ABCMdb

ABCC7 p.His939Arg

ClinVar:	c.2815C>G , p.His939Asp ? , not provided c.2816A>G , p.His939Arg ? , not provided
CF databases:	c.2816A>G , p.His939Arg (CFTR1) D , Found by DGGE and DNA sequencing. (CF patient, genotype [delta]F508/H939R) c.2815C>G , p.His939Asp (CFTR1) ? , This mutation was identified by DGGE and direct sequencing. The other mutation is still unidentified.
Predicted by SNAP2:	A: D (59%), C: N (53%), D: D (71%), E: D (63%), F: D (59%), G: N (53%), I: D (66%), K: N (61%), L: D (63%), M: D (63%), N: N (72%), P: D (80%), Q: N (66%), R: D (53%), S: N (72%), T: D (53%), V: D (63%), W: D (66%), Y: N (72%),
Predicted by PROVEAN:	A: D, C: N, D: D, E: D, F: N, G: D, I: N, K: D, L: N, M: N, N: D, P: D, Q: N, R: D, S: D, T: D, V: D, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Genotype-phenotype correlation in cystic fibrosis ... Genet Mol Biol. 2011 Jul;34(3):416-20. Epub 2011 Jul 1. Polizzi A, Tesse R, Santostasi T, Diana A, Manca A, Logrillo VP, Cazzato MD, Pantaleo MG, Armenio L
Genotype-phenotype correlation in cystic fibrosis patients bearing [H939R;H949L] allele.
Genet Mol Biol. 2011 Jul;34(3):416-20. Epub 2011 Jul 1., [PMID:21931512]

Abstract [show]
Cystic fibrosis (CF) is caused by CFTR (cystic fibrosis transmembrane conductance regulator) gene mutations. We ascertained five patients with a novel complex CFTR allele, with two mutations, H939R and H949L, inherited in cis in the same exon of CFTR gene, and one different mutation per patient inherited in trans in a wide population of 289 Caucasian CF subjects from South Italy. The genotype-phenotype relationship in patients bearing this complex allele was investigated. The two associated mutations were related to classical severe CF phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 We ascertained five patients with a novel complex CFTR allele, with two mutations, H939R and H949L, inherited in cis in the same exon of CFTR gene, and one different mutation per patient inherited in trans in a wide population of 289 Caucasian CF subjects from South Italy. Login to comment
25 The Cystic Fibrosis Mutation Database lists the H939R missense mutation, a nucleotide substitution of A to G at base pair 2948 in the same exon of the mutation H949L, corresponding to a histidine to arginine amino acid change at codon 939. Login to comment
26 The Authors also described the clinical phenothype of the patient, a 17 years old male, with the F508del/H939R genotype, mild expression of a chronic lung disease, pancreatic sufficiency, and unequivocally positive sweat chloride test result. Login to comment
27 In this study we evaluated the contribution to the phenotype of the two CF-associated allele mutations [H939R;H949L], combined in cis in the same exon 15 of CFTR gene, which we observed for the first time in 5 unrelated CF patients. Login to comment
43 During the genetic characterization of the 289 enrolled CF patients a new complex allele [H939R;H949L] (Human Genome Variation Society nomenclature c:[2816A>G;2846A>T] http://www.hgvs.org/ mutnomen) was found in five unrelated patients, in whom the two CF-associated mutations, H939R and H949L, were both carried in the exon 15 on the same allele, as showed in Figure 1. Login to comment
45 The segregation analysis showed that the mother was the carrier of the complex allele [H939R;H949L] in four cases (patients 2, 3, 4 and 5; Table 1), while only in one case (patient 1) the father carried this complex allele (Table 1). Login to comment
46 We did not find patients bearing the H939R or the H949L mutations alone. Login to comment
47 Polizzi et al. 417 Figure 1 - Sequence electropherograms showing the complex allele [H939R;H949L] in CFTR exon 15, (A) forward and (B) reverse (Forward primer: TCAGTAAGTAACTTTGGCTGC; Reverse primer: CCTATTGATGGTGGATCAGC). Login to comment
48 Continuous arrows show the H939R mutation while the dashed arrows show the H949L mutation. Login to comment
58 To our knowledge the complex allele [H939R;H949L] and its correlation to the CF phenotype were not previously described. Login to comment
60 The other four patients were compound heterozygotes respectively for G542X, 1259insA, G1349D, F508del and the two associated mutation in exon 15 [H939R;H949L]. Login to comment
65 On the other hand, the F508del mutation, a deletion of three bases encoding a phenylalanine residue at position 508 within the first nucleotide binding domain (NBD), affects CFTR maturation (class II mutations) (Rowntree and Harris, 2003), while the G1349D plays a role in ATP-dependent opening of the chloride channel, resulting in a defective CFTR activation 418 Novel complex allele in CF Table 1 - Clinical features of five unrelated patients with the complex allele [H939R;H949L]. Login to comment
66 Patients characteris* Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Mutation in trans with [H939R;H949L] R248T G542X 1259insA G1349D F508del Sex male male male male male Present age (years) 15 15 17 20 25 Age at diagnosis (years) 14 3 0 10 10 Airways colonization No SA SA SA PA, BC Age of first colonization (years) / 9 6 12 14 BMI (kg/m2 ) 21.9 17.0 15.1 17.6 17.5 FEV1 as % predicted 84.4 114.8 80.9 93.2 53.7 Sweat chloride concentration (mEq/L) 78 100 108 92 95 S-K score 100 70 60 75 40 Brasfield scorez N/A 5 11 7 21 Pancreas status PS PI PI PI PI Diagnosis CFTR-RD CF CF CF CF SA = Staphilococcus aureus, PA = Pseudomonas aeruginosa, BC = Burkholderia cepacia; N/A = not applicable; S-K = Shwachman-Kulczycki: the system is based on four parameters (general activity, physical examination, growth and nutrition and chest radiograph x-ray), and is rated as a) excellent: 86-100 b) good: 71-85, c) mild: 56-70, d) moderate: 41-55, and e) severe: < 40 (Shwachman and Kulczyzki, 1958); z scoring system from 3 "mild" to 25 "most severe" (Brett et al., 1992) after x-ray; PS/PI = Pancreatic sufficiency/insufficiency. Login to comment
70 We speculate that both mutations H939R and H949L might affect the second NBD of CFTR and have a role in altering the conductance of the chloride channel, but to our knowledge there are no reports on their functions. Login to comment
71 In our study, the four patients carrying the complex allele [H939R;H949L] associated in trans with the severe mutations G542X, 1259insA, G1349D and F508del presented the classic CF phenotype. Login to comment
74 It seems that the complex allele [H939R;H949L] greatly reduces the residual function of CFTR and, when also on the other allele is present a severe mutation which produces a very low residual function, the combined effect is an overall great reduction of CFTR functionality; on the contrary, when the other allele carries a mild mutation, the overall effect is a cumulative greater CFTR functionality. Login to comment
77 The complex alleles and their role in disease pathogenesis still remain a challenge for both researchers and clinicians, thus more information on our newly discovered complex allele [H939R;H949L] or on the H939R and the H949L mutations alone would help to study the effect on the phenotype of these rare mutations. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment
152 Twenty-four non F508del mutations were found associated with the 9T allele: 394delTT, L90S, D110H, R117G, 621+1G>T, V232D, A455E, G542X, R851L, T908N, 2789+5G>A, 2896insAG, H939R, 3007delG, I980K, I1027T, R1066H, A1067T, D1154G, 3737delA, R74W+D1270N, N1303I, N1303K, D1377H. Login to comment