membrane-spanning orientation. Signal sequence activity of TM1, however, was inefficient due to the presence of two charged residues, Glu92 and Lys95, located within its hydrophobic core. As a result, TM1 was able to direct correct topology for less than half of nascent CFTR chains. In contrast to TM1, TM2 signal sequence activity was both efficient and specific. Even in the absence of a functional TM1 signal sequence, TM2 was able to direct CFTR N terminus topology through a ribosome-dependent posttranslational mechanism. Mutating charged residues Glu92 and Lys95 to alanine improved TM1 signal sequence activity as well as the ability of TM1 to independently direct CFTR N terminus topology. Thus, a single functional signal sequence in either the first or second TM segment was sufficient for directing proper CFTR topology. These results identify two distinct and redundant translocation pathways for CFTR N terminus transmembrane assembly and support a model in which TM2 functions to ensure correct topology of CFTR chains that fail to translocate via TM1. This novel arrangement of topogenic information provides an alternative to conventional cotranslational pathways of polytopic protein biogenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR mutations ⌬;E115, E116K, E115K/E116K, and G126D were engineered by PCR overlap extension (35) using sense primers: 1) CCGGATAA- CAAGGAACGCTCTATC, 2) GATAACAAGGAGAAACGCTCTATCGCG, 3) AACAAGAAAAAACGGTCCATCGCGATTTATCTAGGC, 4) GATTTATC- TAGGCATAGACTTATGCCTTCTC, respectively, and complimentary antisense primers (not shown) to generate overlapping 5Ј and 3Ј PCR fragments. Login to comment
52 Plasmids TM1-2.P encoding mutations E116K/G126D and E115K/E116K/G126D were constructed by PCR overlap extension using primers 2 and 3 and pSPCFTR(G126D) template. Login to comment
53 Similarly, plasmids TM1-2.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (5Ј template pSPCFTR(E92A/K95A) and 3Ј template pSPCFTR(G126D); (c) primer 3 (5Ј template pSPCFTR(E92A/ K95A) 3Ј template pSPCFTR(G126D)). Login to comment
55 Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 5Ј PCR reactions. Login to comment
120 To better define the role of TM2 in directing CFTR topology, we attempted to decrease TM2 signal sequence activity by introducing three mutations previously identified in cystic fibrosis patients (G126D, ⌬E115, and E116K) (39). Login to comment
122 Mutations ⌬E115 or E116K had only minor effects on TM2 signal sequence activity based on the fraction of glycosylated chains (Fig. 3A, lanes 1-6). Login to comment
123 However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment
126 PK digestion of mutant ggTM2.P chains (⌬E115, E116K, and E115K/E116K) indicated that the introduction of basic residues flanking the N terminus of TM2, altered TM2 translocation specificity and enabled TM2 to translocate C terminus flanking sequences in a subset of chains. Login to comment
127 This was particularly evident for the E115K/E116K mutant (Fig. 3B, lanes 1-9, upward ar- FIG. 2. Login to comment
139 For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment
143 CFTR cDNA encoding mutations, ⌬;E115, E116K, E115K/E116K, E116K/G126D or E115K/E116K/G126D was therefore truncated at codon Asn186 , and the topology of chains was determined in RRL (Fig. 4). Login to comment
154 However, TM2 mutations E116K/G126D and E115K/E116K/G126D had a relatively minor but reproducible effect on CFTR N terminus topology, 82 and 79% of WT translocation activity, respectively (Fig. 4B, lanes 16-24 and Fig. 5, A and B). Login to comment
155 When the TM1 mutation G85E was introduced into chains containing E116K/G126D or E115K/E116K/G126D mutations, translocation efficiency was further reduced to 45% and 48% of WT levels, respectively (Fig. 5, A and B). Login to comment
159 Thus an efficient signal sequence in either the TM1 or the TM2 position was sufficient to ensure proper CFTR N terminus topology. We also observed that the E115K/E116K mutation, which partially reversed TM2 translocation specificity, was more disruptive than other TM2 mutations. Login to comment
160 Only 55% of truncated E115K/E116K chains achieved correct topology (Fig. 5C), and the G85E mutation had little effect on these chains. Login to comment
54 Similarly, plasmids TM12.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (59 template pSPCFTR(E92A/K95A) and 39 template pSPCFTR(G126D); (c) primer 3 (59 template pSPCFTR(E92A/ K95A) 39 template pSPCFTR(G126D)). Login to comment
56 Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 59 PCR reactions. Login to comment
121 To better define the role of TM2 in directing CFTR topology, we attempted to decrease TM2 signal sequence activity by introducing three mutations previously identified in cystic fibrosis patients (G126D, DE115, and E116K) (39). Login to comment
124 However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment
128 This was particularly evident for the E115K/E116K mutant (Fig. 3B, lanes 1-9, upward ar- FIG. 2. Login to comment
140 For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment

[hide] Three charged amino acids in extracellular loop 1 ... J Gen Physiol. 2014 Aug;144(2):159-79. doi: 10.1085/jgp.201311122. Epub 2014 Jul 14. Cui G, Rahman KS, Infield DT, Kuang C, Prince CZ, McCarty NA
Three charged amino acids in extracellular loop 1 are involved in maintaining the outer pore architecture of CFTR.
J Gen Physiol. 2014 Aug;144(2):159-79. doi: 10.1085/jgp.201311122. Epub 2014 Jul 14., [PMID:25024266]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) bears six extracellular loops (ECL1-6); ECL1 is the site of several mutations associated with CF. Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability. We hypothesized that these amino acids might not be directly involved in ion conduction and permeation but may contribute to stabilizing the outer vestibule architecture in CFTR. We used cRNA injected oocytes combined with electrophysiological techniques to test this hypothesis. Mutants bearing cysteine at these sites were not functionally modified by extracellular MTS reagents and were blocked by GlyH-101 similarly to WT-CFTR. These results suggest that these three residues do not contribute directly to permeation in CFTR. In contrast, mutants D110R-, E116R-, and R117A-CFTR exhibited instability of the open state and significantly shortened burst duration compared with WT-CFTR and failed to be locked into the open state by AMP-PNP (adenosine 5'-(beta,gamma-imido) triphosphate); charge-retaining mutants showed mainly the full open state with comparably longer open burst duration. These interactions suggest that these ECL1 residues might be involved in maintaining the outer pore architecture of CFTR. A CFTR homology model suggested that E116 interacts with R104 in both the closed and open states, D110 interacts with K892 in the fully closed state, and R117 interacts with E1126 in the open state. These interactions were confirmed experimentally. The results suggest that D110, E116, and R117 may contribute to stabilizing the architecture of the outer pore of CFTR by interactions with other charged residues.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability. Login to comment
31 H&#e4;mmerle et al. (2001) reported that mutations D110H, E116K, and R117H induce no trafficking defect when expressed in baby hamster kidney (BHK) cells but affect channel function significantly. Login to comment
32 When studied in planar lipid bilayers, R117H-CFTR had gating kinetics similar to WT-CFTR, but a reduced single-channel conductance, whereas D110H- and E116K- CFTR displayed unstable channel openings, leading the authors to propose that ECL1 might contribute to maintaining the open pore architecture of CFTR (H&#e4;mmerle et al., 2001). Login to comment
36 CF-causing mutations have been identified in ECL1, including S108F, Y109C/N, D110H/ Y/N,P111A/L,E116K/Q,andR117C/G/H/P/L.Among these residues, D110, E116, and R117 are charged amino acids fully conserved among nine species (Fig. 1 A). Login to comment