ABCMdb

ABCC7 p.Glu92Ala

ClinVar:	c.274G>T , p.Glu92* D , Pathogenic c.276A>T , p.Glu92Asp ? , not provided c.274G>A , p.Glu92Lys D , Pathogenic
CF databases:	c.274G>T , p.Glu92* D , CF-causing c.274G>A , p.Glu92Lys D , CF-causing ; CFTR1: E92K was detected in one Spanish chromosome out of 100 non-[delta]F508 chromosomes studied. The mutation on the other chromosome of this patient is unknown, but has the haplotype C/D. The mutation has been detected by SSCP analysis of exon 4 PCR product using intronic primers. Th ebase change has been confirmed after recovering the mutated strand from the SSCP gel, purified and directly sequenced using an automatic sequencer. c.276A>T , p.Glu92Asp (CFTR1) ? , The patient carries two other mutations: 3849+10kbC>T and R668C (2134C>T). Although segregation analysis was not performed, we suggest the putative 3849+10kbC>T;R668C/E92D compound genotype in the patient, as we already found the complex allele 3849+10kbC>T;R668C in another patient. Residue E92 is conserved between species but not in other proteins of the CFTR family, where Asp can be found instead. A mild splicing effect of the mutation is also possible.
Predicted by SNAP2:	A: D (91%), C: D (95%), D: D (91%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: N (53%), L: D (95%), M: D (91%), N: D (95%), P: D (95%), Q: D (85%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: N, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: N, P: D, Q: N, R: D, S: N, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] p97 functions as an auxiliary factor to facilitate... EMBO J. 2006 Oct 4;25(19):4557-66. Epub 2006 Sep 14. Carlson EJ, Pitonzo D, Skach WR
p97 functions as an auxiliary factor to facilitate TM domain extraction during CFTR ER-associated degradation.
EMBO J. 2006 Oct 4;25(19):4557-66. Epub 2006 Sep 14., 2006-10-04 [PMID:16977321]

Abstract [show]
The AAA-ATPase (ATPase associated with various cellular activities) p97 has been implicated in the degradation of misfolded and unassembled proteins in the endoplasmic reticulum (ERAD). To better understand its role in this process, we used a reconstituted cell-free system to define the precise contribution of p97 in degrading immature forms of the polytopic, multi-domain protein CFTR (cystic fibrosis transmembrane conductance regulator). Although p97 augmented both the rate and the extent of CFTR degradation, it was not obligatorily required for ERAD. Only a 50% decrease in degradation was observed in the complete absence of p97. Moreover, p97 specifically stimulated the degradation of CFTR transmembrane (TM) domains but had no effect on isolated cytosolic domains. Consistent with this, p97-mediated extraction of intact TM domains was independent of proteolytic cleavage and influenced by TM segment hydrophobicity, indicating that the relative contribution of p97 is partially determined by substrate stability. Thus, we propose that p97 functions in ERAD as a nonessential but important ancillary component to the proteasome where it facilitates substrate presentation and increases the degradation rate and efficiency of stable (TM) domains.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 The TM1-2 E92A/K95A mutations had a striking effect, decreasing the initial degradation rate by B2.5-fold (0.2870.03/min) in the presence of p97 (Figure 6E and F), and further decreasing the degradation rate by an additional 2.3-fold following p97 depletion (0.1270.01/min). Login to comment
160 (B) Carbonate extraction of wild-type and E92A/K95A polypeptides. Login to comment
179 This also held true in the absence of p97 where the degradation rate of isolated NBD1 and NBD1-R domains was significantly faster than TMD1 and TM12(E92A/K95A). Login to comment
205 deg. rate -p97 (%/min) %increasewithp97 CFTR TMD1 TM1-2wt NBD-R NBD140 80 120 0 160 TM1-2 (E92A/K95A ) Figure 8 P97 effect is inversely related to the rate of degradation. Login to comment
221 Thus, p97 may play a key role in stimulating TM1-2 E92A/K95A degradation by providing a second step for substrate partitioning, thereby generating a locally unfolded domain that preferentially engages the AAA-ATPase ring of the 19S RC. Login to comment
237 Before pelleting, TM1-2 E92A/K95A was released from ribosomes by addition of 1 mM puromycin. Login to comment

[hide] Co- and posttranslational translocation mechanisms... J Biol Chem. 1998 Jan 2;273(1):568-76. Lu Y, Xiong X, Helm A, Kimani K, Bragin A, Skach WR
Co- and posttranslational translocation mechanisms direct cystic fibrosis transmembrane conductance regulator N terminus transmembrane assembly.
J Biol Chem. 1998 Jan 2;273(1):568-76., [PMID:9417117]

Abstract [show]
Transmembrane topology of most eukaryotic polytopic proteins is established cotranslationally at the endoplasmic reticulum membrane through the action of alternating signal and stop transfer sequences. Here we demonstrate that the cystic fibrosis transmembrane conductance regulator (CFTR) achieves its N terminus topology through a variation of this mechanism that involves both co- and posttranslational translocation events. Using a series of defined chimeric and truncated proteins expressed in a reticulocyte lysate system, we have identified two topogenic determinants encoded within the first (TM1) and second (TM2) membrane-spanning segments of CFTR. Each sequence independently (i) directed endoplasmic reticulum targeting, (ii) translocated appropriate flanking residues, and (iii) achieved its proper membrane-spanning orientation. Signal sequence activity of TM1, however, was inefficient due to the presence of two charged residues, Glu92 and Lys95, located within its hydrophobic core. As a result, TM1 was able to direct correct topology for less than half of nascent CFTR chains. In contrast to TM1, TM2 signal sequence activity was both efficient and specific. Even in the absence of a functional TM1 signal sequence, TM2 was able to direct CFTR N terminus topology through a ribosome-dependent posttranslational mechanism. Mutating charged residues Glu92 and Lys95 to alanine improved TM1 signal sequence activity as well as the ability of TM1 to independently direct CFTR N terminus topology. Thus, a single functional signal sequence in either the first or second TM segment was sufficient for directing proper CFTR topology. These results identify two distinct and redundant translocation pathways for CFTR N terminus transmembrane assembly and support a model in which TM2 functions to ensure correct topology of CFTR chains that fail to translocate via TM1. This novel arrangement of topogenic information provides an alternative to conventional cotranslational pathways of polytopic protein biogenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Mutating charged residues Glu92 and Lys95 to alanine improved TM1 signal sequence activity as well as the ability of TM1 to independently direct CFTR N terminus topology. Login to comment
41 MATERIALS AND METHODS cDNA Construction-E92A and K95A mutations were engineered into CFTR by site-directed mutagenesis using a single stranded (M-13) (plasmid pBQ 4.7) template and oligonucleotides TATATTTAGGCGCCGTCAC- CAAAGCAGT and GAAGTCACCGCTGCAGTACAGCCT as described (33). Login to comment
42 AvaI/XbaI fragments containing the engineered mutations were then ligated into an AvaI/XbaI-digested pSPCFTR vector (34), generating plasmids pSPCFTR(E92A) and pSPCFTR(K95A). Login to comment
43 Plasmid pSPCFTR(E92A/ K95A) was generated by PCR amplification of pSPCFTR(E92A) (sense primer (SP6 promoter) ATTTAGGTGACACTATAG, and antisense primer TACTGCAGCGGTGACGGCGCCTAA), digestion of the PCR fragment with AvaI/PstI (PstI encoded in antisense oligonucleotides) and ligation of the fragment into an AvaI/PstI digested pSPCFTRK95A vector. Plasmids pSPCFTR(G85E) and pSPCFTR(G91R) are described elsewhere (33). Login to comment
44 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(E95A), and TM1.P(E92A/E95A) were constructed by PCR amplification of WT or corresponding mutant CFTR plasmids (sense primer (SP6 promoter), antisense primer TAGATAGGTCACCATAGAGCGTTCCTCCT) and ligation of HindIII/BstEII-digested PCR fragments into a HindIII/BstEII-digested vector, S.L.ST.gG.P (described in Ref. Login to comment
53 Similarly, plasmids TM1-2.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (5Ј template pSPCFTR(E92A/K95A) and 3Ј template pSPCFTR(G126D); (c) primer 3 (5Ј template pSPCFTR(E92A/ K95A) 3Ј template pSPCFTR(G126D)). Login to comment
88 We therefore examined translocation efficiency of polypeptides generated from plasmids TM1.P(E92A), TM1.P(K95A) and TM1.P(E92A/K95A). Login to comment
89 As shown in Fig. 1A, lanes 10-18, the E92A and E92A/K95A mutations both improved TM1 signal sequence activity (43% and 79% of P translocated, respectively), whereas the K95A mutation by itself had little effect (10% of P translocated). Login to comment
95 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(K95A), and TM1.P- (E92A/K95A) were expressed in rabbit reticulocyte lysate supplemented with canine pancreas microsomal membranes (A) or in microinjected Xenopus oocytes (B) as described under "Materials and Methods." Login to comment
103 located); (ii) G85E and G91R mutations essentially abolished TM1 signal sequence activity (Ͻ5% of chains translocated); and (iii) E92A and E92A/K95A mutations improved TM1 signal sequence activity (36% and 70% of chains translocated, respectively). Login to comment
158 This conclusion was further supported by the observation that improving TM1 signal sequence activity using the mutant E92A/ K95A completely restored N terminus translocation in TM2 mutants (Fig. 5). Login to comment
161 Furthermore, even an efficient TM1 signal sequence (E92A/K95A) restored translocation efficiency to only 69% of WT levels. Login to comment
234 Consistent with this view, we observed that full-length CFTR encoding E92A or the double mutation, E92A/ K95A, exhibited markedly reduced chloride channel activity when expressed in Xenopus oocytes.3 In addition, scanning cysteine accessibility studies have revealed that Lys95 resides on a hydrophilic surface of TM1 and likely faces the CFTR chloride channel pore, whereas Glu92 appears to face 40° away from the pore surface, suggesting that it contributes to ionic interactions within the plane of the bilayer (67). Login to comment
45 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(E95A), and TM1.P(E92A/E95A) were constructed by PCR amplification of WT or corresponding mutant CFTR plasmids (sense primer (SP6 promoter), antisense primer TAGATAGGTCACCATAGAGCGTTCCTCCT) and ligation of HindIII/BstEII-digested PCR fragments into a HindIII/BstEII-digested vector, S.L.ST.gG.P (described in Ref. 18). Login to comment
54 Similarly, plasmids TM12.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (59 template pSPCFTR(E92A/K95A) and 39 template pSPCFTR(G126D); (c) primer 3 (59 template pSPCFTR(E92A/ K95A) 39 template pSPCFTR(G126D)). Login to comment
90 As shown in Fig. 1A, lanes 10-18, the E92A and E92A/K95A mutations both improved TM1 signal sequence activity (43% and 79% of P translocated, respectively), whereas the K95A mutation by itself had little effect (10% of P translocated). Login to comment
96 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(K95A), and TM1.P- (E92A/K95A) were expressed in rabbit reticulocyte lysate supplemented with canine pancreas microsomal membranes (A) or in microinjected Xenopus oocytes (B) as described under "Materials and Methods." Login to comment
104 located); (ii) G85E and G91R mutations essentially abolished TM1 signal sequence activity (,5% of chains translocated); and (iii) E92A and E92A/K95A mutations improved TM1 signal sequence activity (36% and 70% of chains translocated, respectively). Login to comment

[hide] Mechanisms of CFTR Folding at the Endoplasmic Reti... Front Pharmacol. 2012 Dec 13;3:201. doi: 10.3389/fphar.2012.00201. eCollection 2012. Kim SJ, Skach WR
Mechanisms of CFTR Folding at the Endoplasmic Reticulum.
Front Pharmacol. 2012 Dec 13;3:201. doi: 10.3389/fphar.2012.00201. eCollection 2012., [PMID:23248597]

Abstract [show]
In the past decade much has been learned about how Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) folds and misfolds as the etiologic cause of cystic fibrosis (CF). CFTR folding is complex and hierarchical, takes place in multiple cellular compartments and physical environments, and involves several large networks of folding machineries. Insertion of transmembrane (TM) segments into the endoplasmic reticulum (ER) membrane and tertiary folding of cytosolic domains begin cotranslationally as the nascent polypeptide emerges from the ribosome, whereas posttranslational folding establishes critical domain-domain contacts needed to form a physiologically stable structure. Within the membrane, N- and C-terminal TM helices are sorted into bundles that project from the cytosol to form docking sites for nucleotide binding domains, NBD1 and NBD2, which in turn form a sandwich dimer for ATP binding. While tertiary folding is required for domain assembly, proper domain assembly also reciprocally affects folding of individual domains analogous to a jig-saw puzzle wherein the structure of each interlocking piece influences its neighbors. Superimposed on this process is an elaborate proteostatic network of cellular chaperones and folding machineries that facilitate the timing and coordination of specific folding steps in and across the ER membrane. While the details of this process require further refinement, we finally have a useful framework to understand key folding defect(s) caused by DeltaF508 that provides a molecular target(s) for the next generation of CFTR small molecule correctors aimed at the specific defect present in the majority of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 For example, replacement of ionizable residues in TM1 (E92A and K95A) converts TM1 to a strong signal anchor sequence, thus favoring cotranslational topogenesis, but disrupts CFTR function (Lu et al., 1998; Patrick et al., 2011). Login to comment