ABCMdb

PMID: 21931512

Polizzi A, Tesse R, Santostasi T, Diana A, Manca A, Logrillo VP, Cazzato MD, Pantaleo MG, Armenio L
Genotype-phenotype correlation in cystic fibrosis patients bearing [H939R;H949L] allele.
Genet Mol Biol. 2011 Jul;34(3):416-20. Epub 2011 Jul 1., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCC7 p.His949Leu ABCC7 p.His939Arg We ascertained five patients with a novel complex CFTR allele, with two mutations, H939R and H949L, inherited in cis in the same exon of CFTR gene, and one different mutation per patient inherited in trans in a wide population of 289 Caucasian CF subjects from South Italy. Login to comment 17 ABCC7 p.His949Leu In 2005, we have described for the first time in the CF mutation database, the missense mutation H949L, a nucleotide change of A to T at base pair 2978 in exon 15 of CFTR gene, resulting in a substitution of histidine residue to leucine at codon 949, as potentially disease-associated allele variation. Login to comment 25 ABCC7 p.His949Leu ABCC7 p.His939Arg The Cystic Fibrosis Mutation Database lists the H939R missense mutation, a nucleotide substitution of A to G at base pair 2948 in the same exon of the mutation H949L, corresponding to a histidine to arginine amino acid change at codon 939. Login to comment 26 ABCC7 p.His939Arg The Authors also described the clinical phenothype of the patient, a 17 years old male, with the F508del/H939R genotype, mild expression of a chronic lung disease, pancreatic sufficiency, and unequivocally positive sweat chloride test result. Login to comment 27 ABCC7 p.His939Arg In this study we evaluated the contribution to the phenotype of the two CF-associated allele mutations [H939R;H949L], combined in cis in the same exon 15 of CFTR gene, which we observed for the first time in 5 unrelated CF patients. Login to comment 43 ABCC7 p.His949Leu ABCC7 p.His939Arg ABCC7 p.His939Arg During the genetic characterization of the 289 enrolled CF patients a new complex allele [H939R;H949L] (Human Genome Variation Society nomenclature c:[2816A>G;2846A>T] http://www.hgvs.org/ mutnomen) was found in five unrelated patients, in whom the two CF-associated mutations, H939R and H949L, were both carried in the exon 15 on the same allele, as showed in Figure 1. Login to comment 45 ABCC7 p.His939Arg The segregation analysis showed that the mother was the carrier of the complex allele [H939R;H949L] in four cases (patients 2, 3, 4 and 5; Table 1), while only in one case (patient 1) the father carried this complex allele (Table 1). Login to comment 46 ABCC7 p.His949Leu ABCC7 p.His939Arg We did not find patients bearing the H939R or the H949L mutations alone. Login to comment 47 ABCC7 p.His939Arg Polizzi et al. 417 Figure 1 - Sequence electropherograms showing the complex allele [H939R;H949L] in CFTR exon 15, (A) forward and (B) reverse (Forward primer: TCAGTAAGTAACTTTGGCTGC; Reverse primer: CCTATTGATGGTGGATCAGC). Login to comment 48 ABCC7 p.His949Leu ABCC7 p.His939Arg Continuous arrows show the H939R mutation while the dashed arrows show the H949L mutation. Login to comment 56 ABCC7 p.Arg668Cys During our screening analysis we also found thirteen males affected by congenital bilateral absence of vas deferens (CBAVD) bearing the intron 8 (IVS-8) variants TG13-T5 and TG12-T5 in compound heterozygosity with associated CF-causing mutations, and 2 sisters (of 7 and 9 years old respectively) carrying the [R668C;G576A] complex allele in compound heterozygosity with F508del CF mutation, showing a borderline sweat chloride test, recurrent asthmatic bronchitis and pancreatic sufficiency. Login to comment 58 ABCC7 p.His939Arg To our knowledge the complex allele [H939R;H949L] and its correlation to the CF phenotype were not previously described. Login to comment 59 ABCC7 p.Arg248Thr In the afore mentioned database the R248T mutation that we found in patient 1 was described as "mild", occurring in male patients with CBAVD and no other signs or symptoms, even when associated with another severe mutation. Login to comment 60 ABCC7 p.Gly1349Asp ABCC7 p.Gly542* ABCC7 p.His939Arg The other four patients were compound heterozygotes respectively for G542X, 1259insA, G1349D, F508del and the two associated mutation in exon 15 [H939R;H949L]. Login to comment 61 ABCC7 p.Gly1349Asp ABCC7 p.Gly542* The mutations G542X, 1259insA, G1349D, F508del have already been described as severe CF-asssociated mutation (Casals et al., 1993; Morral et al., 1993; Morral et al., 1994; Kerem et al., 1995; Estivill et al., 1997; Shrimpton et al., 1997; Rowntree and Harris 2003; Bompadre et al., 2007; Castellani et al., 2008). Login to comment 62 ABCC7 p.Gly1349Asp ABCC7 p.Arg1158* ABCC7 p.Leu1077Pro ABCC7 p.Asp579Gly ABCC7 p.Ile502Thr Particularly, 1259insA and G1349D represent with few other mutations, 4382delA, I502T, 852del22, 4016insT, D579G, R1158X and L1077P, almost 20% of the CF alleles found in the Apulian population (Castaldo et al., 2005; Polizzi et al., 2005). Login to comment 64 ABCC7 p.Gly542* Also the G542X prevents the synthesis of full-length, normal CFTR protein due to the creation of a premature termination codon (Rich et al., 1993; Rowntree and Harris, 2003). Login to comment 65 ABCC7 p.Gly1349Asp ABCC7 p.His939Arg On the other hand, the F508del mutation, a deletion of three bases encoding a phenylalanine residue at position 508 within the first nucleotide binding domain (NBD), affects CFTR maturation (class II mutations) (Rowntree and Harris, 2003), while the G1349D plays a role in ATP-dependent opening of the chloride channel, resulting in a defective CFTR activation 418 Novel complex allele in CF Table 1 - Clinical features of five unrelated patients with the complex allele [H939R;H949L]. Login to comment 66 ABCC7 p.Gly1349Asp ABCC7 p.Gly542* ABCC7 p.Arg248Thr ABCC7 p.His939Arg Patients characteris* Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Mutation in trans with [H939R;H949L] R248T G542X 1259insA G1349D F508del Sex male male male male male Present age (years) 15 15 17 20 25 Age at diagnosis (years) 14 3 0 10 10 Airways colonization No SA SA SA PA, BC Age of first colonization (years) / 9 6 12 14 BMI (kg/m2 ) 21.9 17.0 15.1 17.6 17.5 FEV1 as % predicted 84.4 114.8 80.9 93.2 53.7 Sweat chloride concentration (mEq/L) 78 100 108 92 95 S-K score 100 70 60 75 40 Brasfield scorez N/A 5 11 7 21 Pancreas status PS PI PI PI PI Diagnosis CFTR-RD CF CF CF CF SA = Staphilococcus aureus, PA = Pseudomonas aeruginosa, BC = Burkholderia cepacia; N/A = not applicable; S-K = Shwachman-Kulczycki: the system is based on four parameters (general activity, physical examination, growth and nutrition and chest radiograph x-ray), and is rated as a) excellent: 86-100 b) good: 71-85, c) mild: 56-70, d) moderate: 41-55, and e) severe: < 40 (Shwachman and Kulczyzki, 1958); z scoring system from 3 "mild" to 25 "most severe" (Brett et al., 1992) after x-ray; PS/PI = Pancreatic sufficiency/insufficiency. Login to comment 70 ABCC7 p.His949Leu ABCC7 p.His939Arg We speculate that both mutations H939R and H949L might affect the second NBD of CFTR and have a role in altering the conductance of the chloride channel, but to our knowledge there are no reports on their functions. Login to comment 71 ABCC7 p.Gly1349Asp ABCC7 p.Gly542* ABCC7 p.His939Arg In our study, the four patients carrying the complex allele [H939R;H949L] associated in trans with the severe mutations G542X, 1259insA, G1349D and F508del presented the classic CF phenotype. Login to comment 72 ABCC7 p.Arg248Thr On the contrary, patient 1 who carried the same complex allele with the R248T mutation showed a CFTR-RD (Table 1). Login to comment 73 ABCC7 p.Arg248Thr This is likely due to the fact that R248T is a mild mutation (thought to affect CFTR mRNA splicing based on the database: Cystic Fibrosis Mutation Database), and subjects carrying this mutation might have a residual function of the CFTR protein. Login to comment 74 ABCC7 p.His939Arg It seems that the complex allele [H939R;H949L] greatly reduces the residual function of CFTR and, when also on the other allele is present a severe mutation which produces a very low residual function, the combined effect is an overall great reduction of CFTR functionality; on the contrary, when the other allele carries a mild mutation, the overall effect is a cumulative greater CFTR functionality. Login to comment 75 ABCC7 p.Arg668Cys We also found in our CF population subjects carrying the variant tracts TG13-T5 and TG12-T5, which have been already described in males with CBAVD in the literature (Castellani et al., 2008; Dequeker et al., 2009), and the [R668C;G576A] complex allele. Login to comment 76 ABCC7 p.Arg668Cys ABCC7 p.Gly576Ala The R668C in exon 13 is considered a polymorphism (Pignatti et al., 1994) while the G576A, in CFTR exon 12, seems to induce a variable extent of exon skipping that leads to reduced levels of normal CFTR transcripts (Pagani et al., 2003). Login to comment 77 ABCC7 p.His949Leu ABCC7 p.His939Arg ABCC7 p.His939Arg The complex alleles and their role in disease pathogenesis still remain a challenge for both researchers and clinicians, thus more information on our newly discovered complex allele [H939R;H949L] or on the H939R and the H949L mutations alone would help to study the effect on the phenotype of these rare mutations. Login to comment