ABCMdb

ABCC7 p.Val520Phe

Admin's notes:	Class II (maturation defect) Veit et al.
ClinVar:	c.1558G>A , p.Val520Ile ? , Conflicting interpretations of pathogenicity, not provided c.1558G>T , p.Val520Phe D , Pathogenic
CF databases:	c.1558G>T , p.Val520Phe D , CF-causing ; CFTR1: Using the chemical cleavage technique and direct sequencing, a G to T transversion has been demonstrated, changing a valine residue to phenylalanine. Although not a strongly conserved residue, we believe that the substitution of an aromatic for an alpiphatic amino-acid may be of consequence. V520F has been found on 2 out of 26 CF chromosomes with unknown mutations. In both cases on the B haplotype. c.1558G>A , p.Val520Ile (CFTR1) ? , This mutation , in exon 10 of the CFTR gene, was detected by direct DNA sequencing and is a single base substitution from a guanine to an adenine at base 1690 of exon 10 of the CFTR gene. This results in the replacement of a Valine residue by an isoleucine in codon 520. The patient is a 7 year old boy from India and has an as yet unknown mutation on his other CF chromosome. We have seen this mutation once in 20 non-[delta]F508 CF chromosomes analysed by direct sequencing.
Predicted by SNAP2:	A: D (71%), C: D (80%), D: D (95%), E: D (95%), F: D (53%), G: D (95%), H: D (95%), I: D (66%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: N, K: D, L: N, M: N, N: D, P: D, Q: D, R: D, S: D, T: N, W: D, Y: D,

[switch to compact view]
Comments [show]

II (maturation defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Hybridization of glass-tethered oligonucleotide pr... Mol Biotechnol. 1999 Feb;11(1):1-12. Maldonado-Rodriguez R, Espinosa-Lara M, Calixto-Suarez A, Beattie WG, Beattie KL
Hybridization of glass-tethered oligonucleotide probes to target strands preannealed with labeled auxiliary oligonucleotides.
Mol Biotechnol. 1999 Feb;11(1):1-12., [PMID:10367278]

Abstract [show]
In this article we introduce a strategy of preannealing labeled auxiliary oligonucleotides to single-stranded target DNA, prior to hybridization of the DNA target to oligonucleotide arrays (genosensors) formed on glass slides for the purpose of mutation analysis. Human genomic DNA samples from normal individuals and cystic fibrosis (CF) patients (including homozygous delta F508 and heterozygous delta F508/wild type (wt) in the region examined) were used. A PCR fragment of length 138 bp (wt) or 135 bp (mutant) was produced from exon 10 in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, using a new pair of polymerase chain reaction (PCR) primers. This fragment contains four of the most frequent mutation sites causing the disease (Q493X, delta I507, delta F508, and V520F). Each of these mutations was tested using a pair of nonamer (9-mer) probes covalently attached to glass slides, representing the normal (wt) and the mutant alleles. Single-stranded target DNA was isolated from the PCR fragment using one PCR primer labeled with biotin and a streptavidin minicolumn to capture the biotin-labeled strand. Prior to hybridization to the 9-mer array on a glass slide, the unlabeled target strand was preannealed with one, three, or four auxiliary oligonucleotides, at least one being labeled with 32P. As observed previously in several laboratories, the discrimination between normal (wt) and mutant alleles at each site using oligonucleotide array hybridization ranged from very good to poor, depending on the number and location of mismatches between probe and target. Terminal mismatches along the probe were difficult to discriminate, internal mismatches were more easily discriminated, and multiple mismatches were very well discriminated. An exceptionally intense hybridization signal was obtained with a 9-mer probe that hybridized contiguously (in tandem) with one auxiliary oligonucleotide preannealed to the target DNA. The increased stability is apparently caused by strong base stacking interactions between the "capture probe" and the auxiliary oligonucleotide. The presence of the delta F508 mutation was detected with this system, including discrimination between homozygous and heterozygous conditions. Base mismatch discrimination using the arrayed 9-mer probes was improved by increasing the temperature of hybridization from 15 to 25 degrees C. Auxiliary oligonucleotides, preannealed to the single-stranded template, may serve several purposes to enable a more robust genosensor-based DNA sequence analysis: 1. A convenient means of introducing label into the target DNA molecule. 2. Disruption of interfering short-range secondary structure in the region of analysis. 3. Covering up of redundant binding sites in the target strand (i.e., where a given probe has more than one complement within the target). 4. Tandem hybridization with the capture probe (providing contiguous stacking) as a means for achieving efficient mismatch discrimination at the terminal position of the capture probe (adjacent to the auxiliary oligonucleotide). By use of multiple auxiliary oligonucleotides, all of the above benefits can be derived simultaneously.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 This fragment contains four of the most frequent sites of mutations causing CF, Q493X, AI507, AF508, and V520F 07). Login to comment
57 The sequences of the eight 9-mer probes were as follows (the 5'-amino group is denoted by the character, "@": for mutation Q493X, probes CF10W 5'-@actgagaac and CF10M 5'-@taagaacag; for mutationAI507,probes CF11W 5-@aagatgata and CFllM 5-@ccaaagata; for mutation AF508, probes CF 12W 5- @ccaaagatg and CF12M 5'-@caccgatga; and for mutation V520F, probes CF13W 5-@atgacgctt and CF 13M 5-@gatgeagct. Login to comment
40 This fragment contains four of the most frequent sites of mutations causing CF, Q493X, AI507, AF508, and V520F 07). Login to comment
58 The sequences of the eight 9-mer probes were as follows (the 5'-amino group is denoted by the character, "@": for mutation Q493X, probes CF10W 5'-@actgagaac and CF10M 5'-@taagaacag; for mutationAI507,probes CF11W 5-@aagatgata and CFllM 5-@ccaaagata; for mutation AF508, probes CF 12W 5- @ccaaagatg and CF12M 5'-@caccgatga; and for mutation V520F, probes CF13W 5-@atgacgctt and CF 13M 5-@gatgeagct. Login to comment

[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]

Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining. Login to comment

[hide] Analysis of 31 CFTR mutations by polymerase chain ... J Med Screen. 1999;6(2):67-9. Gasparini P, Arbustini E, Restagno G, Zelante L, Stanziale P, Gatta L, Sbaiz L, Sedita AM, Banchieri N, Sapone L, Fiorucci GC, Brinson E, Shulse E, Rappaport E, Fortina P
Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis.
J Med Screen. 1999;6(2):67-9., [PMID:10444722]

Abstract [show]
OBJECTIVES: Molecular biological testing for genetic diseases has grown rapidly, but speed, accuracy, specificity, sensitivity, throughput, and cost become more important as large scale screening is considered. This is a pilot study of an assay for the simultaneous detection of up to 31 cystic fibrosis mutations in a multicentre population based screening of 4476 Italian newborns. METHODS: The assay is a polymerase chain reaction, followed by an oligonucleotide ligation assay (PCR/OLA) and finally a sequence coded separation. It allows the detection of up to 31 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Guthrie spots were used as a source of template DNA. RESULTS: 144 carriers were detected during the analysis of 4476 samples, which translates into a carrier frequency of 1/31.1. Forty two carriers were detected from 1341 samples in Pavia (1/31.9), 53 from 1574 in Turin (1/29.7), and 49 from 1561 in San Giovanni Rotondo (1/31.8). Fifteen different mutations were detected, the most common being delta F508 (0.625). Other common mutations included G542X (16 of 144), which was particularly common in southern Italy (14 of 49), N1303K (8 of 144), and R117H (8 of 144), detected only in the northern centres. CONCLUSIONS: PCR/OLA is a robust, accurate, user friendly method for cystic fibrosis screening of newborns using blood spots in a semiautomated way at a low cost per mutation (0.8 Euro).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia. Login to comment

[hide] Prenatal detection by real-time quantitative PCR a... Clin Chem. 2000 Sep;46(9):1417-20. Costes B, Girodon E, Vidaud D, Flori E, Ardalan A, Conteville P, Fanen P, Niel F, Vidaud M, Goossens M
Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19).
Clin Chem. 2000 Sep;46(9):1417-20., [PMID:10973878]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E. Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... Am J Gastroenterol. 2001 Sep;96(9):2657-61. Truninger K, Malik N, Ammann RW, Muellhaupt B, Seifert B, Muller HJ, Blum HE
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
Am J Gastroenterol. 2001 Sep;96(9):2657-61., [PMID:11569691]

Abstract [show]
OBJECTIVE: Several studies have reported an increased frequency of cystic fibrosis gene mutations in idiopathic but not in alcoholic chronic pancreatitis. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis has not been analyzed. The aim of our study was to determine the frequency of cystic fibrosis gene mutations in patients with chronic pancreatitis with long-term follow-up and to see whether patients with mutations have a clinically different natural course compared to those without mutations. METHODS: Eighty two patients with chronic pancreatitis and 11 patients with recurrent acute pancreatitis of our well defined pancreatitis cohort were screened for the 31 most common cystic fibrosis gene mutations. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis was assessed. RESULTS: A cystic fibrosis gene mutation was detected in five of 49 patients with alcoholic chronic pancreatitis (10.2%; 2.3 times the expected frequency) and in three of 14 patients with idiopathic-juvenile chronic pancreatitis (21.4%; 4.8 times the expected frequency). No mutations were found in the remaining patients with chronic pancreatitis of rare causes, hereditary pancreatitis, and recurrent acute pancreatitis. The frequency of pancreatic calcifications was significantly higher in patients with alcoholic chronic pancreatitis without mutations. This result was not confirmed in patients with idiopathic-juvenile chronic pancreatitis. The duration of pain and the frequency of exocrine and endocrine insufficiency was comparable in both subgroups irrespective of the mutation status. CONCLUSION: Our data indicate a significantly increased frequency of cystic fibrosis gene mutations both in patients with alcoholic and idiopathic-juvenile chronic pancreatitis. The natural course was similar in patients with mutations compared to those without mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A. Login to comment

[hide] Analysis of exocrine pancreatic function in cystic... Eur J Clin Invest. 2001 Sep;31(9):796-801. Walkowiak J, Herzig KH, Witt M, Pogorzelski A, Piotrowski R, Barra E, Sobczynska-Tomaszewska A, Trawinska-Bartnicka M, Strzykala K, Cichy W, Sands D, Rutkiewicz E, Krawczynski M
Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency.
Eur J Clin Invest. 2001 Sep;31(9):796-801., [PMID:11589722]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common cause of exocrine pancreatic insufficiency in childhood. The aim of the present study is to evaluate the correlation between genotype and exocrine pancreatic insufficiency in CF patients. The special emphasis was put on the analysis of mild CFTR mutations. DESIGN: The study comprised 394 CF patients and 105 healthy subjects (HS). Elastase-1 concentrations were measured in all subjects. RESULTS: Severe pancreatic insufficiency was associated with the presence of two CFTR gene mutations (DeltaF508, N1303K, CFTR dele 2,3 (21kb), G542X, 1717-1G-A, R533X, W1282X, 621GT, 2183AAG, R560T, 2184insA and DeltaI507, G551D, 895T) and mild insufficiency with the presence of at least one mutation (R117H, 3171insC, A155P2, 138insL, 296 + 1G-A, E92GK, E217G, 2789 + 5G-A. 3849 + 1kbC-T/3849 + 1kbC-T) genotype resulted in high elastase-1-values. However, in case of patients with genotype DeltaF508/3849 + 10kbC-T, 1717-1GA/3849 + 10kbC-T as well as with DeltaF508/R334W, both high and low elastase-1 concentrations were found. Low E1 values were found in a patient with DeltaF508/R347P genotype. CONCLUSION: Patients who carry two 'severe' mutations develop pancreatic insufficiency, whereas those who carry at least one 'mild' usually remain pancreatic sufficient. However, the presence of one mild mutation does not exclude pancreatic insufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 Kristidis et al. [10] reported that pancreatic insufficiency strongly correlates also with two alleles of DI507, Q493X, G542X, R553X, W1282X, 621 1 1G-T, 1717±1G-A, 556delA, 3659delC, I148T, G480C, V520F and R560T while one or two mutations such as R117H, R334W, A455E, and P574H were correlated with a pancreatic sufficient phenotype. Login to comment

[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]

Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14). Login to comment

[hide] Predicting the risk of cystic fibrosis with abnorm... Am J Med Genet. 2002 Jun 15;110(2):109-15. Muller F, Simon-Bouy B, Girodon E, Monnier N, Malinge MC, Serre JL
Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases.
Am J Med Genet. 2002 Jun 15;110(2):109-15., 2002-06-15 [PMID:12116247]

Abstract [show]
Hyperechogenic fetal bowel is prenatally detected by ultrasound during the second trimester of pregnancy in 0.1-1.8% of fetuses. It has been described as a normal variant but has often been associated with severe diseases, notably cystic fibrosis (CF). The aim of our study was to determine the risk of CF in a prospective study of 641 fetuses with ultrasonographically abnormal fetal bowel and the residual risk when only one mutation is detected in the fetus. Fetal cells and/or parental blood cells were screened for CFTR mutations. Two screening steps were used, the first covering the mutations most frequently observed in French CF patients (mutation detection rate of 70-90%) and, when a CF mutation was detected, a DGGE-sequencing strategy. We observed a 3.1% risk of CF when a digestive tract anomaly was prenatally observed at routine ultrasound examination. The risk was higher when hyperechogenicity was associated with bowel dilatation (5/29; 17%) or with the absence of gall bladder (2/8; 25%). The residual risk of CF was 11% when only one CF mutation was detected by the first screening step, thereby justifying in-depth screening. Mutations associated with severe CF (DeltaF508 mutation) were more frequently observed in these ultrasonographically and prenatally detected CF cases. However, the frequency of heterozygous cases was that observed in the normal population, which demonstrates that heterozygous carriers of CF mutations are not at increased risk for hyperechogenic bowel. In conclusion, fetal bowel anomalies indicate a risk of severe cystic fibrosis and justify careful CFTR molecular analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 A, N1303K, W1282X), oligonucleotide ligation assay with the CF-OLA kit (PE-Biosystems, Foster City, CA) (31 mutations detected: DF508, DI507, Q493X, V520F, 1717-1G ! Login to comment

[hide] Screening for cystic fibrosis in newborn infants: ... J Med Screen. 2002;9(2):60-3. Corbetta C, Seia M, Bassotti A, Ambrosioni A, Giunta A, Padoan R
Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population.
J Med Screen. 2002;9(2):60-3., [PMID:12133923]

Abstract [show]
OBJECTIVE: To assess the performance of a two tier neonatal screening programme (IRT/DNA/IRT) for cystic fibrosis, based on immunoreactive trypsinogen (IRT) followed by direct cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis (based on a panel of up to 31 mutations) in hypertrypsinaemic newborn infants and to compare it with a previous screening protocol. SETTING: The study comprised all the newborn infants in the period 1 October 1998 to 31 December 1999 in the Lombardia region, north western Italy. METHODS: The screening strategy consisted of an immunoreactive trypsinogen assay from dried blood spots, a polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (PCR-OLA), and a sequence code separation. RESULTS: 104 609 newborn infants were screened. 1457 hypertrypsinaemic infants (1.39%) were analysed with the PCR-OLA assay. 18 newborn homozygotes or compound heterozygotes for CFTR mutations were identified and referred to the cystic fibrosis (CF) centre at a mean age of 3 weeks. 125 infants presenting only one mutation were recalled for a sweat test: a diagnosis of CF was made in 13 infants, and parents of 112 neonates identified as carriers (1:13) received genetic counselling. The remaining 1314 hypertrypsinaemic newborn infants were recalled for IRT retesting and 177 were referred for a sweat test because the second IRT measurement was above the cut off value. Among this group a further two infants were diagnosed with CF (1.1%) leading to a CF prevalence of 1:3170. CONCLUSIONS: This strategy resulted in an early and accurate diagnosis of CF. The IRT/DNA/IRT protocol with an OLA assay was shown to be useful in an Italian population with a genetic heterogeneity, leading to the identification of 94% of infants with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Demographics of the UK cystic fibrosis population:... Eur J Hum Genet. 2002 Oct;10(10):583-90. McCormick J, Green MW, Mehta G, Culross F, Mehta A
Demographics of the UK cystic fibrosis population: implications for neonatal screening.
Eur J Hum Genet. 2002 Oct;10(10):583-90., [PMID:12357328]

Abstract [show]
The objective was to determine the composition of the Cystic Fibrosis (CF) Population attending specialist UK CF centres in terms of age, gender, age at diagnosis, genotype and ethnicity. With the planned introduction of the national CF screening programme in the UK, cystic fibrosis transmembrane regulator (CFTR) mutations were compared between different ethnic groups enabling a UK-specific frequency of mutations to be defined. Data were analysed from the patient biographies held in the UK CF Database (see www.cystic-fibrosis.org.uk). The currently registered population of 5,274 CF patients is 96.3% Caucasian with a male preponderance that significantly increases with age. The majority of the 196 non-Caucasian CF patients are from the Indian Subcontinent (ISC), of which one in 84 UK CF patients are of Pakistani origin. The commonest CFTR mutation, deltaF508, is found in 74.1% of all CF chromosomes. In the Caucasian CF population, 57.5% are deltaF508 homozygotes but the UK ISC CF population with only 24.7%, has significantly fewer deltaF508 homozygotes patients (95% confidence interval (CI) 0.2-0.4). The distribution of Caucasian patients with deltaF508/deltaF508, deltaF508/Other and Other/Other does not fit the expected distribution with a Hardy-Weinberg model unless those patients without a detected mutation are excluded (P<0.001). The UK CF Database has shown the UK CF population to have distinct characteristics separate from the North American and European CF Registries. The ISC group contains many mutations not recognised by current genetic analysis, and one in four ISC patients have no CFTR mutations identified. The CFTR analysis proposed for the screening programme would detect 96% of patients registered in the database, but is unlikely to achieve the desired >80% detection rates in the ethnic minority groups. Screen-positive, non-Caucasian infants without an identifiable CFTR mutation should be referred for a sweat test and genetic counselling when serum trypsinogen concentrations remain elevated after birth.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Table 4 The commonest CFTR mutations in the UK Genotypes UK CF population Genotyped UK Caucasian CF Genotyped UK CF ISC (n=9866 chromosomes) population (n=9506 chromosomes) population (n=156 chromosomes) CFTR mutation gene frequency per 1000 genes gene frequency per 1000 genes gene frequency per 1000 genes DF508 741.0 752.0 294.9 G551D 33.7 34.3 12.8 G542X 18.5 18.4 25.6 R117H 12.5 12.7 0.0 621+1G?T 12.7 12.7 6.4 1717-1G?A 5.8 5.8 0.0 1898+1G?A 5.7 5.9 0.0 N1303K 5.6 5.4 0.0 DI507 4.8 5.0 0.0 R560T 4.2 4.3 0.0 R553X 3.3 3.4 0.0 1154insTC 3.2 3.3 0.0 Q493X 2.8 2.9 0.0 3659delC 2.8 2.9 0.0 E60X 2.4 2.4 0.0 W1282X 2.7 2.7 0.0 P67L 2.1 2.1 0.0 G85E 2.1 2.0 0.0 V520F 1.6 1.7 0.0 1078delT 1.3 1.4 0.0 Y569D 1.5 0.0 96.2 L218X 0.6 0.0 38.5 1161delC 0.7 0.1 38.5 R1162X 0.9 0.6 19.2 R709X 0.4 0.2 12.8 3849+10kbC?T 1.2 0.8 19.2 S549R* 0.6 0.0 0.0 *S549R mutations appear in the non-Caucasian but not the ISC subgroup. Login to comment

[hide] Cystic fibrosis mutation frequencies in an Irish p... Clin Genet. 2003 Feb;63(2):121-5. Devaney J, Glennon M, Farrell G, Ruttledge M, Smith T, Houghton JA, Maher M
Cystic fibrosis mutation frequencies in an Irish population.
Clin Genet. 2003 Feb;63(2):121-5., [PMID:12630958]

Abstract [show]
The incidence of cystic fibrosis (CF) at birth in Ireland is 1/1461. Neonate CF genetic testing is not routinely performed in Ireland. Currently, screening is only carried out where there is clinical evidence or a family history to suggest disease. Here we report the frequencies of common CF mutations occurring in an Irish population composed of samples collected from western, mid-western and southern regions of Ireland. Rarer CF mutations were also identified in a selected number of CF patients. In addition, a number of polymorphisms were identified, some of which are reported to be functionally and phenotypically important.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Frequency of rarer CF mutations and polymorphisms Mutation Numberof chromosomes Frequency (%) Polymorphism Frequency (%) E60X 1 0.24 IVS6a-8 25.0 P67L 1 0.24 (TG)m 37.5 G85E 1 0.24 IVS8-Tn 23.8 6211G >T 1 0.24 M470V 41.3 IVS8^5T 5 1.21 V520F 2 0.48 18981G >A 2 0.48 R117H 1 ^ DF508 17 ^ Total 80 15 Frequencypercentages areadjustedtorepresent 85%. Login to comment
69 GMPD profiles of ABCC7 exon 10: lane 1, DF508 heterozygote; lane 2, DF508/V520F compound heterozygote. Login to comment
78 There are no reports of the E60X, P67L, G85E, IVS8-5T, V520F or 1898 1G> A mutations in previously published CF mutation frequency reports for the Republic of Ireland (11, 12). Login to comment
79 The E60X mutation has been reported in Northern Ireland (0.7%), with no V520F or P67L alleles being detected (13). Login to comment
81 In UK reports (15), the incidence of the E60X mutation is reported at 0.16%, G85E at 0.21%, 621 1G> T and V520F at 0.17% and 1898 1G> A at 0.46%. Login to comment
83 In this study, the DF508, V520F and 5T alleles were associated with meconium ileus and meconium ileus equivalent. Login to comment
84 High sweat chloride tests (<90meq/l) were similarly associated with DF508, V520F and 1898 1G> A. Login to comment

[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]

Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development. Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment
98 Number Frequency Number Frequency 1652_1655del 3 bp F508del 966 76.5% 226 81.3% 1192 77.4% 1784G>A G551D 82 6.5% 27 9.7% 109 7.1% 482G>A R117H 38 3.0% 4 1.4% 42 2.7% 1811G>C R560T 30 2.4% 2 0.7% 32 2.1% 621+1G>T 21 1.7% 21 1.4% 1648_1653delATC I507del 10 0.8% 1 0.4% 11 0.7% 1717-1G>A 9 0.7% 9 0.6% 1756G>T G542X 8 0.6% 8 0.5% 1187G>A R352Q 3 0.2% 2 0.7% 5 0.3% 1461ins4 5 0.4% 5 0.3% 4041C>G N1303K 5 0.4% 5 0.3% 310G>T E60X 4 0.3% 4 0.3% 1690G>T V520F 4 0.3% 4 0.3% 3007delG 4 0.3% 4 0.3% 3272-26A>G 2 0.2% 2 0.7% 4 0.3% 386G>A G85E 3 0.2% 3 0.2% 3849+10kbC>T 3 0.2% 3 0.2% Unidentified Unidentified 41 3.2% 11 4.0% 52 3.4% Total Total 1262 100.0% 278 100.0% 1540 100.0% Dublin cohort Cork cohort Ireland Amino acid change Nucleotide change We noted similar high frequencies of the F508del and G551D mutations in the three cohorts studied. Login to comment

[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]

Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
294 Less common mutations included G85E and 5T (n=5 chromosomes), A455E and R1162X (n=4 chromosomes), R347, Y1092X, R334W, and V520F (n=3 chromosomes). Login to comment

[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]

Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation. Login to comment

[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

[hide] Role of CFTR mutations in adult bronchiectasis. Thorax. 2004 Apr;59(4):357-8. King PT, Freezer NJ, Holmes PW, Holdsworth SR, Forshaw K, Sart DD
Role of CFTR mutations in adult bronchiectasis.
Thorax. 2004 Apr;59(4):357-8., [PMID:15047968]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
230 The patients were screened for the 10 most common mutations in the local population (DF508, D1507, V520F, G542X, G551D, R553X, R117H, 621+1GRT, A455E and N1303K) responsible for 82% of cases of CF and the 5T mutation by previously published methods.7 8 Ethical approval for the project was obtained from the ethics committee at MMC. Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

[hide] Genotype-phenotype correlation and frequency of th... Genet Med. 2004 Sep-Oct;6(5):421-5. Monaghan KG, Highsmith WE, Amos J, Pratt VM, Roa B, Friez M, Pike-Buchanan LL, Buyse IM, Redman JB, Strom CM, Young AL, Sun W
Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study.
Genet Med. 2004 Sep-Oct;6(5):421-5., [PMID:15371907]

Abstract [show]
PURPOSE: We expect that the mutation panel currently recommended for preconception/prenatal CF carrier screening will be modified as new information is learned regarding the phenotype associated with specific mutations and allele frequencies in various populations. One such example is the I148T mutation, originally described as a severe CF mutation. After implementation of CF population-based carrier screening, we learned that I148T exists as a complex allele with 3199del6 in patients with clinical CF, whereas asymptomatic compound heterozygotes for I148T and a second severe CF mutation were negative for 3199del6. METHODS: We performed reflex testing for 3199del6 on 663 unrelated specimens, including I148T heterozygotes, compound heterozygotes, and a homozygous individual. RESULTS: Less than 1% of I148T carriers were also positive for 3199del6. Excluding subjects tested because of a suspected or known CF diagnosis or positive family history, 0.6% of I148T-positive individuals were also positive for 3199del6. We identified 1 I148T homozygote and 6 unrelated compound heterozygous individuals with I148T and a second CF variant (2 of whom also carried 3199del6). In addition, one fetus with echogenic bowel and one infertile male were heterozygous for I148T (3199del6 negative). CONCLUSIONS: Reflex testing for 3199del6 should be considered whenever I148T is identified. Reflex testing is of particular importance for any symptomatic patient or whenever one member of a couple carries a deleterious CF mutation and the other member is an I148T heterozygote. Further population data are required to determine if I148T, in the absence of 3199del6, is associated with mild or atypical CF or male infertility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Case 7 had a clinical diagnosis of CF and was positive for V520F, a CF mutation associated with pancreatic insufficiency, and I148T/3199del6. Login to comment
67 DNA testing on her son revealed I148T/3199del6 7 Not provided Caucasian Affected with CF V520F/I148T (3199del6 positive) Not determined None available 8 Prenatal test Middle Eastern Fetal echogenic bowel I148Ta carrier Not determined Healthy male reported at age 2 years. Login to comment
104 One patient with a known CF severe mutation, V520F, and I148T(3199del6) had a clinical diagnosis of CF, although no specific clinical information is available. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] Parallel single nucleotide polymorphism genotyping... Anal Chem. 2005 Apr 15;77(8):2400-5. Chen Y, Shortreed MR, Olivier M, Smith LM
Parallel single nucleotide polymorphism genotyping by surface invasive cleavage with universal detection.
Anal Chem. 2005 Apr 15;77(8):2400-5., 2005-04-15 [PMID:15828773]

Abstract [show]
Large-scale investigations of sequence variation within the human species will provide information about the basis of heritable variation in disease susceptibility and human migration. The surface invader assay (an adaptation of the invasive cleavage reaction to an array format) is capable of exquisitely sensitive and specific detection of genetic variation. It is shown here that this genotyping technology can be multiplexed in a DNA array format, permitting the parallel analysis of a panel of single nucleotide polymorphisms (SNPs) directly from an unamplified genomic DNA target. In addition, a "universal" mode of detection was developed that makes use of a mixture of degenerate templates for DNA ligation to the surface-bound cleaved oligonucleotides and thereby makes this strategy amenable to any desired SNP site or combination of SNP sites, without regard to their particular DNA sequences. This approach was demonstrated on a proof-of-principle scale using small DNA arrays to genotype 6 SNP markers in the PTPN1 gene and 10 mutations in the cystic fibrosis transmembrane conductance regulator gene. This ability to analyze many different genetic variations in parallel, directly from unamplified human genomic DNA samples, lays the groundwork for the development of high-density arrays able to analyze hundreds of thousands or even millions of SNPs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
170 508 of the protein product.23 The CF mutations chosen in this study, ∆F508, G551D, W1282X, N1303K, R117H, R560T, 3849+10kbCT, V520F, R334W, and I148T, are a subset of the standard panel. Login to comment
174 Among the six unrelated CF carriers, one was found to be homozygous for 3849+10kbCT, one homozygous for ∆F508, one heterozygous for both R117H and ∆F508, one heterozygous for W1282X/WT, one heterozygous for V520F/WT, and one heterozygous for G551D/WT. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Multiple mutation analysis of the cystic fibrosis ... Mol Hum Reprod. 2005 Jun;11(6):463-8. Epub 2005 May 20. Sanchez-Garcia JF, Benet J, Gutierrez-Mateo C, Luis Seculi J, Monros E, Navarro J
Multiple mutation analysis of the cystic fibrosis gene in single cells.
Mol Hum Reprod. 2005 Jun;11(6):463-8. Epub 2005 May 20., [PMID:15908456]

Abstract [show]
PGD is becoming an alternative to prenatal diagnosis. The combination of IVF techniques with the PCR technology allows for the detection of genetic abnormalities in first polar bodies from oocytes and blastomeres from cleavage-stage embryos. Dealing with a genetic disease with a heterogeneous spectrum of mutations like cystic fibrosis, one of the objectives of centres offering PGD is the application of simple and efficient protocols that allow for the detection of a wide range of mutations with a single procedure. In the present work, 29 normal loci and the 31 most frequent cystic fibrosis transmembrane conductance regulator (CFTR) mutations in Southern Europe could be detected at the same time in single cells applying a modified and improved primer extension preamplification-PCR. Two different Taq polymerases were tested in isolated buccal cells heterozygous for several mutations. The protocol that gave statistically significant better results was also successful in oocytes and their first polar bodies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 The mutations assayed are: DF508, DI507, Q493X, V520F, 1717-1G.A, G542X, G551D, R560T, S459R, S459N and R553X labelled with FAM (blue), 3849þ10kbC.T, 3849 þ 4A . Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel. Login to comment

[hide] Nucleotide binding domains of human CFTR: a struct... Cell Mol Life Sci. 2005 Sep;62(18):2112-23. Eudes R, Lehn P, Ferec C, Mornon JP, Callebaut I
Nucleotide binding domains of human CFTR: a structural classification of critical residues and disease-causing mutations.
Cell Mol Life Sci. 2005 Sep;62(18):2112-23., [PMID:16132229]

Abstract [show]
Defective function of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) causes CF, the most frequent lethal inherited disease among the Caucasian population. The structure of this chloride ion channel includes two nucleotide-binding domains (NBDs), whose ATPase activity controls channel gating. Recently, the experimental structures of mouse and human CFTR NBD1 and our model of the human CFTR NBD1/NBD2 heterodimer have provided new insights into specific structural features of the CFTR NBD dimer. In the present work, we provide a structural classification of CF-causing mutations which may complement the existing functional classification. Our analysis also identified amino acid residues which may play a critical role in interdomain interaction and are located at the NBD1-NBD2 interface or on the surface of the dimer. In particular, a cluster of aromatic amino acids, which includes F508 and straddles the two NBDs, might be directly involved in the interaction of the NBD1/NBD2 heterodimer with the channel-forming membrane-spanning domains.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 Examples are V456F [33] and V520F [34] (labeled C and K, respectively, in fig. 2) which involve residues buried in the interior of the NBD1 subdomain. Login to comment

[hide] Markedly elevated neonatal immunoreactive trypsino... Arch Dis Child. 2006 Mar;91(3):222-5. Epub 2005 Oct 21. Massie J, Curnow L, Tzanakos N, Francis I, Robertson CF
Markedly elevated neonatal immunoreactive trypsinogen levels in the absence of cystic fibrosis gene mutations is not an indication for further testing.
Arch Dis Child. 2006 Mar;91(3):222-5. Epub 2005 Oct 21., [PMID:16243854]

Abstract [show]
AIMS: To investigate the immunoreactive trypsinogen (IRT) values above the usual 99th centile laboratory cut-off and determine the value of offering further testing to those infants with a markedly elevated IRT but no cystic fibrosis transmembrane regulator (CFTR) gene mutation identified by the screening programme. METHODS: All babies born in Victoria, Australia, between 1991 and 2003, were screened by IRT followed by CF gene mutation analysis. RESULTS: Of the 806,520 babies born, 9268 with the highest IRT levels had CFTR mutation analysis. There were 123 DeltaF508 homozygotes and 703 heterozygotes (86 with CF, 617 carriers). A total of 8442 babies had no CFTR gene mutation, of whom 18 (0.21%) had CF. The total number of CF babies with IRT greater than the laboratory cut-off was 227 (2.4%). The IRT results of the CF patients were distributed normally, with the majority above the laboratory cut-off of newborn IRT results. There was no evidence of an excess of babies with CF in the very highest levels of IRT above the 99th centile. CONCLUSIONS: Only a small proportion of babies with a neonatal IRT >99th centile have CF. Additional CF testing for infants with an elevated IRT but no CFTR gene mutation has an extremely low yield, no matter how high the IRT result.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
220 Table 2 shows the relatively poor PPV of Table 1 Details of cystic fibrosis patients with IRT .99th centile but no DF508 mutation, Victoria, Australia, 1991-2003 Patient IRT (MoM) Genotype* Presentation Patient 1 2.77 R117H/2 Sibling with CF Patient 2 4.57 N1303K/2 Meconium ileus/sibling with CF Patient 3 3.28 2/2 Failure to thrive Patient 4 18.16 N1303K/N1303K Failure to thrive/recurrent cough Patient 5 2.98 V520F/2 Meconium ileus Patient 6 3.79 2/2 Meconium ileus Patient 7 6.65 G551D/3849 Failure to thrive/recurrent cough Patient 8 8.32 2/2 Failure to thrive Patient 9 6.45 2/2 Failure to thrive Patient 10 3.69 2/2 Clinical details not available Patient 11 13.81 2/2 Failure to thrive Patient 12 6.64 G542X/2 Recurrent chest infection Patient 13 5.51 2/2 Affected sibling Patient 14 3.95 G542X/2 Meconium ileus Patient 15 6.92 2/2 Recurrent chest infection Patient 16 6.82 2/2 Failure to thrive Patient 17 7.31 2/2 Failure to thrive Patient 18 7.66 2/2 Sibling with CF IRT, immunoreactive trypsinogen; MoM, multiple of median. Login to comment
222 *All patients underwent an extended CFTR mutation analysis for the following mutations in addition to DF508: G551D, R553X, G542X, R117H, N1303K, 621+1G-T, A455E, V520F, 1717-1G-A, W1282X, R1162X, 3849+10kbC-T, R347P, R334W, R560T, S549N. Login to comment

[hide] Detection of F508del mutation in cystic fibrosis t... Singapore Med J. 2006 Feb;47(2):129-33. Zilfalil BA, Sarina S, Liza-Sharmini AT, Oldfield NJ, Stenhouse SA
Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays.
Singapore Med J. 2006 Feb;47(2):129-33., [PMID:16435054]

Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is one of the common genetic disorders in the western world. It has been reported to be very rare in Asian populations. According to the Cystic Fibrosis Genetic Analysis Consortium, more than 1,000 mutations of the CF gene have been identified. The CF gene, named the cystic fibrosis transmembrane conductance regulator (CFTR), is located on chromosome 7 and composed of 27 exons. This study aims to detect possible CFTR gene mutations in Malays. METHODS: We analysed 50 blood samples from healthy Malays with no symptoms of CF. DNA was extracted from blood using commercially available extraction kits (Eppendorf, Germany). Identification of CFTR gene mutation was performed using the CF OLA (Oligonucleotide Ligation Assay) kit (Applied Biosystems, USA). The PCR-ligation products were electrophoresed on eight percent sequagel using an ABI PRISM 377 genetic analyser (Applied Biosystems, USA). Electrophoresis data was analysed using the Genotyper software and a report of the CF genotype for all loci tested was created using the CF Genotyper Template software. Out of 50, one sample (two percent) was detected to have the F508del mutation (3bp deletion at exon 10), which is one of the most common CFTR gene mutations in Caucasians. RESULTS: The F508del mutation allele was detected in one subject. This indicates that she was a CF carrier. CONCLUSION: We report the finding of a carrier of the F508del mutation of the CFTR gene in the Malay population. Our finding revealed that CF could also affect the Malay population. Larger studies are necessary to determine the exact gene frequency of this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes. Login to comment

[hide] CFTR 5T variant has a low penetrance in females th... Genet Med. 2006 Jun;8(6):339-45. Sun W, Anderson B, Redman J, Milunsky A, Buller A, McGinniss MJ, Quan F, Anguiano A, Huang S, Hantash F, Strom C
CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype.
Genet Med. 2006 Jun;8(6):339-45., [PMID:16778595]

Abstract [show]
PURPOSE: The study's purpose was to understand the molecular basis for different clinical phenotypes of the 5T variant, a tract of 5 thymidines in intron 8 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which disrupts processing of CFTR mRNA and reduces synthesis from the corresponding CFTR alleles. METHOD: We analyzed the polymorphic TG dinucleotide repeat adjacent to the 5T variant in intron 8 and the codon 470 in exon 10. Patients selected for this study were positive for both the 5T variant and the major cystic fibrosis mutation, Delta F508. Almost all Delta F508 mutation alleles occur in a 10TG-9T-470M haplotype. Therefore, it is possible to determine the haplotype of the 5T variant in trans. RESULTS: Of the 74 samples analyzed, 41 (55%) were 11TG-5T-470M, 31 (42%) were 12TG-5T-470V, and 2 (3%) were 13TG-5T-470M. Of the 49 cases for which we had clinical information, 17.6% of females (6/34) and 66.7% of males (10/15) showed symptoms resembling atypical cystic fibrosis. The haplotype with the highest penetrance in females (42% or 5/12) and more than 80% (5/6) in males is 12TG-5T-470V. We also evaluated 12 males affected with congenital bilateral absence of vas deferens and positive for the 5T variant; 10 of 12 had the 12TG-5T-470V haplotype. CONCLUSION: Overall, the 5T variant has a milder clinical consequence than previously estimated in females. The clinical presentations of the 5T variant are associated with the 5T-12TG-470M haplotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 These mutations include R347H, S549N, S549R, 3876delA, 394delT, 3905insT, and V520F, in addition to the 25-mutation core panel recommended by ACMG/ACOG for population-based CF screening. Login to comment

[hide] Validation of cystic fibrosis mutation analysis us... Diagn Mol Pathol. 2007 Mar;16(1):57-9. Huang CK, Pan Q
Validation of cystic fibrosis mutation analysis using ABI 3130XL genetic analyzer.
Diagn Mol Pathol. 2007 Mar;16(1):57-9., [PMID:17471160]

Abstract [show]
Cystic fibrosis (CF) is one of the most common autosomal recessive diseases in the white population, with a prevalence estimate of 1 in 2500 to 3300 live births. CF is characterized by viscous mucus in the lungs with involvement of digestive and reproductive systems as well as sweat glands (excess salt loss). Treatment for CF patients is palliative. Over 1300 mutations have been identified in the CFTR gene. However, most of the mutations are at frequencies of <0.1% or represent private mutations. Although other methodologies are available for CF testing, the oligonucleotide ligation assay is a unique approach to mutation detection of point mutations, small deletions, and small insertions, and consists of 2 phases. Applied Biosystems 3130 Series Genetic Analyzers are the next-generation platform for low to medium throughput laboratories and deliver improved performance. One disadvantage of the Genetic Analyzers is that there is no template of instrument settings for POP-6 polymer using 36-cm array. The Abbott CF oligonucleotide ligation assay ASRs can be run only using POP-6 polymer. We are the first to have optimized the instrument settings for POP-6 polymer based on the template of Rapidseq36-POP6 for Abbott Diagnostics CF V3 ASRs. Several conditions were tried, and the conditions of sample injection voltage at 10,000 v and sample injection time at 5 seconds gave better results, which were with clearer peaks and lower background signals. Twenty cell line DNA samples from Coriell were analyzed, and the results were matched. In addition, Synthetic Controls from AcroMetrix were analyzed, and the results were same as expected. Also, about 1500 clinical samples were analyzed, and high-quality reportable results were obtained. In conclusion, our modified protocol is robust and reliable on this ABI 3130XL instrument.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Mutation controls: to specifically assess the detection of CF mutations, 20 cell line DNA samples with mutations of R553X, 3659delC/delF508, delF508/Q493X, 711+ 1G>T/621+1G>T, 621+1G>T/delF508, G85E/ 621+1G>T, R560T/delF508, A455E/621+1G>T, N1303K, W1282X, G551D/R553X, 2789+5G>A/ 2789+5G>A, 3849+10C>T/3849+10C>T, 1717-1G>A, delF508/delF508, R347P/G551D, R334W, V520F, R117H/delF508/5T/9T, or G542X/G542X, respectively, from the Coriell Cell Repositories were analyzed. Login to comment

[hide] One multiplex control for 29 cystic fibrosis mutat... Genet Test. 2007 Fall;11(3):256-68. Lebo RV, Bixler M, Galehouse D
One multiplex control for 29 cystic fibrosis mutations.
Genet Test. 2007 Fall;11(3):256-68., [PMID:17949287]

Abstract [show]
A simple approach is described to synthesize and clone an inexhaustible supply of any homozygous and/or heterozygous controls diluted with yeast genomic DNA to mimic human genome equivalents for use throughout the entire multiplex mutation assay. As a proof of principle, the 25 cystic fibrosis mutation panel selected by the American College of Medical Genetics and four additional mutant sequences were prepared as a single control mixture. The 29 CFTR mutations were incorporated into 17 gene fragments by PCR amplification of targeted sequences using mutagenic primers on normal human genomic DNA template. Flanking primers selected to bind beyond all published PCR primer sites amplified controls for most assay platforms. The 17 synthesized 433-933-bp CFTR fragments each with one to four homozygous mutant sequences were cloned into nine plasmid vectors at the multiple cloning site and bidirectionally sequenced. Miniplasmid preps from these nine clones were mixed and diluted with genomic yeast DNA to mimic the final nucleotide molar ratio of two CFTR genes in 6 x 10(9) bp total human genomic DNA. This mixture was added to control PCR reactions prior to amplification as the only positive control sample. In this fashion >200 multiplex clinical PCR analyses of >4,000 clinical patient samples have been controlled simultaneously for PCR amplification and substrate specificity for 29 tested mutations without cross contamination. This clinically validated multiplex cystic fibrosis control can be modified readily for different test formats and provides a robust means to control for all mutations instead of rotating human genomic controls each with a fraction of the mutations. This approach allows scores of additional mutation controls from any gene loci to be added to the same mixture annually.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
229 The nine normal sequences detected at other tested mutation sites (3876delA; S1255X; 2307insA; 1898ϩ5G Ǟ T; S549R; S549N; V520F; Y122X; and 394delTT) reflected the correct sequence in this mixture of nine cloned sequences. Login to comment

[hide] Distribution of CFTR mutations in Saguenay- Lac-Sa... Genet Med. 2008 Mar;10(3):201-6. Madore AM, Prevost C, Dorfman R, Taylor C, Durie P, Zielenski J, Laprise C
Distribution of CFTR mutations in Saguenay- Lac-Saint-Jean: proposal of a panel of mutations for population screening.
Genet Med. 2008 Mar;10(3):201-6., [PMID:18344710]

Abstract [show]
PURPOSE: Saguenay-Lac-Saint-Jean is a region located in the northeastern part of the Province of Quebec, Canada, and is characterized by a founder effect. In this region, it has been documented that the incidence of cystic fibrosis reached 1/902 live births between 1975 and 1988, three times higher than the average incidence of 1/2500 live births reported in other Caucasian populations. This corresponds to a carrier rate of 1/15. METHODS: Using genotyping data from the Canadian Consortium for Cystic Fibrosis Genetic Studies, this article describes the cystic fibrosis transmembrane conductance regulator profile of the cystic fibrosis population living in the Saguenay-Lac-Saint-Jean region and compares it with cystic fibrosis populations living in three other regions of the Province of Quebec. RESULTS: Significant differences in allelic frequencies of common mutations (as DeltaF508, 621 + 1G>T and A455E), and in percentage of covered allele with three or six mutations, were found in Saguenay-Lac-Saint-Jean compared to other regions. Based on this result, two mutation panels exceeding 90% sensitivity threshold are now proposed for cystic fibrosis carrier screening in this region. CONCLUSION: The implementation of the proposed carrier screening program could diminish the incidence of this disease in this region and allow future parents to make informed decisions about family planning.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Altogether, the six mutations represent 95.89% of the CFTR allele of CF patients in the SLSJ population, whereas the proportions are 86.85, 85.27, and Table 2 Cystic fibrosis mutations present in the four populations studied Mutationa Allelic frequency (number of alleles [%]) Populationb 1 2 3 4 „F508 106 (62.35) 55 (72.37) 398 (72.36) 67 (57.78) 621 ؉ 1G>T 42 (24.71) 6 (7.89) 30 (5.45) 1 (0.85) A455E 12 (7.06) 2 (2.63) 14 (2.55) 1 (0.85) 3199del6 1 (0.59) 1 (1.32) 7 (1.27) 1 (0.85) 711 ؉ 1G>T 1 (0.59) 1 (1.32) 15 (2.73) 1 (0.85) Y1092X 1 (0.59) 1 (1.32) 5 (0.91) 0 R117C 2 (1.18) 0 0 0 ‚I507 1 (0.59) 2 (2.63) 10 (1.82) 0 L206W 1 (0.59) 1 (1.32) 9 (1.64) 0 R1158X 1 (0.59) 0 0 0 S489X 1 (0.59) 0 1 (0.18) 0 R553X 0 2 (2.63) 2 (0.36) 0 R334W 0 1 (1.32) 2 (0.36) 0 G542X 0 0 10 (1.82) 0 G85E 0 0 6 (1.09) 5 (4.24) N1303K 0 0 5 (0.91) 1 (0.85) IVS8-5T 0 0 4 (0.73) 0 W1282X 0 0 3 (0.55) 7 (5.93) R347P 0 0 1 (0.18) 2 (1.69) V520F 0 0 1 (0.18) 0 I1027T 0 0 1 (0.18) 0 R1066C/IVS 0 0 1 (0.18) 0 Q1313X 0 0 1 (0.18) 0 1898ϩ3GϾA 0 0 1 (0.18) 0 2183AAϾG 0 0 1 (0.18) 0 2951insA 0 0 1 (0.18) 0 G551D 0 0 0 2 (1.69) 1525-iG-A 0 0 0 2 (1.69) Y109C 0 0 0 1 (0.85) S549N 0 0 0 1 (0.85) 3154del1G 0 0 0 1 (0.85) UNKNOWN 1 (0.59) 4 (5.26) 20 (3.82) 25 (21.19) Number of alleles genotypedc 170 (100) 76 (100) 550 (100) 118 (100) a The six mutations included in the panels proposed are in bold. Login to comment

[hide] Identification and characterization of CFTR gene m... Ann Hum Genet. 2009 Jan;73(1):26-33. Epub 2008 Sep 8. Sharma N, Singh M, Kaur G, Thapa BR, Prasad R
Identification and characterization of CFTR gene mutations in Indian CF patients.
Ann Hum Genet. 2009 Jan;73(1):26-33. Epub 2008 Sep 8., [PMID:18782298]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. This study was performed on Indian CF patients (n = 50) to investigate the spectrum of mutations in the CFTR gene and their association with intragenic and extragenic marker haplotypes. We report identification of 14 previously known and eight novel mutations, namely 3986-3987delC, 876-6del4, 1792InsA, L69H, S158N, Q493L, I530L and E1329Q. The frequency of delta F508 was found to be 27%. Absolute linkage between delta F508 and the KM.19-GATT-TUB9-M470V-T854T haplotype (2-2-1-1-1) predicts a relatively recent appearance of delta F508 in Indian CF patients. Low frequency of delta F508 mutation and detection of eight novel and thirteen rare mutations reflect a heterogeneous spectrum of mutations in Indian CF patients. Failure to detect mutations in 34% of alleles indicates the possible presence of gross deletions involving one or more exons or may indicate the location of the molecular defects in either the noncoding parts of the gene or in the promoter region, which warrants analysis of those regions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 They included nine missense mutations (L69H, S158N, Q493L, Y517C, V520F, I530L, S549N, E1329Q, and Y1381H), one insertion mutation (1792insA), three splice site mutations (876-6del4, 1525-1G-A, 3120+1G-A), two deletion mutations (1161delC, 3986delC), and 1 nonsense mutation (L218X). Login to comment
96 Table 2 Genotypes of CF subjects (n=50) Genotype Number of subjects Delta F508/Delta F508 5 Delta F508/3849+10kb C-T 1 Delta F508/S549N 2 Delta F508/S158N 1 Delta F508/Y1381H 1 Delta F508/1525-1 G-A 2 V520F/R117H 1 I530L/I530L 1 876-6del4/876-6del4 1 1792ins A/1792insA 1 3986-3987delC/3986-3987delC 1 Delta F508/U 10 1161 delC/U 2 L69H/U 1 R117H/U 1 Q493L/U 1 Y517C/U 1 S549N/U 3 G551D/U 1 E1329Q/U 1 N1303K/U 1 Y1381H/U 1 L218X/U 1 R553X/U 1 1525-1G-A/U 3 3120+1G-A/U 2 3849+10kb C-T/U 2 U/U 1 U-unidentified Table 3 Outcome prediction scores of novel substitution mutations identified in Indian CF patients Wild type Mutant Position Output Reliablity Prediction L H 69 0.5210 0 Pathological S N 158 0.3304 3 Neutral Q L 493 0.7784 5 Pathological I L 530 0.0591 8 Neutral E Q 1329 0.1018 7 Neutral Molecular Modelling and Bioinformatics (MMB) program (http://mmb.pcb.ub.es/PMut/) was used for pathological predictions of novel sequence variants. Login to comment
113 We first identified five of the mutations by ARMS (Delta F508, R117H, R553X, N1303K & G551D) and one by restriction digestion (3849+10kbC-T) and later identified by SSCP eight known (Y517C, V520F, S549N, Y1381H, 1525-1G-A, 3120+1G-A, 1161delC and L218X) and eight previously unreported mutations (L69H, S158N, Q493L, I530L, E1329Q, 876-6del4, 1792insA and 3986-3987delC). Login to comment

[hide] Population-based carrier screening for cystic fibr... Aust N Z J Obstet Gynaecol. 2009 Oct;49(5):484-9. Massie J, Petrou V, Forbes R, Curnow L, Ioannou L, Dusart D, Bankier A, Delatycki M
Population-based carrier screening for cystic fibrosis in Victoria: the first three years experience.
Aust N Z J Obstet Gynaecol. 2009 Oct;49(5):484-9., [PMID:19780730]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common inherited, life-shortening condition affecting Australian children. The carrier frequency is one per 25 and most babies with CF are born to parents with no family history. Carrier testing is possible before a couple has an affected infant. AIMS: To report the outcomes of a carrier screening program for CF. METHOD: Carrier screening was offered to women and couples planning a pregnancy, or in early pregnancy, through obstetricians and general practitioners in Victoria, Australia. Samples were collected by cheek swab and posted to the laboratory. Twelve CFTR gene mutations were tested. Carriers were offered genetic counselling and partner testing. Carrier couples were offered prenatal testing by chorionic villous sampling (CVS) if pregnant. The number of people tested, carriers detected and pregnancy outcomes were recorded from January 2006 to December 2008. RESULTS: A total of 3200 individuals were screened (3000 females). One hundred and six carriers were identified (one per 30, 95% confidence interval one per 25, one per 36). All carrier partners were screened, and nine carrier couples identified (total carriers 115). Ninety-six individuals (83%) were carriers of the p.508del mutation. Of the nine carrier couples, six were pregnant at the time of screening (five natural conception and one in vitro fertilisation) and all had CVS (mean gestation 12.5 weeks). Two fetuses were affected, three were carriers and one was not a carrier. Termination of pregnancy was undertaken for the affected fetuses. CONCLUSION: Carrier screening for CF by obstetricians and general practitioners by cheek swab sample can be successfully undertaken prior to pregnancy or in the early stages of pregnancy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 Although we have promoted the uptake of CF carrier screening to both partners in the relationship it is evident Table 1 Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations identified in 2006-2008 CFTR gene mutation n p.508del 96 W1282X 5 c.3718-2477C > T 5 p.G551D 3 p.G542X 1 p.N1303K 1 p.507del 1 p.R560T 1 p.R553X 1 c.489+1G > T 1 p.V520F 0 c.1585-1G > A 0 Total 115 Carrierscreeningforcysticfibrosis (c)2009TheAuthors487 Journalcompilation(c)2009TheRoyalAustralianandNewZealandCollegeofObstetriciansandGynaecologists;49:484-489 Table 2 Carrier couples detected by cystic fibrosis population screening program, Victoria 2006-2008 Subjects Timing of CF carrier test (gestation) Conception Parents genotype Counselling Prenatal diagnosis Status of pregnancy Future plans 1 Pre-pregnancy Natural Both Genetic counsellor and CF physician CVS 12 weeks Termination of pregnancy 2008: Second pregnancy: CVS: carrier p508delp.508del Affected (p.508del/p.508del) 2 10 weeks Natural Both Genetic counsellor and CF physician CVS 12 weeks Continued p.508del Unaffected (no mutations) 3 11 weeks Natural Both Genetic counsellor CVS 13 weeks Continued p.508del Carrier (p.508del/-) 4 10 weeks Natural Both Genetic counsellor CVS 13 weeks Continued p.508del Carrier (p.508del/-) 5 11 weeks Natural Both Genetic counsellor CVS 13 weeks Continued p.508del Unaffected (no mutations) 6* 9 weeks IVF Both Genetic counsellor and CF physician CVS 12 weeks Termination of pregnancy Currently undergoing IVF conception with PGD.p.508del Affected (p.508del/p.508del) 7 Pre-pregnancy Not applicable Both Genetic counsellor and CF physician CVS 12 weeks Continued Did not attend PGD, established natural pregnancy 2 months after seen by genetic counsellor and respiratory physician p.508del Carrier p.508del 8** Pre-pregnancy Not applicable Both Genetic counsellor Not applicable Not applicable Likely to pursue PGD p.508del 9*** Pre-pregnancy Not applicable c.3718-2477C > T, Genetic counsellor and CF physician Not applicable Not applicable Likely to pursue PGD p.W1282X *This couple had an IVF pregnancy but were not offered carrier screening until nine weeks gestation. Login to comment
38 The following 12 mutations were screened using a polymerase chain reaction multiplex: p.508del, p.G551D, p.G542X, p.N1303K, c.1585-1G > A, p.I507del, p.R560T, p.W1282X, p.V520F, c.489+1G > T, p.R553X and c.3718-2477C > T. Login to comment

[hide] Non-classic cystic fibrosis associated with D1152H... Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15. Burgel PR, Fajac I, Hubert D, Grenet D, Stremler N, Roussey M, Siret D, Languepin J, Mely L, Fanton A, Labbe A, Domblides P, Vic P, Dagorne M, Reynaud-Gaubert M, Counil F, Varaigne F, Bienvenu T, Bellis G, Dusser D
Non-classic cystic fibrosis associated with D1152H CFTR mutation.
Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15., [PMID:19843100]

Abstract [show]
BACKGROUND: Limited knowledge exists on phenotypes associated with the D1152H cystic fibrosis transmembrane conductance regulator (CFTR) mutation. METHODS: Subjects with a D1152H allele in trans with another CFTR mutation were identified using the French Cystic Fibrosis Registry. Phenotypic characteristics were compared with those of pancreatic insufficient (PI) and pancreatic sufficient (PS) cystic fibrosis (CF) subjects in the Registry (CF cohort). RESULTS: Forty-two subjects with D1152H alleles were identified. Features leading to diagnosis included chronic sinopulmonary disease (n = 25), congenital absence of the vas deferens (n = 11), systematic neonatal screening (n = 4), and genetic counseling (n = 2). Median age at diagnosis was 33 [interquartile range (IQR, 24-41)] years in D1152H subjects. Median sweat chloride concentrations were 43.5 (39-63) mmol/l in D1152H subjects and were markedly lower than in PI and PS CF subjects (p < 0.05). Bronchiectasis was present in 67% of D1152H subjects, but Pseudomonas aeruginosa colonization and pancreatic insufficiency were present in <30% of subjects. Estimated rates of decline in forced expiratory volume in 1 s (FEV(1)) were lower in D1152H subjects vs PI CF subjects (p < 0.05). None of the D1152H subjects identified since 1999 had died or required lung transplantation. CONCLUSIONS: When present in trans with a CF-causing mutation, D1152H causes significant pulmonary disease, but all subjects had prolonged survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The CF genetic analysis panel used in France seeks for 32 mutations: G85E, 394delTT, 621+1G>T, 711+1G>T, R334W, R347P, R347H, 1078delT, 5T/7T/9T, A455E, F508del, I507del, V520F, 1717-1G>A, G542X, G551D, R553X, R560T, S549R (T>G), S549N, 1898+1G>A, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, R1162X, 3659delC, 3849+10kbC>T, W1282X, 3905insT, 3876delA, N1303K. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Cancer. 2010 Jan 1;116(1):203-9. McWilliams RR, Petersen GM, Rabe KG, Holtegaard LM, Lynch PJ, Bishop MD, Highsmith WE Jr
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma.
Cancer. 2010 Jan 1;116(1):203-9., 2010-01-01 [PMID:19885835]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are common in white persons and are associated with pancreatic disease. The purpose of this case-control study was to determine whether CFTR mutations confer a higher risk of pancreatic cancer. METHODS: In a case-control study, the authors compared the rates of 39 common cystic fibrosis-associated CFTR mutations between 949 white patients with pancreatic adenocarcinoma and 13,340 white controls from a clinical laboratory database for prenatal testing for CFTR mutations. The main outcome measure was the CFTR mutation frequency in patients and controls. RESULTS: Overall, 50 (5.3%) of 949 patients with pancreatic cancer carried a common CFTR mutation versus 510 (3.8%) of 13,340 controls (odds ratio [OR], 1.40; 95% confidence interval [CI], 1.04-1.89; P = .027). Among patients who were younger when their disease was diagnosed (<60 years), the carrier frequency was higher than in controls (OR, 1.82; 95% CI, 1.14-2.94; P = .011). In patient-only analyses, the presence of a mutation was associated with younger age (median 62 vs 67 years; P = .034). In subgroups, the difference was seen only among ever-smokers (60 vs 65 years, P = .028). Subsequent sequencing analysis of the CFTR gene detected 8 (16%) compound heterozygotes among the 50 patients initially detected to have 1 mutation. CONCLUSIONS: Carrying a disease-associated mutation in CFTR is associated with a modest increase in risk for pancreatic cancer. Those affected appear to be diagnosed at a younger age, especially among smokers. Clinical evidence of antecedent pancreatitis was uncommon among both carriers and noncarriers of CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 (%) of Controls, n513,340 Significance Not detected 899 (94.7) 12,830 (96.2) OR, 1.40 (95% CI, 1.04-1.89) Detected 50 (5.3) 510 (3.8) P¼.027 DF508*,y 35 (70) 354 (69.4) R117H*,z 5 (10) 71 (13.9) G551D*,y 1 (2) 11 (2.2) N1303K*,y 1 (2) 8 (1.6) G542X*,y 8 (1.6) 1717-1G>A*,y 7 (1.4) 278915G>A* 6 (1.2) R553X*,y 6 (1.2) W1282X*,y 5 (10) 5 (1.0) R347H 5 (1.0) R1162X*,y 4 (0.8) 62111G>T*,y 4 (0.8) R560T*,y 3 (0.6) R347P* 1 (2) 2 (0.4) A455E* 2 (0.4) 3849110kbC>T* 2 (0.4) 394delTT 2 (0.4) G85E* 2 (0.4) 3905insTy 2 (0.4) 189811G>A* 2 (0.4) 2183AA>G 1 (0.2) 2184delA*,y 1 (0.2) 71111G>T*,y 1 (0.2) V520F 1 (0.2) S549Ry 1 (2) DI507*,y 1 (2) OR indicates odds ratio; CI, confidence interval. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment
152 In contrast, V520 is less conserved, but V520F is a severe mutation. Login to comment
57 PI prevalence and in silico prediction scores for 13 most frequent missense mutations identified in Canadian CF patients Mutation Total PI Total (PI + PS) PI prevalence Class PANTHER scorea POLYPHENa SIFTa p.R334W 1 9 0.11 CF-PS -7.4419 Possibly damaging 0.01 p.P67L 2 14 0.14 CF-PS -4.1736 Probably damaging 0 p.R347P 2 12 0.17 CF-PS -7.5259 Possibly damaging 0.01 p.R347H 1 5 0.20 CF-PS -6.8327 Possibly damaging 0 p.A455E 8 39 0.21 CF-PS -8.8641 Probably damaging 0 p.L206W 4 19 0.21 CF-PS -8.5817 Possibly damaging 0 p.P574H 4 7 0.57 CF-PI/PSb -8.1252 Probably damaging 0 p.G85E 15 24 0.63 CF-PI/PSb -7.3194 Possibly damaging 0 p.M1101K 22 33 0.67 CF-PI/PSb -5.8849 Probably damaging 0.01 p.R1066C 7 8 0.88 CF-PI -7.7424 Probably damaging 0 p.G551D 56 59 0.95 CF-PI -9.5654 Probably damaging 0 p.N1303K 47 49 0.96 CF-PI -9.7687 Probably damaging 0 p.V520F 7 7 1.00 CF-PI -7.1652 Benign 0 aPANTHER scores range from zero to negative values (maximum -12). Login to comment
124 SIFT-generated low (deleterious) scores for missense mutations associated both with the highest (p.N1303K, p.G551D, p.V520F) and the lowest PI prevalence scores (p.A455E, p.P67L, p.L206W). Login to comment
128 Conversely, PolyPhen assigned the intermediate mutation p.M1101K with other PS mutations as 'possibly damaging`, and the p.V520F was misclassified as 'benign`. Login to comment

[hide] Incidence, prevalence, etiology, and prognosis of ... Dig Dis Sci. 2010 Oct;55(10):2988-98. Epub 2010 Jan 28. Joergensen M, Brusgaard K, Cruger DG, Gerdes AM, de Muckadell OB
Incidence, prevalence, etiology, and prognosis of first-time chronic pancreatitis in young patients: a nationwide cohort study.
Dig Dis Sci. 2010 Oct;55(10):2988-98. Epub 2010 Jan 28., [PMID:20108119]

Abstract [show]
BACKGROUND/AIMS: Publications on etiology of chronic pancreatitis (CP) are infrequent. Etiologies today encompass genetic disorders. We wanted to describe etiologies of today and identify patients with genetic disorders like hereditary pancreatitis (HP), mutations in Serine Protease Inhibitor Kazal type1 (SPINK1), and the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR) among patients formerly considered to have idiopathic CP. METHODS: Data on patients diagnosed with first-time CP < 30 years of age in Denmark identified in the Danish National Registry of Patients were retrieved. Patients previously considered to have idiopathic pancreatitis were offered genetic counseling and evaluation for HP, SPINK1, and CFTR mutations. RESULTS: In the period 1980-2004, 580 patients < 30 years of age presented with CP, the standardized prevalence ratio of CP increased from 11.7 per 100,000 person years in 1980-1984 to 17.0 per 100,000 in 2000-2004 (p < 0.001). The odds ratio (OR) having gallstone-related CP increased in the latter time period, especially in women, that of alcohol-induced CP decreased over time. OR having idiopathic CP increased in the latter period; 50% of patients with idiopathic pancreatitis accepted genetic reevaluation; 28 patients had a genetic mutation that totally or partly could explain their pancreatitis, nine of these had two, and 11 patients had HP. CONCLUSION: The prevalence of CP, especially in women, increased over time. Genetic causes that partly or totally could explain the CP were found in 54.90% (95% CI (40.45-68.62)) of those with idiopathic CP, as a minimum estimation 1.9% (95% CI (1.00-3.47)) of the total cohort had HP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 1G [ A, V520F, 1898 ? Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Low abundance of sweat duct Cl- channel CFTR in bo... Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12. Brown MB, Haack KK, Pollack BP, Millard-Stafford M, McCarty NA
Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise.
Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12., [PMID:21228336]

Abstract [show]
To understand potential mechanisms explaining interindividual variability observed in human sweat sodium concentration ([Na(+)]), we investigated the relationship among [Na(+)] of thermoregulatory sweat, plasma membrane expression of Na(+) and Cl(-) transport proteins in biopsied human eccrine sweat ducts, and basal levels of vasopressin (AVP) and aldosterone. Lower ductal luminal membrane expression of the Cl(-) channel cystic fibrosis transmembrane conductance regulator (CFTR) was observed in immunofluorescent staining of sweat glands from healthy young adults identified as exceptionally "salty sweaters" (SS) (n = 6, P < 0.05) and from patients with cystic fibrosis (CF) (n = 6, P < 0.005) compared with ducts from healthy young adults with "typical" sweat [Na(+)] (control, n = 6). Genetic testing of healthy subjects did not reveal any heterozygotes ("carriers") for any of the 39 most common disease-causing CFTR mutations in the United States. SS had higher baseline plasma [AVP] compared with control (P = 0.029). Immunostaining to investigate a potential relationship between higher plasma [AVP] (and sweat [Na(+)]) and ductal membrane aquaporin-5 revealed for all groups a relatively sparse and location-dependent ductal expression of the water channel with localization primarily to the secretory coil. Availability of CFTR for NaCl transport across the ductal membrane appears related to the significant physiological variability observed in sweat salt concentration in apparently healthy humans. At present, a heritable link between healthy salty sweaters and the most prevalent disease-causing CFTR mutations cannot be established.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
114 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment
119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment

[hide] Clinical outcomes in infants with cystic fibrosis ... Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475. Ren CL, Desai H, Platt M, Dixon M
Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome.
Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475., 2011-04-29 [PMID:21538969]

Abstract [show]
An unavoidable outcome of cystic fibrosis newborn screening (CF NBS) programs is the detection of infants with an indeterminate diagnosis. The United States CF Foundation recently proposed the term cystic fibrosis transmembrane conductance regulator related metabolic syndrome (CRMS) to describe infants with elevated immunoreactive trypsinogen (IRT) on NBS who do not meet diagnostic criteria for CF. The objective of this study was to describe the clinical outcomes of infants with CRMS identified through an IRT/DNA algorithm. We reviewed the records of all infants with CRMS diagnosed at our CF Center from 2002 to 2010. We identified 12 infants, and compared them to 27 infants diagnosed with CF by NBS. Compared to CF patients, CRMS patients were more likely to be pancreatic sufficient as assessed by fecal elastase measurement (100% vs. 8%, P < 0.01). Their weight for age percentile was normal from birth. A positive oropharyngeal (OP) culture for Pseudomonas aeruginosa (Pa) was found in 25% of CRMS patients. One patient with the F508del/R117H/7T genotype was reassigned the diagnosis of CF after he had a positive OP culture for Pa, and his follow up sweat Cl at 1 year of life was 73 mmol/L. CF patients were more likely to receive oral antibiotics and be hospitalized for pulmonary symptoms. Our results indicate that CRMS patients can develop signs of CF disease, but have a milder clinical course than CF infants. Close initial monitoring of these patients is warranted. Pediatr. Pulmonol. (c) 2011 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment
61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment

[hide] Alpha1-antitrypsin deficiency alleles and the Taq-... Eur Respir J. 1998 Apr;11(4):873-9. Mahadeva R, Westerbeek RC, Perry DJ, Lovegrove JU, Whitehouse DB, Carroll NR, Ross-Russell RI, Webb AK, Bilton D, Lomas DA
Alpha1-antitrypsin deficiency alleles and the Taq-I G-->A allele in cystic fibrosis lung disease.
Eur Respir J. 1998 Apr;11(4):873-9., [PMID:9623690]

Abstract [show]
Cystic fibrosis (CF) is characterized by progressive and ultimately fatal pulmonary disease although there are notable variations in clinical features. This heterogeneity is thought to lie outside the cystic fibrosis transmembrane regulator (CFTR) gene locus and may stem from deficiencies in the antiproteinase screen that protects the lung from proteolytic attack. One hundred and fifty seven patients were recruited from two UK CF centres. The serum concentrations of alpha1-antitrypsin, alpha1-antichymotrypsin and C-reactive protein (CRP) were determined and patients were screened for the common S and Z deficiency alleles of alpha1-antitrypsin and the G-->A mutation in the 3' noncoding region of the alpha1-antitrypsin gene (Taq-I G-->A allele). Alpha1-antitrypsin deficiency phenotypes were detected in 20 (16 MS, 1 S and 3 MZ) out of 147 unrelated tested CF patients and were, surprisingly, associated with significantly better lung function (adjusted mean forced expiratory volume in one second (FEV1) 62.5% of predicted for deficient group and 51.1% pred for normal alleles; p=0.043). The Taq-I G-->A allele was found in 21 out of 150 unrelated patients and had no significant effect on CF lung disease or on levels of alpha1-antitrypsin during the inflammatory response. We show here that, contrary to current thinking, common mutations of alpha1-antitrypsin that are associated with mild to moderate deficiency of the protein predict a subgroup of cystic fibrosis patients with less severe pulmonary disease. Moreover, the Taq-I G-->A allele has no effect on serum levels of alpha1-antitrypsin in the inflammatory response, which suggests that the previously reported association of the Taq-I G-->A allele with chronic obstructive pulmonary disease is not mediated by its effect on the serum level of alpha1-antitrypsin.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The 39 "other" CF mutations in the normal α1-AT phenotype 508/other group were: six patients G551D, three R117H, three 621+1G→T, two R1162X, two G542X and one each had P67L, 1078delT, 2711delT, 1717-1G→A, V520F, 1898+1G→T, W1310X and N1303K in addition to the ∆F508 mutation. Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... N Engl J Med. 1998 Sep 3;339(10):645-52. Sharer N, Schwarz M, Malone G, Howarth A, Painter J, Super M, Braganza J
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
N Engl J Med. 1998 Sep 3;339(10):645-52., 1998-09-03 [PMID:9725921]

Abstract [show]
BACKGROUND: The pancreatic lesions of cystic fibrosis develop in utero and closely resemble those of chronic pancreatitis. Therefore, we hypothesized that mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene may be more common than expected among patients with chronic pancreatitis. METHODS: We studied 134 consecutive patients with chronic pancreatitis (alcohol-related disease in 71, hyperparathyroidism in 2, hypertriglyceridemia in 1, and idiopathic disease in 60). We examined DNA for 22 mutations of the CFTR gene that together account for 95 percent of all mutations in patients with cystic fibrosis in the northwest of England. We also determined the length of the noncoding sequence of thymidines in intron 8, since the shorter the sequence, the lower the proportion of normal CFTR messenger RNA. RESULTS: The 94 male and 40 female patients ranged in age from 16 to 86 years. None had a mutation on both copies of the CFTR gene. Eighteen patients (13.4 percent), including 12 without alcoholism, had a CFTR mutation on one chromosome, as compared with a frequency of 5.3 percent among 600 local unrelated partners of persons with a family history of cystic fibrosis (P<0.001). A total of 10.4 percent of the patients had the 5T allele in intron 8 (14 of 134), which is twice the expected frequency (P=0.008). Four patients were heterozygous for both a CFTR mutation and the 5T allele. Patients with a CFTR mutation were younger than those with no mutations (P=0.03). None had the combination of sinopulmonary disease, high sweat electrolyte concentrations, and low nasal potential-difference values that are diagnostic of cystic fibrosis. CONCLUSIONS: Mutations of the CFTR gene and the 5T genotype are associated with chronic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 DNA Studies We extracted DNA from buccal cells obtained by having the patients rinse their mouths with 10 ml of 4 percent sucrose.19 The CFTR locus was examined for the 22 mutations that together account for 95 percent of all such mutations in patients with cystic fibrosis in the northwest of England.20 The amplification- refractory mutation system Elucigene CF(4)m kit (Zeneca Diagnostics, Macclesfield, United Kingdom) was used to detect the four most common mutations: ∆F508, G551D, G542X, and 621+1(G→T)21; the polymerase chain reaction, restriction-enzyme analysis, and allele-specific oligonucleotide hybridization facilitated the detection of R560T, R117H, 1898+1(G→A), R553X, S549N, 1717¡1(G→A), N1303K, W1282X, E60X, 1154insTC, R347P, 3659delC, Q493X, V520F, R334W, ∆I507, 3849+10Kb(C→T), and 1078delT. Login to comment

[hide] When good CF tests go bad. Eur J Hum Genet. 2009 Apr;17(4):403-5. Epub 2008 Dec 3. McDevitt T, Barton D
When good CF tests go bad.
Eur J Hum Genet. 2009 Apr;17(4):403-5. Epub 2008 Dec 3., [PMID:19050722]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 During validation studies, we observed genotype miscalls for two cases with compound genotypes, comprising p.Phe508del and p.Val520Phe in one case and p.Phe508del and p.Gln493X in the other. Login to comment

[hide] Genetic, epidemiological, and clinical aspects of ... Am J Gastroenterol. 2010 Aug;105(8):1876-83. Epub 2010 May 25. Joergensen MT, Brusgaard K, Cruger DG, Gerdes AM, Schaffalitzky de Muckadell OB
Genetic, epidemiological, and clinical aspects of hereditary pancreatitis: a population-based cohort study in Denmark.
Am J Gastroenterol. 2010 Aug;105(8):1876-83. Epub 2010 May 25., [PMID:20502448]

Abstract [show]
OBJECTIVES: In a population-based, well-defined group of patients first regarded as having pancreatitis of unknown origin (PUO), we identified, described, and compared the clinical and genetic aspects of patients with hereditary pancreatitis (HP) and with cystic fibrosis transmembrane conductance regulator gene (CFTR) and serine protease inhibitor Kazal type 1 gene (SPINK1) mutations with patients who retained the diagnosis of true idiopathic pancreatitis (tIP) after genetic testing for HP, SPINK1, and CFTR mutations. METHODS: Patients with PUO were identified in the Danish National Registry of Patients or were referred by clinicians. DNA from blood was analyzed for cationic trypsinogen (PRSS1), SPINK1, and CFTR mutations. Considering the diagnosis of HP, a pedigree was drawn for each patient. RESULTS: A genetic mutation was found in 40% of 122 patients with PUO. After testing first-degree relatives of the 18 initially identified HP patients, 38 HP patients in total were identified, and 28 patients had SPINK1-CFTR mutations. Among HP patients, no p.N29I mutations were found and the p.A16V mutation was more frequent than previously reported, 45 and 32% had exocrine and endocrine insufficiency, respectively, and among tIP patients 9 and 12%, respectively. Pancreatic cancer was diagnosed in 5% of the HP families. CONCLUSIONS: The genotype of the Danish population with HP differs from that of previously described cohorts. The occurrence of exocrine and endocrine insufficiency is higher among patients with HP than in patients with SPINK1-CFTR mutations and tIP, and more HP families develop pancreatic cancer. Genetic testing thus helps to predict the prognosis of the pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 The samples were also tested for 33 CFTR mutations, and all 6 classeswererepresented:394delTT,p.R553X,621+1G>T,p.R1162X, 1717-1G>A,3659delC,p.G542X,2183AA>G,p.W1282X,1078delT, 711+1G>T, F508del, p.S549N, I507del, p.S549R, 2184delA, p.G551D, p.G85E, p.N1303K, p.R560T, p.R117H, p.R347H, p.R347P, p.R334W, 2789+5G>A, 3849+10kbC>T, p.A445E, 3120+1G>A, p.V520F,1898+1G>A,3876delA,3905insT,andIVS8-5T.DNAwas amplified by multiplex PCR (Hybaid 4 A62, Middlesex, UK). Login to comment

[hide] Cystic fibrosis in Chilean patients: Analysis of 3... J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30. Lay-Son G, Puga A, Astudillo P, Repetto GM
Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations.
J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30., [PMID:21036675]

Abstract [show]
BACKGROUND: CFTR gene mutations have worldwide differences in prevalence and data on Chilean patients is scarce. METHODS: We studied 36 of the most common CFTR mutations in Chilean patients from the CF National Program [Programa Nacional de Fibrosis Quistica (PNFQ)] of the Ministry of Health of Chile. RESULTS: Two hundred and eighty-nine patients were studied. Fourteen different mutations were identified with an overall allele detection rate of 42.0%. Mutations with frequencies greater than 1% were p.F508del (30.3% of alleles), p.R334W (3.3%), p.G542X (2.4%), c.3849+10Kb C>T (1.7%), and p.R553X (1.2%). A north to south geographical gradient was observed in the overall rate of detection. CONCLUSIONS: Southern European CFTR mutations predominate in the Chilean population, but a high percentage of alleles remain unknown. Geographical heterogeneity could be explained in part by admixture. Complementary analyses are necessary to allow for effective genetic counselling and improve cost-effectiveness of screening and diagnostic tests.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] Lessons learned from 20 years of newborn screening... Med J Aust. 2012 Jan 16;196(1):67-70. Massie RJ, Curnow L, Glazner J, Armstrong DS, Francis I
Lessons learned from 20 years of newborn screening for cystic fibrosis.
Med J Aust. 2012 Jan 16;196(1):67-70., [PMID:22256939]

Abstract [show]
OBJECTIVE: To compare three cystic fibrosis (CF) newborn screening strategies used in Victoria since 1989. DESIGN, SETTING AND PARTICIPANTS: Retrospective review of newborn screening and clinical records for people with CF born in Victoria between 1989 and 2008 to compare screening strategies: repeat immunoreactive trypsinogen (IRT) testing (IRT/IRT, 1989-1990), IRT and p.F508del mutation analysis (IRT/p.F508del, 1991-2006) and IRT with analysis of 12 CFTR mutations (IRT/12 mutations, 2007-2008). MAIN OUTCOME MEASURES: Total number of infants screened, people identified with CF (by screening or clinical diagnosis), number of CF-affected terminations of pregnancy, and number of carriers detected. RESULTS: There were 420 people born with CF (live-birth prevalence, 1/3139; 95% CI, 1/2853-1/3462) and 78 CF-affected pregnancy terminations (overall prevalence, 1/2647; 95% CI, 1/2425-1/2896). Of the babies born with CF, 283 (67.4%) were detected by newborn screening alone, 61 (14.5%) had meconium ileus, 33 (7.9%) had a family history of CF, nine (2.1%) were diagnosed antenatally, and 34 (8.1%) were missed by screening (17 missed because IRT level was < 99th percentile, two with repeat IRT level not elevated, 14 without a screened CFTR mutation, and one with missing data). The sensitivities of the protocols were 86.6% for IRT/IRT, 89.9% for IRT/p.F508del, and 95.8% for IRT/12 mutations. Including 12 mutations in the analysis detected one patient who would otherwise have been missed and, had this protocol been implemented from 1989, it would have detected four others. CONCLUSION: Most babies with CF without meconium ileus, a family history or antenatal diagnosis are detected by newborn screening. Despite improved sensitivity with the 12-mutation analysis, most infants detected would have been diagnosed using the IRT/p.F508del protocol.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 From 1991 to 2006, babies with an IRT level > 99th percentile had CFTR gene mutation analysis for p.F508del and, from 2007, for 12 CFTR mutations (p.F508del, p.G551D, p.G542X, p.N1303K, c.1585- 1G>A, p.I507del, p.R560T, p.W1282X, p.V520F, c.489+1G>T, p.R553X, c.3718-2477C>T). Login to comment

[hide] Variation in MSRA modifies risk of neonatal intest... PLoS Genet. 2012;8(3):e1002580. Epub 2012 Mar 15. Henderson LB, Doshi VK, Blackman SM, Naughton KM, Pace RG, Moskovitz J, Knowles MR, Durie PR, Drumm ML, Cutting GR
Variation in MSRA modifies risk of neonatal intestinal obstruction in cystic fibrosis.
PLoS Genet. 2012;8(3):e1002580. Epub 2012 Mar 15., [PMID:22438829]

Abstract [show]
Meconium ileus (MI), a life-threatening intestinal obstruction due to meconium with abnormal protein content, occurs in approximately 15 percent of neonates with cystic fibrosis (CF). Analysis of twins with CF demonstrates that MI is a highly heritable trait, indicating that genetic modifiers are largely responsible for this complication. Here, we performed regional family-based association analysis of a locus that had previously been linked to MI and found that SNP haplotypes 5' to and within the MSRA gene were associated with MI (P = 1.99 x 10(-5) to 1.08 x 10(-6); Bonferroni P = 0.057 to 3.1 x 10(-3)). The haplotype with the lowest P value showed association with MI in an independent sample of 1,335 unrelated CF patients (OR = 0.72, 95% CI [0.53-0.98], P = 0.04). Intestinal obstruction at the time of weaning was decreased in CF mice with Msra null alleles compared to those with wild-type Msra resulting in significant improvement in survival (P = 1.2 x 10(-4)). Similar levels of goblet cell hyperplasia were observed in the ilea of the Cftr(-/-) and Cftr(-/-)Msra(-/-) mice. Modulation of MSRA, an antioxidant shown to preserve the activity of enzymes, may influence proteolysis in the developing intestine of the CF fetus, thereby altering the incidence of obstruction in the newborn period. Identification of MSRA as a modifier of MI provides new insight into the biologic mechanism of neonatal intestinal obstruction caused by loss of CFTR function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
221 Subjects with p.Gly551Asp carried this mutation in trans with another PI-associated mutation: p.Cys343X (c.1029delC), c.1585-1G.A, p.Lys1177SerfsX15 (c.3528delC), c.489+1G.T, p.Glu585X (c.1753G.T), p.Phe508del, p.Gly542X (c.1624G.T), p.Gly551Asp, p.Asn1303Lys (c.3909C .G), p.Arg553X (c.1657C.T), p.Val520Phe (c.1558G.T), or p.Trp1282X (c.3846G.A). Login to comment
222 Subjects with p.Gly551Asp carried this mutation in trans with another PI-associated mutation: p.Cys343X (c.1029delC), c.1585-1G.A, p.Lys1177SerfsX15 (c.3528delC), c.489+1G.T, p.Glu585X (c.1753G.T), p.Phe508del, p.Gly542X (c.1624G.T), p.Gly551Asp, p.Asn1303Lys (c.3909C .G), p.Arg553X (c.1657C.T), p.Val520Phe (c.1558G.T), or p.Trp1282X (c.3846G.A). Login to comment

[hide] First study of the F508del mutation in Malaysian c... J Paediatr Child Health. 2011 Aug;47(8):573-5. doi: 10.1111/j.1440-1754.2011.02149.x. Nathan AM, Thong MK, deBruyne J, Ariffin H
First study of the F508del mutation in Malaysian children diagnosed with cystic fibrosis.
J Paediatr Child Health. 2011 Aug;47(8):573-5. doi: 10.1111/j.1440-1754.2011.02149.x., [PMID:21843195]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Letters to the Editor Journal of Paediatrics and Child Health 47 (2011) 572-575 (c) 2011 The Authors Journal of Paediatrics and Child Health (c) 2011 Paediatrics and Child Health Division (Royal Australasian College of Physicians) Table1Summaryoftheclinicalcharacteristics,sweattestresultsandcysticfibrosistransmembraneconductanceregulatormutationstudiesofthepatientsdiagnosedwithcysticfibrosisinUniversity MalayaMedicalCenterfrom2000to2009 PatientAgeat presentation PresentingsymptomsOtherfindingsConsanguinityRaceSweatconductivity (mmol/l) KS score Mutations Rin3monthsRecurrentpneumoniaandFTTPseudo-Bartter`ssyndromeYesIndian13440†Nonedetected Nes8yearsSeverepersistentasthmaFTTNoIndian12450F508del/unknown Abd4monthsSeverepneumoniaandventilator dependent FTTYesYemeni11730F508del/F508del Ben7yearsCirrhosisoftheliverwithportal hypertension FTTUnknown(adopted)Unknown14080†Nonedetected(7T polymorphism) Sak3monthsRecurrentpneumoniaandFTTNDYesIndian11350F508del/F508del Ngan3yearsPseudo-Bartter`ssyndromeNDNoChinese13790Notdone(parentsrefused) LJH5monthsPseudo-Bartter`ssyndromeRecurrentpneumoniaNoChinese/Indonesian9465F508delnegative Josh5monthsPseudo-Bartter`ssyndromeandFTTNDNoIndian8585†Nonedetected Nur3monthsChronicdiarrhoeaandFTTPseudo-Bartter`ssyndromeNoMalay/Chinese13085‡†R553X/nonedetected Vin4monthsRecurrentpneumoniaandFTTNDNoChinese12260F508delnegative Muh5yearsPoorlycontrolledasthmaNDNoMalay10765F508delnegative Naz3monthsFTTandsteatorrhoeaRecurrentlunginfectionsand pseudo-Bartter`s NoMalay14675F508delnegative Additionalmutationsscreenedinthefourpatients:†F508del,I506/7del,G551D,G542X,R553X,R117C,R117H,621+1G>T,V520F,A455E,N1303K,3849+10kbC>T.‡R334W,R347P,A455E,S549N,R560T, 3659delC,W1282X.FTT,failuretothrive;KS,Schwachman-Kulczycki(KS)score;ND,nodata. Login to comment

[hide] Molecular basis of cystic fibrosis disease: an Ind... Indian J Clin Biochem. 2010 Oct;25(4):335-41. Epub 2010 Nov 19. Prasad R, Sharma H, Kaur G
Molecular basis of cystic fibrosis disease: an Indian perspective.
Indian J Clin Biochem. 2010 Oct;25(4):335-41. Epub 2010 Nov 19., [PMID:21966101]

Abstract [show]
Cystic fibrosis is a common autosomal recessive disorder usually found in population of white Caucasian descent. Now it is well documented the presence of CF disease in India with the advancement of laboratory testing. As once it was thought non existence of this disease in our population. Most of the phenotype of CF disease was in accordance of western population. Genetic analysis of CFTR gene in Indian CF patients revealed that most common mutation was delta F508 mutation. However, it was less than Caucasian population. CFTR mutations are also a causative factor in the pathogenesis of male infertility due to obstructive azoospermia. There are two most common mutation viz. IVS8-T5 and delta F508 which are responsible for congenital absence of vas deferens in male infertility patients. Elevated levels of sweat chloride at two occasions along with the presence of two mutations in CFTR gene was gold standard method for diagnosis of CF disease. It is noteworthy here that due to magnitude of Indian population, the total CF disease load would be more than many European countries. Clinical data demonstrate the prevalence of both classical and genetic form of CF in India.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 25 mutation Table 2 CFTR mutation identified in Indian population with classical CF [25] Genotype No. of subjects Delta F508/Delta F508 5 Delta F508/3849?10kb C-T 1 Delta F508/S549 2 Delta F508/Y138H 1 Delta F508/15251G-A 1 V520F/R117H 2 1530L/1530L 1 876-6del4/876-6del4 1 1792insA/1792insA 1 3986-3987delC/3986-3987delC 1 Delta F508/U 10 1161delC/U 2 L69H/U 1 R117H/U 1 Q493L/U 1 Y517C/U 1 S549N/U 3 G551D/U 1 E1329Q/U 1 N1303K/U 1 Y1381H/U 1 L218X/U 1 R553X/U 1 1525-1G-A/U 3 3120?1G-A/U 2 3849?10kbC-T/U 2 U/U 1 U unidentified panel were detected in our population at a combined frequency of (10%). Login to comment
99 The other seven known but rare mutations (1161delC, Y517C, V520F, S549N, Y1381H, L218X and 1525-1G-A) were identified at a combined frequency of (17%), and eight new mutations (3986delC, 1792InsA, L69H, S158N, Q493L, I530L, E1329Q and 876-8del4) identified in our CF population represented (15%) of the total CF alleles analyzed. Login to comment

[hide] The use of DHPLC (Denaturing High Performance Liqu... J Prenat Med. 2010 Jul;4(3):45-8. Mesoraca A, Di Natale M, Cima A, Di Giacomo G, Sarti M, Barone MA, Bizzoco D, Cignini P, Mobili L, D'emidio L, Giorlandino C
The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis.
J Prenat Med. 2010 Jul;4(3):45-8., [PMID:22439061]

Abstract [show]
OBJECTIVE: The aim of the study is to evaluate the role of Denaturing High Performance Liquid Chromatography (DHPLC) in the second level screening of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. METHODS: A 9-month prospective study, between June 2008 and March 2009 at Artemisia Fetal Medical Centre, included 3829 samples of amniotic fluid collected from women undergoing mid-trimester amniocentesis.The genetic diagnosis of CF was based on research of the main mutations of the CFTR gene on fetal DNA extracted from the amniocytes, (first level screening) using different commercial diagnostic systems. A second level screening using DHPLC, on the amniotic fluid and on a blood sample from the couple, was offered in case of fetuses heterozygous at first level screening. RESULTS: Of 3829 fetuses, 134 were found to be positive, 129 heterozygous and 5 affected. Of the 129 couples, following appropriate genetic counselling, 53 requested a second level screening. Through the use of DHPLC, 44 couples were found to be negative, and in nine couples, nine rare mutations were identified. CONCLUSIONS: The first level screening can be useful to evidence up to 75% of the CF mutations. The second level screening can identify a further 10% of mutant alleles. DHPLC was found to be a reliable and specific method for the rapid identification of the rare CFTR mutations which were not revealed in initial first level screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations. Login to comment

[hide] Cystic fibrosis carrier frequency and estimated pr... J Cyst Fibros. 2008 Sep;7(5):440-3. Epub 2008 Feb 1. Ratbi I, Genin E, Legendre M, Le Floch A, Costa C, Cherkaoui-Deqqaqi S, Goossens M, Sefiani A, Girodon E
Cystic fibrosis carrier frequency and estimated prevalence of the disease in Morocco.
J Cyst Fibros. 2008 Sep;7(5):440-3. Epub 2008 Feb 1., [PMID:18243066]

Abstract [show]
BACKGROUND: The epidemiology of cystic fibrosis (CF) is poorly known in North African populations, in particular in Morocco and the CF carrier frequency in the general Moroccan population has never been evaluated. METHODS: To estimate the prevalence of CF mutations in Morocco, blood samples from 150 healthy Moroccans were tested for frequent CFTR mutations and the intron 8 polyT variant. RESULTS: Two subjects were heterozygous for F508del and eight others for the (T)5 variant. CONCLUSION: These findings indicate that the Moroccan population is at risk for CF and CFTR-related disorders. CF prevalence could be in the range of that found in European populations. Wider studies are necessary to identify the clinical pattern and accurately determine the prevalence and molecular basis of CF in Morocco.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 We screened for 32 CFTR gene mutations (G85E, 394delTT, R117H, 621+1GNT, 711+1GNT, R334W, R347P, R347H, 1078delT, A455E, I507del, F508del, V520F, 1717-1GNA, G542X, G551D, R553X, R560T, S549R(TNG), S549N, 1898+1GNA, 2183AANG, 2184delA, 2789+5GNA, 3120 + 1G NA, R1162X, 3659delC, 3849 + 10kbC NT, W1282X, 3905insT, 3876delA, N1303K) and the (T)5 splicing variant of intron 8, using a commercial kit (CF v3 Genotyping Assay, Abbott, Rungis, France). Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Complete gene scanning by temperature gradient cap... J Mol Diagn. 2005 Feb;7(1):111-20. Chou LS, Gedge F, Lyon E
Complete gene scanning by temperature gradient capillary electrophoresis using the cystic fibrosis transmembrane conductance regulator gene as a model.
J Mol Diagn. 2005 Feb;7(1):111-20., [PMID:15681482]

Abstract [show]
Many inherited diseases involve large genes with many different mutations. Identifying a wide spectrum of mutations requires an efficient gene-scanning method. By differentiating thermodynamic stability and mobility of heteroduplexes from heterozygous samples, temperature gradient capillary electrophoresis (TGCE) was used to scan the entire coding region of the cystic fibrosis transmembrane conductance regulator gene. An initial panel (29 different mutations) showed 100% agreement between TGCE scanning and previously genotyped results for heterozygous samples. Different peak patterns were observed for single base substitutions and base insertions/deletions. Subsequently, 12 deidentified clinical samples genotyped as wild type for 32 mutations were scanned for the entire 27 exons. Results were 100% concordance with the bidirectional sequence analysis. Ten samples had nucleotide variations including a reported base insertion in intron 14b (2789 + 2insA) resulting in a possible mRNA splicing defect, and an unreported missense mutation in exon 20 (3991 G/A) with unknown clinical significance. This methodology does not require labeled primers or probes for detection and separation through a temperature gradient eliminates laborious temperature optimization required for other technologies. TGCE automation and high-throughput capability can be implemented in a clinical environment for mutation scanning with high sensitivity, thus reducing sequencing cost and effort.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Mutation Samples with Known Genotypes Scanned by TGCE* Exon Mutation† Amplicon size (bp) Location of mutation from 5Ј end (bp) Base change Detection‡ 3 G85E 234 124 G to A 1/1 3 394delTT 234 132 del TT 1/1 4 R117H 270 83 G to T 2/2 4 I148T 270 176 T to C 3/3 Intron 4 621 ϩ 1 G/T 270 233 G to T 1/1 5 663delT/663delT 186 75 del T 0/1 Intron 5 711 ϩ 1 G/T 186 124 G to T 1/1 7 R334W 345 208 C to T 1/1 7 R347P 345 248 G to C 1/1 9 A455E 263 155 C to A 2/2 10 I506V 292 168 A to G 1/1 10 ⌬I507 292 171 del ATC 2/2 10 ⌬F508 292 174 del TTT 2/2 10 ⌬F508/⌬F508 292 174 del TTT 0/1 10 F508C 292 175 T to G 1/1 10 V520F 292 210 G to T 1/1 Intron 10 1717-1 G/A 175 50 G to A 1/1 11 G542X 175 90 G to T 2/2 11 G542X/G542X 175 90 G to T 0/1 11 G551D 175 118 G to A 3/3 11 R553X 175 123 C to T 3/3 11 R560T 175 145 G to C 2/2 13 2184delA 834 356 del A 1/1 Intron 14b 2789 ϩ 5G/A 192 102 G to A 1/1 Intron 16 3120 ϩ 1G/A 216 111 G to A 1/1 19 R1162X 322 68 C to T 1/1 19 3659delC 322 111 del C 1/1 20 W1282X 206 154 G to A 1/1 21 N1303K 250 175 C to G 2/2 Total exon/intron Overall accuracy 17 93% *Samples were compared with their respective wild-type control (confirmed by sequencing). Login to comment

[hide] Microsphere bead arrays and sequence validation of... J Mol Diagn. 2004 Nov;6(4):348-55. Hadd AG, Laosinchai-Wolf W, Novak CR, Badgett MR, Isgur LA, Goldrick M, Walkerpeach CR
Microsphere bead arrays and sequence validation of 5/7/9T genotypes for multiplex screening of cystic fibrosis polymorphisms.
J Mol Diagn. 2004 Nov;6(4):348-55., [PMID:15507674]

Abstract [show]
The development of simple and rapid methods for the detection of the common genetic mutations associated with cystic fibrosis (CF) requires access to positive-control samples including the 5/7/9T variants of intron 8. We used PCR and a simple multiplex bead-array assay to identify 5/7/9T control samples from 29 commercially available DNA samples. Unpurified PCR products were directly hybridized to color-coded beads containing allele-specific capture probes for 5/7/9T detection. The performance of the assay was investigated using reverse-complement oligonucleotides, individual PCR products, and multiplex PCR products for 5/7/9T detection within a complex CFTR screening assay. Samples were genotyped by grouping the relative signal intensities from each capture probe. Of 29 commercially available DNA samples analyzed, 2 5T/7T, 2 5T/9T, 9 7T/9T, 11 7T/7T, and 5 9T/9T genotypes were identified. The genotype within each sample group was confirmed by DNA sequencing. The assay was compatible with the analysis of 10 to 1000 ng of genomic DNA isolated from whole blood and allowed for the separate identification of primary CFTR mutations from reflex variants. The correct identification of positive controls demonstrated the utility of a simple bead-array assay and provided accessible samples for assay optimization and for routine quality control in the clinical laboratory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
197 Intron 8 Genotype by Coriell Number, Characterized CF Mutation and Allele Fraction for 5/7/9T Intron 8 genotype Coriell sample Characterized mutation Allele fraction by probe 5T 7T 9T 7T/7T NA09947 Normal 0.04 0.93 0.03 NA11277 ⌬I507/normal 0.06 0.90 0.04 NA11761 G551D/R553X 0.06 0.92 0.02 NA11859 2789ϩ5GϾA/2789ϩ5GϾA 0.02 0.96 0.02 NA11860 3849ϩ10kbCϾT/3849ϩ10kbCϾT 0.03 0.94 0.03 NA12444 1717-1GϾT/normal 0.06 0.87 0.07 NA12585 R1162X/normal 0.07 0.86 0.08 NA12785 R347P/G551D 0.04 0.92 0.05 NA12960 R334W/normal 0.06 0.92 0.02 NA12961 V520F/normal 0.06 0.89 0.05 NA13033 F508C/normal 0.03 0.93 0.04 9T/9T NA01531 ⌬F508/⌬F508 0.14 0.04 0.82 NA11281 621ϩ1GϾT/⌬F508 0.14 0.04 0.82 NA11283 A455E/⌬F508 0.13 0.05 0.82 NA11290 A455E/621ϩ1GϾT 0.12 0.01 0.87 NA11496 G542X/G542X 0.14 0.05 0.81 5T/7T NA11723 W1282X/normal 0.53 0.44 0.03 NA13032 I506V/normal 0.58 0.39 0.03 5T/9T NA11279 129GϾC/⌬F508 0.51 0.00 0.49 NA13591 R117H/⌬F508 0.52 0.00 0.48 7T/9T NA07441 3120ϩ1GϾA/621ϩ1GϾA 0.08 0.41 0.51 NA07552 R553X/⌬F508 0.09 0.36 0.55 NA07830 556dA/⌬F508 0.11 0.37 0.52 NA11275 3659dC/⌬F508 0.10 0.37 0.53 NA11278 Q493X/⌬F508 0.09 0.38 0.53 NA11280 711ϩ1GϾT/621ϩ1GϾA 0.09 0.37 0.54 NA11282 G85E/621ϩ1GϾA 0.07 0.39 0.53 NA11284 R560T/⌬F508 0.08 0.39 0.52 NA11472 N1303K/G1349D 0.08 0.39 0.54 Figure 3. Login to comment

[hide] CFTR Cl- channel function in native human colon co... Gastroenterology. 2004 Oct;127(4):1085-95. Hirtz S, Gonska T, Seydewitz HH, Thomas J, Greiner P, Kuehr J, Brandis M, Eichler I, Rocha H, Lopes AI, Barreto C, Ramalho A, Amaral MD, Kunzelmann K, Mall M
CFTR Cl- channel function in native human colon correlates with the genotype and phenotype in cystic fibrosis.
Gastroenterology. 2004 Oct;127(4):1085-95., [PMID:15480987]

Abstract [show]
BACKGROUND & AIMS: Cystic fibrosis (CF) is caused by over 1000 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and presents with a widely variable phenotype. Genotype-phenotype studies identified CFTR mutations that were associated with pancreatic sufficiency (PS). Residual Cl- channel function was shown for selected PS mutations in heterologous cells. However, the functional consequences of most CFTR mutations in native epithelia are not well established. METHODS: To elucidate the relationships between epithelial CFTR function, CFTR genotype, and patient phenotype, we measured cyclic adenosine monophosphate (cAMP)-mediated Cl- secretion in rectal biopsy specimens from 45 CF patients who had at least 1 non-DeltaF508 mutation carrying a wide spectrum of CFTR mutations. We compared CFTR genotypes and clinical manifestations of CF patients who expressed residual CFTR-mediated Cl- secretion with patients in whom Cl- secretion was absent. RESULTS: Residual anion secretion was detected in 40% of CF patients, and was associated with later disease onset (P < 0.0001), higher frequency of PS (P < 0.0001), and less severe lung disease (P < 0.05). Clinical outcomes correlated with the magnitude of residual CFTR activity, which was in the range of approximately 12%-54% of controls. CONCLUSIONS: Specific CFTR mutations confer residual CFTR function to rectal epithelia, which is related closely to a mild disease phenotype. Quantification of rectal CFTR-mediated Cl- secretion may be a sensitive test to predict the prognosis of CF disease and identify CF patients who would benefit from therapeutic strategies that would increase residual CFTR activity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Relationship Between the CFTR Genotype and Cl- Channel Function in Native Rectal Epithelia CFTR genotype Number of individuals Sweat Cl-concentration (mmol/L)a cAMP-mediated response Carbachol-induced plateau response or maximal lumen-negative response Isc-cAMP (␮A/cm2) Cl- secretion (% of control) Isc-carbachol (␮A/cm2) Cl- secretion (% of control) Cl- secretion absent R1162X/Q552X 1 71 17.1 0 0.7 0 W1282X/3121-2AϾG 1 112 1.9 0 0.6 0 1898 ϩ 1G Ͼ T/1609delCA 2b 114, 118 25.4, 13.4 0, 0 0, 0.7 0, 0 ⌬F508/Q39X 2b 127, 129 2.6, 4.4 0, 0 1.7, 3.7 0, 0 ⌬F508/G542X 1 102 29.0 0 6.6 0 ⌬F508/R553X 3 112, 102, 109 13.1, 4.5, 23.8 0, 0, 0 1.5, 4.4, 1.0 0, 0, 0 ⌬F508/E585X 1 115 1.4 0 1.1 0 ⌬F508/Q637X 1 100 2.9 0 1.2 0 ⌬F508/Y1092X 1 119 0.0 0 -0.3 0 ⌬F508/120del23c 1 72 20.1 0 3.3 0 ⌬F508/182delT 1 116 10.8 0 5.2 0 ⌬F508/3905insT 2 88, 96 8.4, 5.6 0, 0 2.3, -1.1 0, 1 ⌬F508/V520F 1 68 1.2 0 1.7 0 ⌬F508/A561E 3 113, 146, 100 17.0, 17.0, 16.0 0, 0, 0 2.1, 1.5, 3.7 0, 0, 0 ⌬F508/R1066C 1 138 0.0 0 0.0 0 ⌬F508/N1303K 3 100, 117, 94 1.7, 4.1, 1.5 0, 0, 0 -0.6, 2.2, 0.8 0, 0, 0 A561E/A561E 2 101, 116 6.6, 2.0 0, 0 7.3, 3.3 0, 0 Residual Cl- secretiond G542X/I148N 1 75 -50.1 54 -22.2 12 1898 ϩ 3A Ͼ G/1898 ϩ 3A Ͼ G 1 82 -36.8 39 -12.9 7 ⌬F508/3272-26A Ͼ G 1 116 -17.8 19 -27.2 14 ⌬F508/S108F 1 118 -15.8 17 -12.3 7 ⌬F508/R117H 1 90 -35.9 38 -207.7 109 ⌬F508/Y161Cc 1 44 -35.1 37 -45.9 25 ⌬F508/P205S 1 80 -23.3 25 -10.4 5 ⌬F508/V232D 1 120 -16.9 18 -26.9 14 ⌬F508/R334W 1 92 -22.1 23 -21.1 11 ⌬F508/R334W 1 101 -24.5 26 -37.4 20 ⌬F508/T338I 1 73 -44.4 47 -79.4 42 ⌬F508/G576A 1 40 -16.9 18 -115.5 61 ⌬F508/I1234V 1 113 -13.6 15 -8.6 5 G576A/G85E 1 95 -26.1 28 -61.6 32 F1052V/M1137R 1 47 -36.7 39 -146.6 77 M1101K/M1101K 1 94 -11.1 12 -4.8 3 S1159F/S1159F 1 67 -47.9 51 -38.7 21 N1303K/R334W 1 91 -30.3 32 -47.7 25 NOTE. CFTR Cl- channel function was determined in rectal epithelia from Cl- secretory responses induced by IBMX/forskolin (Isc-cAMP) and after co-activation with carbachol (Isc-carbachol). Login to comment
101 Functional Classification and Protein Location of CFTR Mutations Mutation type Severe mutations (protein location) Mild mutations (protein location) Missense V520F, A561E (NBD1) G85E (MSD1, TM1) R1066C (MSD2, CL4) S108F, R117H (MSD1, EL1) N1303K (NBD2) I148N, Y161Ca (MSD1, CL1) P205S (MSD1, TM3) V232D (MSD1, TM4) R334W, T338I (MSD1, TM6) G576A (NBD1) I1234V (NBD2) F1052V, M1101K (MSD2, CL4) M1137R (MSD2, TM12) S1159F (pre-NBD2) Splice 1898 ϩ 1G Ͼ T (R domain) 1898 ϩ 3A Ͼ G (R domain) 3121-2A Ͼ G (MSD2, TM9) 3272-26A Ͼ G (MSD2, TM10) Single amino acid deletion ⌬F508 (NBD1) Nonsense Q39X (N-terminus) G542X, Q552X, R553X, E585X (NBD1) Q637X (R domain) Y1092X (MSD2, CL4) R1162X (pre-NBD2) W1282X (NBD2) Frameshift 120del23a 182delT (N-terminus) 1609delCA (NBD1) 3905insT (NBD2) NOTE. Severe mutation, Cl- secretion absent; mild mutation, residual cAMP-mediated Cl- secretion. Login to comment
125 According to our functional data, 3121-2AϾG, 1898ϩ1GϾT, and V520F constitute severe mutations, whereas 1898ϩ3AϾG, I148N, Y161C, V232D, T338I, I1234V, and S1159F confer residual CFTR Cl- channel function (Table 1). Login to comment

[hide] Cystic fibrosis and related diseases of the pancre... Best Pract Res Clin Gastroenterol. 2002 Jun;16(3):511-26. Naruse S, Kitagawa M, Ishiguro H, Fujiki K, Hayakawa T
Cystic fibrosis and related diseases of the pancreas.
Best Pract Res Clin Gastroenterol. 2002 Jun;16(3):511-26., [PMID:12079272]

Abstract [show]
The discovery of the gene for cystic fibrosis (CF), the cystic fibrosis transmembrane conductance regulator (CFTR), brought about a new era in the study of this disease. Identification of the molecular target has yielded a flood of data that add to our understanding of the pathogenesis, diagnosis and treatment of CF. The CFTR protein is a cAMP-regulated Cl(-) channel with multiple functions in epithelial cells. In the exocrine pancreas the CFTR plays a key role in the apical Cl(-), HCO(3)(-), and water transport in duct cells. The severe loss of functions, caused by mutations of the CFTR gene, leads to pathological lesions of the pancreas. Over 1200 CFTR mutations and polymorphisms have been identified and their diversity may explain the high level of heterogeneity in the CF phenotype. Mutation analyses of the CFTR gene have revealed a spectrum of CFTR-related diseases that do not fit the classical CF picture but are associated with dysfunction of CFTR, such as chronic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic ®brosis of the pancreas'. Login to comment
64 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuQciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 W 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic &#ae;brosis of the pancreas'. Login to comment

[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]

Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment

[hide] Analysis of the CFTR gene in Turkish cystic fibros... Hum Genet. 1998 Feb;102(2):224-30. Onay T, Topaloglu O, Zielenski J, Gokgoz N, Kayserili H, Camcioglu Y, Cokugras H, Akcakaya N, Apak M, Tsui LC, Kirdar B
Analysis of the CFTR gene in Turkish cystic fibrosis patients: identification of three novel mutations (3172delAC, P1013L and M1028I).
Hum Genet. 1998 Feb;102(2):224-30., [PMID:9521595]

Abstract [show]
In order to determine the spectrum of cystic fibrosis (CF) mutations in the Turkish population, a complete coding region of the cystic fibrosis transmembrane conductance regulator (CFTR) gene including exon-intron boundaries, on 122 unrelated CF chromosomes from 73 Turkish CF families was analysed by denaturing gradient gel electrophoresis and multiplex heteroduplex analysis on MDE gel matrix. In addition to 15 previously reported mutations and 12 polymorphisms, three novel mutations, namely 3172delAC, P1013L and M1028I, were detected. DeltaF508 was found to be present on 18.8% of CF chromosomes. The second most common mutation was 1677delTA, with a frequency of 7.3%, followed by G542X and 2183AA-->G mutations, with frequencies of 4.9%. These four most common mutations in Turkish CF population account for approximately 36% of mutations. This study could only detect 52.5% of disease-causing mutations in this population; 47.5% of CF alleles remain to be identified, reflecting the high molecular heterogeneity of the Turkish population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 For the identification of N1303K, W1282X, V520F, C524X and R334W, mutation detection methods based on the analysis of PCR products by appropriate restriction enzymes were used as previously described (Osborne et al. 1992; Shoshani et al. 1992; Picci et al. 1992; Jones et al. 1992). Login to comment

[hide] Identification of common cystic fibrosis mutations... Am J Hum Genet. 1997 May;60(5):1122-7. Macek M Jr, Mackova A, Hamosh A, Hilman BC, Selden RF, Lucotte G, Friedman KJ, Knowles MR, Rosenstein BJ, Cutting GR
Identification of common cystic fibrosis mutations in African-Americans with cystic fibrosis increases the detection rate to 75%.
Am J Hum Genet. 1997 May;60(5):1122-7., [PMID:9150159]

Abstract [show]
Cystic fibrosis (CF)--an autosomal recessive disorder caused by mutations in CF transmembrane conductance regulator (CFTR) and characterized by abnormal chloride conduction across epithelial membranes, leading to chronic lung and exocrine pancreatic disease--is less common in African-Americans than in Caucasians. No large-scale studies of mutation identification and screening in African-American CF patients have been reported, to date. In this study, the entire coding and flanking intronic sequence of the CFTR gene was analyzed by denaturing gradient-gel electrophoresis and sequencing in an index group of 82 African-American CF chromosomes to identify mutations. One novel mutation, 3120+1G-->A, occurred with a frequency of 12.3% and was also detected in a native African patient. To establish frequencies, an additional group of 66 African-American CF chromosomes were screened for mutations identified in two or more African-American patients. Screening for 16 "common Caucasian" mutations identified 52% of CF alleles in African-Americans, while screening for 8 "common African" mutations accounted for an additional 23%. The combined detection rate of 75% was comparable to the sensitivity of mutation analysis in Caucasian CF patients. These results indicate that African-Americans have their own set of "common" CF mutations that originate from the native African population. Inclusion of these "common" mutations substantially improves CF mutation detection rates in African-Americans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment
71 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

[hide] Survey of cystic fibrosis transmembrane conductanc... Dig Dis Sci. 1996 Mar;41(3):540-2. McGill JM, Williams DM, Hunt CM
Survey of cystic fibrosis transmembrane conductance regulator genotypes in primary sclerosing cholangitis.
Dig Dis Sci. 1996 Mar;41(3):540-2., [PMID:8617131]

Abstract [show]
A variety of cholestatic liver diseases appear to primarily affect the biliary epithelium, including cystic fibrosis (CF). CF results from a defect in the chloride channel protein, cystic fibrosis transmembrane conductance regulator (CFTR). Although the majority of CF patients have a genomic deletion in deltaF508, other mutations of CFTR may result in less severe clinical presentations and outcomes. Recently, CFTR has been shown to be involved in secretin-stimulated choleresis in intrahepatic bile duct epithelial cells. Cholestasis in cystic fibrosis appears to result from defective chloride transport across the biliary epithelium and is the only cholestatic disease of bile ducts for which a cellular defect has been identified. Primary sclerosing cholangitis (PSC) is a cholestatic disease with histological and cholangiographic features similar to CF. The purpose of this pilot study was to explore whether there is an increased prevalence of CFTR mutations. Two patients exhibited mutations in one allele, yielding a carrier rate of 10.6%, not statistically different from the general U.S. population carrier rate of 4%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 In total, 32 mutations were evaluated, which represent 90% of the most common mutations (t4): AF508 G542X G551D W1282X 3905insT NI303K 3849+ 10kbC--~T R553X 621+ IG--*T 1717- IG--,A lt)78delT 2789+5G---~A 3849+4A--~G 711+ IG---oT R1162X 1898+IG----~A R117H 3659delC G85E 2184delA A1507 R347P Y1092X R560T A455E R334W Y122X S549R(T---~G) Q493X V520F $549N R347H Patient Selection. Login to comment

[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]

Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 35%) PAGE (278) Kerem et al.. 1989AF508 G551D R117H R560T G542X 621+1G>T A1507 E60X 3659delC R553X 3120G>A 1l54insTC 2789+5G>A N1303K MlI(G>T) QW P67L 557delT 711+3A>G L206W R297Q V520F V562L Y563N Y917C R1162X 3849G>A 3849 +10kbC>T 3850-1GBA W1282X 280 21 17 12 9 9 7 3 2 1 68.0 5.1 4.1 2.9 2.2 2.2 1.7 0.7 0.5 0.24 17-32-13 (38;27%j 17-31-13(24,17%) 16-07-17 16-30-13 plus14 rare haplotypes (29) 16-07-17 23-33-13 (4) 22-31-13 (2) 21-31-13 17-07-17 (5) 16-31-13 16-35-13 17-58-13 17-35-13 16-07-17 17-07-17 23-29-13 (1) 23-31-13 (1) 16-07-17 16-31-13 16-07-17 15-29-13 16-33-13 16-07-17 17-07-17 16-07-17 16-07-17 16-30-13 16-32-17 17-31-13 16-31-14 16-46-13 16-30-14 17-07-17 DGGE(2) ' RD ASO's (11) DGGE(6) RD AR (8) DGGE (1) RD PAGE (5) DGGE (2) SEQ SEQ (2) DGGE (1) RD DGGE DGGE DGGE SEQ DGGE DGGE DGGE SEQ DGGE DGGE SEQ DGGE DGGE DGGE DGGE DGGE SEQ RD DGGE DGGE Cutting et al.. 1990 Dean et al.. 1990 Kerem et al., 1990 Kerem et al.. 1990 Zielenski et al., 1991 Kerem et al.. 1990 Malone et al., CFGAC Kerem et al., 1990 Cutting et al., 1990 Zielenski et al., CFGAC lannuzzi et al., 1991 Highsmith et al., 1990 Osborne et al., 1991 this study Savov et al., 1994 Hamosh et al., CFGAC Graham et al., 1992 Petreska et al., CFGAC Claustres et al., 1993 Graham et al., 1991 Jones et al.. 1992 this study Kerem et al.. 1990 Edkins & Creegan, CFGAC Gasparini et al., 1991 Cutting et al.. 1992 Highsmith et al., 1994 Audriizet et al., 1993 Vidaud et al., 1990 "Numbers in parentheses after the microsatellite haplotypes refer to the number of alleles haplotyped when not all of the available chromosomeswere typed. Login to comment
75 AF508, AF508lAF508, M470V (p),Q493X, Q493WAF508,V520F. Login to comment

[hide] Fluorescent multiplex microsatellites used to defi... Hum Mutat. 1996;8(3):229-35. Hughes D, Wallace A, Taylor J, Tassabehji M, McMahon R, Hill A, Nevin N, Graham C
Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes.
Hum Mutat. 1996;8(3):229-35., [PMID:8889582]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene contains three highly informative microsatellites: IVS8CA, IVS17bTA, and IVS17bCA. Their analysis improves prenatal/ carrier diagnosis and generates haplotypes from CF chromosomes that are strongly associated with specific mutations. Microsatellite haplotypes were defined for 75 CFTR mutations carried on 437 CF chromosomes (220 for delta F508, 217 for other mutations) from Northern Ireland and three English regions: the North-West, East Anglia, and the South. Fluorescently labelled microsatellites were amplified in a triplex PCR reaction and typed using an ABI 373A fluorescent fragment analyser. These mutations cover all the common and most of the rare CF defects found in the UK, and their corresponding haplotypes and geographic region are tabulated here. Ancient mutations, delta F508, G542X, N1303K, were associated with several related haplotypes due to slippage during replication, whereas other common mutations were associated with the one respective haplotype (e.g., G551D and R560T with 16-7-17, R117H with 16-30-13, 621 + 1G > T with 21-31-13, 3659delC with 16-35-13). This simple, fast, and automated method for fluorescent typing of these haplotypes will help to direct mutation screening for uncharacterised CF chromosomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI. Login to comment

[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]

Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 (1992) Dork et al. (1994a) Malone et al. (personal communication) Claustreset al. (1992) Ferec et al. (1992) Fanen et al. (1992) lvaschenko et al. (1991) T. Dork (personal communication) Dean et al. (1990) Dork et al. (1994a) Ferec et al. (1992) Bozon et al. (1994) Costes et al. (personal communication) Fanen et al. (1992) Audrezet et al. (personal communication) Zielenski et al. (1991a) Zielenski et al. (1991a) Granell et al. (1992) Highsmith et al. (1990) Mercier et al. (1993b) Vidaud et al. (1990) Fanen et al. (1992) Fanen et al. (1992) Dork et al. (1994b) (continued) HAPLOTYPESFOR 94 CF MUTATIONS TABLE2. CFTR HaplotvpesforDiallelic and Multiallelic DNA Markers for 94 CF Mutations"(Continued) ~~ ~ J44-GAIT- 8CA-17BTA- No. of TSU-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-1-2 (9.1%) 1-6-2-2 (8.9%) 1-7-1-2 (3.4%) 1-7-2-2 (2.6%) 2-7-1-1 (1.2%) 2-7-2-2 (0.7%) 17-7-16 16-7-18 16-7-17 15-7-17 24-31-13 23-52-13 23-34-13 23-33-14 23-33-13 23-32-13 23-31-13 23-30-13 23-21-19 23-18-13 22-35-13 22-31-13 22-30-13 21-31-13 19-33-13 18-45-13 18-37-13 18-35-13 17-57-11 17-55-13 17-55-11 17-54-11 17-53-11 17-52-11 17-51-11 17-33-13 16-46-13 16-45-13 16-44-13 16-42-13 16-35-13 16-30-13 16-30-13 16-7-17 16-21-19 L107% L1077P 24ldelAT L719X A1507 3849+10kbC-T 2184insA 2991de132 G551D 1154insTC V520F R560T 4114ATA+lT 3667de14 435insA Q414X C225R Q39X N1303K R1162X H199Y G542X G542X w1204x R347H G542X AF50gb N1303K 2143delT 3849f 10kbC-T N1303K 681delC R347H A455E N1303K A120T 621+1 h T 574delA 1221delCT F311L R560K R553X R533X R553X Q552X R553X Q552X R116W R553X 1898+5 h T 3272-26A-G 1717-1hA 1342-2A-C A1507 2869insG 2869insG E92X 4374+1 h T 2183AA-G R117H 1609delCA I336K W1063X 1 1 1 1 6 1 3 1 1 22 17 1 1 1 1 1 1 1 1 1 1 1 1 1 17 1 1 4 157 7 1 2 2 1 1 2 2 1 9 1 1 1 1 1 1 6 1 1 1 2 1 3 2 1 3 1 1 1 4 2 4 1 1 - - 10.33 1.45 - - 0.48 1.45 - 0.24 1.45 0.24 - - - - 0.24 0.48 - - - - - - 0.49 0.48 - 0.24 0.24 0.24 - - - - - 0.72 0.24 0.72 - t h fP h b.fb,fP h b,fp.t t h b.fb.fp,h,t b.fb.fp,h,t t t t h b h h fP h fP fb b fP b.fb,fP,h.t fP fb b,fP,t b.fb,fp,h,t b.fb,h h h h,t t fb t b b b.fb.t fP fb fb tb h fP h h t t b h t h b b h h b,fb,h fP.h b h fP fP Bozon et al. (1994) Fanen et al. (1992) Dork et al. (1994a) Kerem et al. (1990) Dork et al. (1994~) Cutting et al. (1990) Kerem et al. (1990) lannuui et d. Login to comment

[hide] Cystic fibrosis mutation detection by hybridizatio... Hum Mutat. 1996;7(3):244-55. Cronin MT, Fucini RV, Kim SM, Masino RS, Wespi RM, Miyada CG
Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays.
Hum Mutat. 1996;7(3):244-55., [PMID:8829658]

Abstract [show]
We have combined photochemistry and photolithography with solid-phase DNA synthesis chemistry to form a new technology that makes high density oligonucleotide probe array synthesis possible. Hybridization to these two-dimensional arrays containing hundreds or thousands of oligonucleotide probes provides a powerful DNA sequence analysis tool. Two types of light-generated DNA probe arrays have been used to test for a variety of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. One array, made up of 428 probes, was designed to scan through the length of CFTR exon 11 and identify differences from the wild type reference sequence. The second type of array contained 1480 probes chosen to detect known deletions, insertions, or base substitution mutations. The validity of the probe arrays was established by hybridizing them with fluorescently labeled control oligonucleotide targets. Characterized mutant CFTR genomic DNA samples were then used to further test probe array hybridization specificity. Finally, ten unknown patient samples were genotyped using the CFTR probe array assay. The genotype assignments were identical to those obtained by PCR product restriction fragment analysis. Our results show that light-generated DNA probe arrays are highly effective in analyzing complex mutation and polymorphism patterns in a relatively large gene such as CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
238 Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design. Login to comment

[hide] Methods for screening in cystic fibrosis. Methods Mol Med. 1996;5:99-119. Schwarz M, Malone G
Methods for screening in cystic fibrosis.
Methods Mol Med. 1996;5:99-119., [PMID:21374513]

Abstract [show]
Cystic fibrosis (CF) is the most common lethal autosomal recessive disorder in Whites, with an incidence of approx 1 m 2500 live births and a carrier frequency of approx 1 in 25. Since the discovery of the cystic fibrosis transmembrane conductance regulator (CFTR) gene m 1989 (1-3), molecular genetics laboratories throughout the world have endeavored to identify the mutations present in their population of CF-bearing chromosomes. Since the entire CFTR gene and its intron-exon boundaries have been sequenced, mutation analysis in CF has become relatively simple, although time consuming. Generally, a number of different methods are applied to mutation analysis, but all involve an imtial step of amplification of part of the gene by polymerase chain reaction (PCR) (4), or a derivative of it, such as amplification refractory mutation system (ARMS) (5).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 Molecular D/agnoss of GenetIc Diseases Edlted by R Elles Humana Press Inc , Totowa, NJ 99 Table1 RelativeFrequenciesoftheCommonCFMutationsintheUnitedKingdom(S),NorthAmerica, andNorthernandSouthernEurope(7)" NorthNorthernSouthern UKAmericaEuropeEurope MutationExonNo.%No.%No.%No%References AF508 G551D G542X 621+l(G>T) 1717-l(G>A) sR117H =R553x 1898+l(G>A) N1303K R560T AI507 G85E 1154insTC V520F W1282X E60X 3659delC 1078delT 10738775.32690066.114,86670.28400755.033 113023.082061.973561.68370.518 111651.682342.244392.082593.569 intron4910.931541.48970.46370.51IO intron10560.57440.421600.76650.899 4450.46610.586202930.04II 11450.46960.921650.7844068 intron12450.4620.02410.191001412 21450.461301.252090.991792.4613 11410.42240.2340019009 10300.31200.19570.2750.079,14 3210.211601530014140.19II 7190.19n/an/an/an/an/an/a15 10170.17n/an/an/an/an/an/a16 20170.172452.351200.57430.5917 3160.16n/an/an/an/an/an/aMaloneb 19140.14140.133901810.019 790.0910.015302520.318 S549N1180.0850.051800920038 Q493X1070.07n/an/adan/adan/a9 R347P760.06260.25550.26240.3311 3849+10kb(C>T)intron1950.05570.55230.1180.1119 A455E930.03270.26350.17009 %/a,Datanotavadable. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]

Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 At present, we have not detected any Spanish CF chromosomes bearing any of the following mutations: 394delTA, Y122X, 556delA, 852de122, R347P, $492F, 1677delTA, V520F, Q552X, R553X, L559S, R560K, R560T, Y563N, P564H, 2043delG, 3320ins5, R1066H, A1067T, H1085R, 3732delA, 3737delA, I1234V, S1255P, 3898insC, Q1291H or 4005+ 1G---~A. Login to comment

[hide] Genetic analysis of Hispanic individuals with cyst... Am J Hum Genet. 1994 Mar;54(3):443-6. Grebe TA, Seltzer WK, DeMarchi J, Silva DK, Doane WW, Gozal D, Richter SF, Bowman CM, Norman RA, Rhodes SN, et al.
Genetic analysis of Hispanic individuals with cystic fibrosis.
Am J Hum Genet. 1994 Mar;54(3):443-6., [PMID:7509564]

Abstract [show]
We have performed molecular genetic analyses of Hispanic individuals with cystic fibrosis (CF) in the southwestern United States. Of 129 CF chromosomes analyzed, only 46% (59/129) carry delta F508. The G542X mutation was found on 5% (7/129) of CF chromosomes. The 3849 + 10kbC-->T mutation, detected primarily in Ashkenazi Jews, was present on 2% (3/129). R1162X and R334W, mutations identified in Spain and Italy, each occurred on 1.6% (2/129) of CF chromosomes. W1282X and R553X were each detected once. G551D and N1303K were not found. Overall, screening for 22 or more mutations resulted in detection of only 58% of CF transmembrane conductance regulator gene mutations among Hispanic individuals. Analysis of KM19/XV2c haplotypes revealed an unusual distribution. Although the majority of delta F508 mutations are on chromosomes of B haplotypes, the other CF mutations are on A and C haplotypes at higher-than-expected frequencies. These genetic analyses demonstrate significant differences between Hispanic individuals with CF and those of the general North American population. Assessment of carrier/affected risk in Hispanic CF individuals cannot, therefore, be based on the mutation frequencies found through studies of the general population but must be adjusted to better reflect the genetic makeup of this ethnic group. Further studies are necessary to identify the causative mutation(s) in this population and to better delineate genotype/phenotype correlations. These will enable counselors to provide more accurate genetic counseling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC- T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G- T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted). Login to comment
54 COther = A1507, 621+1G- T, R117H, N1303K, 711+1G-*.T, 1717-1G-.A, R560T, Y122X, 1148T, G314E, 1078AT, R347P, Q493X, V520F, and 3659AC. Login to comment
56 The G542X mutation was found in 5.4% of Hispanic CF chromosomes, similar to the 3% frequency in the general population. Login to comment
47 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC-T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G-T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted). Login to comment

[hide] Exon 9 of the CFTR gene: splice site haplotypes an... Hum Genet. 1994 Jan;93(1):67-73. Dork T, Fislage R, Neumann T, Wulf B, Tummler B
Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations.
Hum Genet. 1994 Jan;93(1):67-73., [PMID:7505767]

Abstract [show]
The alternatively spliced exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene codes for the initial part of the amino-terminal nucleotide-binding fold of CFTR. A unique feature of the acceptor splice site preceding this exon is a variable length polymorphism within the polypyrimidine tract influencing the extent of exon 9 skipping in CFTR mRNA. We investigated this repeat for its relationship to CFTR mutations and intragenic markers on 200 chromosomes from German patients with cystic fibrosis (CF). Four frequent length variations were strongly associated with the four predominant haplotypes previously defined by intragenic marker dimorphisms. One of these alleles displayed absolute linkage disequilibrium to the major CF mutation delta F508. Other frequent CFTR mutations were linked to one particular splice site haplotype indicating that differential exon 9 skipping contributes little to the clinical heterogeneity among CF patients with an identical mutation. We also identified a novel missense mutation (V456F) and a novel nonsense mutation (Q414X) within the coding region of exon 9. The missense mutation V456F adjacent to Walker motif A was present in a pancreas-sufficient CF patient. In contrast, the pancreas-insufficient Q414X/delta F508 compound heterozygote suffered from a severe form of the disease, indicating that alternative splicing of exon 9 does not overcome the deleterious effect of a stop codon with this exon.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 Phenylalanine residues within the amino-terminal nucleotide-binding domain may be critical for the structure and function of CFTR, as exemplified by the mutations V520F and AF508 in exon 10 (Tsui 1992). Login to comment

[hide] A novel mutation in exon 3 of the CFTR gene. Hum Genet. 1993 Apr;91(3):233-5. Guillermit H, Jehanne M, Quere I, Audrezet MP, Mercier B, Ferec C
A novel mutation in exon 3 of the CFTR gene.
Hum Genet. 1993 Apr;91(3):233-5., [PMID:7682984]

Abstract [show]
We have screened the 27 exons of the cystic fibrosis transmembrane conductance regulator gene in 87 non-delta F508 chromosomes of Breton origin using the combined techniques of denaturing gradient gel electrophoresis and direct sequencing. By this process, we have detected a new missense mutation, G91R, which results in an arginine for glycine at codon 91. Three affected patients with a delta F508/G91R genotype are pancreatic sufficient. Such observations could facilitate a better understanding of the functional importance of different regions of the encoded product and of the pathogenesis of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Most of the missense mutations so far reported in the first NBF (G551D, V520F, R560T, etc.) result in a severe phenotype. Login to comment

[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]

Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Frequent cystic fibrosis mutations Name Relative freqeenc~ Mutation Con~,~'~luence Ref. Z~508 67.2 G542X 3.4 G551D 2.4 W1282X 2.1 3905insT 2.1 N1303K 1.8 3849+10kbC-+T 1.4 1717-1G-+A 1078delT 2789+5G--+A Deletion of 3 bp between nt 1652 and t655 in exon 10 G-+T at nt 1756 in exon 11 G-+A at nt 1784 in exon 1I G-+A at nt 3978 in exon 20 Insertion of T after nt 3905 in exon 20 C-+G at nt 4041 in exon 21 C-->T in a 6.2 kb EcoRI fragment 10 kb from 5' junction of intron 19 3849+4A-+G 1.0 7tt÷IG--+T 0.9 Rl162X 0.9 1898+lG-+A 0.9 Rll7H 0.8 3659delc 0.8 G85E 0.7 2184delA 0.7 AI5W 0.5 R347P 0.5 R~ 0.4 1,3 C-+T at nt 1"789in exon 11 1.3 G-+T at nt 1 from 5' junction of intron 4 1.1 G--+A at nt 1 from 3' junction of intron 10 1.1 Deletion of T at nt 1078 in exon 7 1.1 G-cA at 5 nt from 5' end of intron 14b A-->G at 4 nt from 5' end of intron 19 G-+T at nt 1 from 5' junction of intron 5 C-+T at nt 3616 in exon 19 G-+A at nt 1 from 5' junction of intron 12 G--)A at nt 482 in exon Deletion of C at nt 3659 in exon 19 G-+A at nt 386 in exon 3 A-->G at nt 2183 and deletion of A at nt 2184 in exon 13 Deletion of 3 bp between nt 1648 and 1653 in exon 10 G-+C at nt 1172 in exon 7 G-~C at nt 1811 in exon 11 A455E 0.4 R334W 0.4 Y122X 0.3 S549R(T-+G) 0.3 Q493X 0.3 V520F 0.2 S549N 0.2 C-+A at nt 1496 in exon 9 C-+T at nt 1132 in exon 7 T-cA at nt ~i98 in exon 4 T--+G at nt 1779 in exon 11 C-+T at nt 1609 in exon 10 G-+T at nt 1690 in exon 10 G-->A at nt I778 in exon !1 Deletion of Phe at codon 508 Gly-+Stop at codon 542 12 Gly-~Asp at codon 551 10 l"rp-->Stop at codon t282 35 Frameshift -~ Asn-+Lys at codon 1303 36 Aberrant splicing -~ Arg~Stop ~ codon 553 Splice mutation 10 37 Splice mutation 12 Frameshift 38 Splice mutation _c Splice mutation? Login to comment
123 8 NO. 11 m []~EVIEWS G551D R553Q G551S I L558S aI~7 S5491 I I 1&559T A455F E5040 I&F508 V520F SS49NII IIR560T PS74H I G458V G480C $492F /" • ss,9 II III* oa. / III / NBF1 ~t ~t NBF2 I I I I I III I I I 11234V G1244E IS1255P D1270N II I Q1291H N1303K G1349D S1251N W1282R] F1286S N1303H Q1283M, FIG[] Cystic fibrosis (missense) mutations located within the two presumptive ATP-binding domains (NBF1 and NBF2) of CFTR. Login to comment

[hide] Milestones in cystic fibrosis. Br Med Bull. 1992 Oct;48(4):717-37. Super M
Milestones in cystic fibrosis.
Br Med Bull. 1992 Oct;48(4):717-37., [PMID:1281032]

Abstract [show]
The study of cystic fibrosis (CF) provides a fascinating insight into developments in medicine in the 20th century. Milestones include the first clear clinical descriptions in the 1930s, discovery of a sweat electrolyte abnormality, establishing the autosomal recessive mode of inheritance and improvements in treatment. Microdissection experiments on sweat glands allowed the main defect to be delineated as one of chloride transport. Location of the gene to chromosome 7 made prenatal diagnosis feasible and carrier detection in siblings. The CF gene--its product being the cystic fibrosis transmembrane conductance regulator (CFTR), and its major mutation Delta F508 was discovered in 1989. World-wide collaboration has resulted in discovery of more than 150 further mutations. Incorporation of CFTR into non-chloride transporting insect cells by conferring chloride transport, proved it a chloride channel. CFTR incorporated into adenovirus results in correction of the chloride transport defect in airway cells, bringing gene therapy closer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
160 Thus a protein conformational change in CFTR resulting in a signif- FIBROSIS Table 4 CF Mutations encountered in United Kingdom Mutation Delta F508 G551D R553 G542X R56OT N1303K DI507 R117H 621+1G-T G85E W1282X E60X R75Q V520F 1717-1 G-A CF chromosomes screened 1 Mutations encountered 1062 199 (non Delta F508) 199 199 199 199 199 199 199 199 199 30 15 199 199 CF chromosomes with mutation in North-West England 863 37 8 11 6 6 4 5 10 4 2 2 1 3 3 Percentage 81.2 3.48 0 75 1.03 0.58 0 58 038 0.47 0.98 0.38 0 19 ? Login to comment

[hide] Mutation analysis of 184 cystic fibrosis families ... J Med Genet. 1992 Sep;29(9):642-6. Cheadle J, Myring J, al-Jader L, Meredith L
Mutation analysis of 184 cystic fibrosis families in Wales.
J Med Genet. 1992 Sep;29(9):642-6., [PMID:1357180]

Abstract [show]
We describe a molecular analysis of 184 cystic fibrosis (CF) families in Wales. To determine accurate frequency data for the CF mutations in the Welsh population, families with at least three Welsh grandparents were strictly regarded as Welsh. Of these 74 families, we have identified approximately 90% of mutations causing CF, with delta F508 accounting for 71.8% and 621 + 1G greater than T 6.7%. We observed a significant difference between the Welsh and Scottish frequencies of 621 + 1G greater than T. To allow the rapid and efficient screening for the more common mutations we modified a multiplex used by Watson et al enabling the detection of delta F508, G551D, and R553X simultaneously with 621 + 1G greater than T. In parallel to this system we ran the Cellmark Diagnostics ARMS multiplex kit, which detects delta F508, 621 + 1G greater than T, G551D, and G542X. RFLP analysis of the 184 families shows that the delta F508 chromosomes are almost exclusively found on the B haplotype (XV2c 1, KM19 2); the other CF mutations have more heterogeneous backgrounds. Strong haplotype correlations exist between the markers XV2c, KM19, D9, and G2 and the other CF mutations. Haplotype data suggest that there are at least seven mutations that remain to be identified in these families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Welsh Mixed Undefined Total Mutation No % No % No % No % AF508 107/149 71-8 92/126 73 0 69/94 73 4 268/369 72-6 621 + 1G>T 10/42* 6-7 5/34* 4-0 4/25* 4-3 19/101* 51 G551D 2/42* 1-3 6/34* 4-8 3/25* 3-2 11/101* 3 0 G542X 4/42* 2-7 4/34* 3-2 1/25* 1.1 9/101* 2-4 G85E 0/41* 0-0 2/34* 1 6 3/24* 3*4 5/99* 1-4 R553X 2/42* 1-3 2/34* 16 0/25* 00 4/101* 1-1 R1283M 3/42* 2.0 0/34* 0.0 0/25* 0.0 3/101* 0-8 N1303K 1/42* 0 7 1/34* 0-8 0/24* 0.0 2/100* 0-6 AI507 2/149 1-3 0/126 0.0 0/94 0.0 2/369 0-5 R117H 1/42* 0 7 1/34* 0-8 0/25* 0.0 2/101* 0-5 1717- 1G>A 2/42* 1-3 0/34* 0 0 0/25* 0 0 2/101* 0-5 R560T 0/42* 00 0/34* 00 1/25* 1 1 1/101* 03 1154InsTC 0/40* 0 0 1/33* 0 9 0/24* 0.0 1/97* 0-3 V520F 0/42* 0 0 0/34* 0 0 0/25* 0.0 0/101* 0 0 W1282X 0/42* 0 0 0/34* 0.0 0/25* 0.0 0/101* 0 0 R347P 0/42* 0 0 0/34* 0 0 0/24* 0.0 0/100* 0 0 Q493X 0/42* 0 0 0/34* 0 0 0/24* 0 0 0/100* 00 Total (%) 89-8 90 7 86-5 891 * Non-AF508 chromosomes. Login to comment

[hide] Genetic determination of exocrine pancreatic funct... Am J Hum Genet. 1992 Jun;50(6):1178-84. Kristidis P, Bozon D, Corey M, Markiewicz D, Rommens J, Tsui LC, Durie P
Genetic determination of exocrine pancreatic function in cystic fibrosis.
Am J Hum Genet. 1992 Jun;50(6):1178-84., [PMID:1376016]

Abstract [show]
We showed elsewhere that the pancreatic function status of cystic fibrosis (CF) patients could be correlated to mutations in the CF transmembrane conductance regulator (CFTR) gene. Although the majority of CF mutations--including the most common, delta F508--strongly correlated with pancreatic insufficiency (PI), approximately 10% of the mutant alleles may confer pancreatic sufficiency (PS). To extend this observation, genomic DNA of 538 CF patients with well-documented pancreatic function status were analyzed for a series of known mutations in their CFTR genes. Only 20 of the 25 mutations tested were found in this population. They accounted for 84% of the CF chromosomes, with delta F508 being the most frequent (71%), and the other mutations accounted for less than 5% each. A total of 30 different, complete genotypes could be determined in 394 (73%) of the patients. The data showed that each genotype was associated only with PI or only with PS, but not with both. This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as delta F508, delta I507, Q493X, G542X, R553X, W1282X, 621 + 1G----T, 1717-1G----A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as AF508, A1507, Q493X, G542X, R553X, W1282X, 621 + 1G-PT, 1717-1G--'A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T. Login to comment
58 Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both. Login to comment
73 Complete CF Genotypes for 394 Patients No. OF PATIENTS GENOTYPE WITH Allele 1 Allele 2 pla P AF508 ...... AF508 277 (49) 2 G551D 21 (1) 0 G542X 18 (9)c 0 621+1G-~T 11 (1) 0 AI507 7 (1) 0 N1303K 6 (1) 0 R560T 5 0 1717-lG-A 5 (1) 0 556delA 3 0 Q493X 3 0 R553X 3 (1) 0 W1282X 3 0 3659delC 2 0 1148T 1 0 R117H 0 9 A445E 0 2 P574H 0 2 R347P 0 1 G551D ..... 1717-lG-~A 2 0 621+1G-~T 1 0 G480C 1 0 G551D 1 0 V520F 1 (1) 0 G542X ..... V520F 1 0 1148T ...... W1282X 1 (1) 0 W1282X .... W1282X 1 0 N1303K .... R553X 1 (1) 0 R117H ..... R117H 0 1 G542X 0 1 R334W ..... R334W 0 1 a1 Numbers in parentheses are number of patients with neonatal meconium ileus. Login to comment
85 Accordingly, the mutations R117H, R334W, R347P, A455E, and P574H may be regarded as mild, whereas AF508, AI507, Q493X, G542X, R553X, W1282X, 621 + 1G-T, 1717-1G--A, 556delA, 3659delC, 1148T, G480C, V520F, GSS1D, and R560T are severe. Login to comment

[hide] The gene defect in cystic fibrosis and clinical ap... J R Soc Med. 1992;85 Suppl 19:6-8. Super M
The gene defect in cystic fibrosis and clinical applications of the knowledge.
J R Soc Med. 1992;85 Suppl 19:6-8., [PMID:1375961]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 V520F 63* 3 0.90% This supports a crucial role for the nucleotide binding G85E 40* 2 0.48% folds in determining severity-R117H is in exon 3, Total 91.99% part ofthe intramural anchoringprotein presumably not playing a major role in ion transport. Login to comment

[hide] Analysis of 31 CFTR mutations in 55 families from ... Early Hum Dev. 2001 Nov;65 Suppl:S161-4. Gomez-Llorente MA, Suarez A, Gomez-Llorente C, Munoz A, Arauzo M, Antunez A, Navarro M, Gil A, Gomez-Capilla JA
Analysis of 31 CFTR mutations in 55 families from the South of Spain.
Early Hum Dev. 2001 Nov;65 Suppl:S161-4., [PMID:11755047]

Abstract [show]
We carried out a molecular analysis of 350 chromosomes from 55 families originating from the South of Spain (Andalucia) who were diagnosed with cystic fibrosis (CF). We used polymerase chain reaction, followed by an oligonucleotide ligation assay (OLA) and sequence-coded separation using capillary electrophoresis. A frequency of 43.5% for DeltaF508 was found, making it the most common CF mutation in our sample. Seven more mutations (G542X, R334W, R1162X, 2789+5G-->A, R117H, DeltaI507 and W1282X) were detected and accounted for 24.7% of the total. The remaining mutations (31.8%) were undetectable with the methodology used in this study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 The patients and their families were referred to us from six Table 1 Listing of the CFTR mutations which are interrogated in the CF assay used in this study Mutation Location Mutation Location Exon/Intron Exon/Intron DF508 E.10 W1282X E.20 F508C E.10 3905insT E.20 DI507 E.10 N1303K E.21 Q493X E.10 G85E E.3 V520F E.10 621 + 1G ! Login to comment

[hide] Diagnosis of cystic fibrosis in adults with diffus... J Cyst Fibros. 2004 Mar;3(1):15-22. Hubert D, Fajac I, Bienvenu T, Desmazes-Dufeu N, Ellaffi M, Dall'ava-Santucci J, Dusser D
Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis.
J Cyst Fibros. 2004 Mar;3(1):15-22., [PMID:15463882]

Abstract [show]
We assessed the contribution of the sweat test, genotyping and nasal potential difference (NPD) in the diagnosis of cystic fibrosis (CF) in adults with diffuse bronchiectasis (DB). Among 601 adults referred for DB from 1992 to 2001, 46 were diagnosed with CF. The sweat test was positive in 37 patients and normal or intermediate in nine patients. Two CF mutations were identified in 18 patients (39%) by screening for 31 mutations and in 36 patients (78%) after complete genetic analysis. NPD was suggestive of CF in 71% of the patients. The combination of the sweat test and genetic analysis led to the diagnosis of CF in 45 patients. In the nine patients with normal or intermediate sweat test, the diagnosis was confirmed by screening for 31 mutations in five, by complete genetic screening in three, and by NPD in the remaining patient. Searching for CF should start with sweat test. If the sweat test is normal or intermediate, screening for 31 mutations may help to diagnose CF. A complete genetic analysis is indicated when only one mutation is detected and/or when other clinical features, such as obstructive azoospermia or pancreatic insufficiency, are suggestive of CF. NPD measurement is indicated in controversial cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 We used an oligonucleotide ligation assay using a commercially available kit (Cystic Fibrosis Assay, Applied Biosystems, Foster City, CA, USA) to seek 31 mutations in the CFTR gene (F508del, I507del, Q943X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA) which allowed to detect 82% of the CF alleles in France. Login to comment
129 * 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x. Login to comment

[hide] DNA immobilisation procedures for surface plasmon ... Biosens Bioelectron. 2007 Jan 15;22(6):803-9. Epub 2006 Apr 18. Mannelli I, Lecerf L, Guerrouache M, Goossens M, Millot MC, Canva M
DNA immobilisation procedures for surface plasmon resonance imaging (SPRI) based microarray systems.
Biosens Bioelectron. 2007 Jan 15;22(6):803-9. Epub 2006 Apr 18., [PMID:16621508]

Abstract [show]
Two different surface chemistries have been studied for the development of surface plasmon resonance imaging (SPRI) based DNA microarray affinity sensors: (1) 11-mercaptoundecanoic acid-poly(ethylenimine) (MUA-PEI) and (2) dextran procedures. The MUA-PEI method consists of assembling a multilayer on the basis of electrostatic interactions formed with: 11-mercaptoundecanoic acid (MUA), poly(ethylenimine) (PEI) and extravidin layers. The dextran procedure involves assembling a multilayer formed with 11-mercaptoundecanol, dextran and streptavidin layers, which are linked by covalent bonds. The oligonucleotide probes are immobilised onto the sensor surface as spots forming a matrix 14x14, which is spotted by a robot, while the target sequences are free in solution. The system allows the interaction (hybridisation) monitoring, in real-time and in parallel, of unlabeled oligonucleotide solution targets to oligonucleotide probes immobilised on a 196 spots matrix. Using oligonucleotides as probes and targets, both functionalised surfaces have been evaluated in view of their application to the diagnosis of gene mutations involved in human diseases. In particular, we demonstrate the ability to detect, in parallel, several mutations causing human cystic fibrosis (CF), which lie within exon 10 of the human cystic fibrosis transmembrane conductance regulator (CFTR) gene. The immobilised probes were complementary to sequences corresponding the mutant or wild type alleles. Two deletions of three bases (DeltaF508 and DeltaI507) and four single nucleotide polymorphisms (M470V, Q493X, V520F and 1716 G>A) were investigated. In both functionalised surfaces, the system showed the capacity to discriminate normal and mutant sequences differing by a single base.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Two deletions of three bases (F508 and I507) and four single nucleotide polymorphisms (M470V, Q493X, V520F and 1716 G > A) were investigated. Login to comment
56 The probe (P) sequences used are: 1, F508 wild type (P-F508-WT) = 5 biotin (T)17 ATA TCA TCT TTG GTG 3; 2, F508 mutant (P-F508-M) = 5 biotin (T)17 AAT ATC ATT GGT GTT 3; 3, I507 wild type (P-I507-WT) = 5 biotin (T)15 GAA AAT ATC ATC TTT G 3; 4, I507 mutant (P-I507-M) = 5 biotin (T)15 GAA AAT ATC TTT GGT 3; 5, M470V wild type (P-M470V-WT) = 5 biotin (T)16 TTC TAA TGA TGA TTA 3; 7, M470V mutant (P-M470V-M) = 5 biotin (T)16 TTC TAA TGG TGA TTA 3; 9, 1716 G > A wild type (P-1716 G > A-WT) = 5 biotin (T)18 AGA AGA GGT AAG A 3; 11, 1716 G > A mutant (P-1716 G > A-M) = 5 biotin (T)18 AGA AGA AGT AAG A 3; 13, Q493X wild type (P-Q493X-WT) = 5 biotin (T)18 TGT TCT CAG TTT T 3; 15, Q493X mutant (P-Q493X-M) = 5 biotin (T)18 TGT TCT TAG TTT T 3; 17, V520F wild type (P-V520F-WT) = 5 biotin (T)19 GAA GCG TCA TC 3; 19, V520F mutant (P-V520F-M) = 5 biotin (T)19 GAA GCT TCA TC 3 and 21, not relevant (P-NR) = 5 biotin (T)18 CAC TTC GTG CCT T 3. Login to comment
61 In the case of the remaining polymorphisms, the correspondence with the official nomenclature is: M470V-WT = c.1540A (normal allele), M470V-M = c.1540G (mutant allele), Q493X- WT = c.1609C (normal allele), Q493X-N = c.1609T (mutant allele), 1716 G > A-WT = c.1716G (normal allele), 1716 G > AM = c.1716A (mutant allele), V520F-WT = c.1690G (normal allele) and V520F-M = c.1690T (mutant allele). Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22]. Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT. Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1G࢐T, 711+1G࢐T, G551D, R334W, R347P, A455E, 1717-1G࢐A, R560T, R553X, N1303K, 1898+1G࢐A, 2184delA, 2789+5G࢐A, 3120+1G࢐A, R1162X, 3659delC, 3849+10kbC࢐T, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5G࢐T, 2183AA࢐G, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT. Login to comment
84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbC࢐T* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1G࢐A* 4 1.6 0.7 (1) 621+1G࢐T* 3 1.2 0.9 (1) 3120+1G࢐A* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5G࢐A* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1G࢐T* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1G࢐A* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5G࢐T 0 0 Undetermined (1) 2183AA࢐G 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens. Login to comment
88 One baby (4%) was a M1101K homozygote, and one was a compound heterozygote V520F/1898+1G࢐A. Login to comment

[hide] Genetic testing of sperm donors for cystic fibrosi... Eur J Obstet Gynecol Reprod Biol. 2013 Sep;170(1):183-7. doi: 10.1016/j.ejogrb.2013.06.022. Epub 2013 Jul 15. Landaburu I, Gonzalvo MC, Clavero A, Ramirez JP, Yoldi A, Mozas J, Zamora S, Martinez L, Castilla JA
Genetic testing of sperm donors for cystic fibrosis and spinal muscular atrophy: evaluation of clinical utility.
Eur J Obstet Gynecol Reprod Biol. 2013 Sep;170(1):183-7. doi: 10.1016/j.ejogrb.2013.06.022. Epub 2013 Jul 15., [PMID:23866907]

Abstract [show]
OBJECTIVE: To evaluate the clinical utility of genetic testing for cystic fibrosis (CF) and spinal muscular atrophy (SMA) in sperm donors. STUDY DESIGN: We studied the results of the genetic tests for CF and SMA applied to 372 sperm donor candidates. The CF carrier screening test analysed 32 mutations on the CFTR gene. Regarding SMA, the carrier test studied possible deletions of SMN1/2 by Multiplex Ligation-dependent Probe Amplification (MLPA) methodology. RESULTS: The carrier frequency obtained was greater for SMA than for CF. After adjusting the results obtained for the sensitivity of the tests, and taking into account the prevalence of female carriers in our population, the probability of transmission of the disease to the child from a donor with a negative genetic test was about five times lower in the case of SMA than in CF, although this difference was not statistically significant. The number of donors needed to screen (NNS) to avoid the occurrence of a child being affected by CF and SMA in our population was similar in both cases (1591 vs. 1536). CONCLUSIONS: This study demonstrates the need to include SMA among the diseases for which genetic screening is performed in the process of sperm donor selection. We believe that testing donors for SMA is as important and as useful as doing so for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The panel of mutations studied was: S549N, S549R, R553X, G551D, V520F, I507del, F508del, 3876delA, 1717-1G->A, G542X, R560T, 3120+1G->A, A455E, R117H, 394delTT, 2183AA- >G, 2184delA, 2789+5G->A, 1898+1G->A, 621+1G->T, 711+1G- >T, G85E, R347P, R347H, W1282X, R334W, 1078delT, 3849+10kbC->T, R1162X, N1303K, 3659delC, 3905insT. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 RESULTS The 32-mutation panel is composed of the 23 variants from the ACMG/ACOG screening panel combined with 9 additional mutations, namely, 3876delA, R347H, S549N, 3905insT, 1078delT, V520F, 394delTT, S549R, and 2183AA>G. Login to comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
80 The Table 3ߒ Frequency of 5T/7T/9T genotypes as a result of R117H reflex testing Poly-T alleles Number of detected alleles (%) CF32 panel CF69 panel 5T/5T 23 (0.44) 2 (0.73) 5T/7T 430 (8.27) 26 (9.49) 5T/9T 38 (0.73) 1 (0.37) 7T/7T 4,103 (78.93) 219 (79.92) 7T/9T 604 (11.61) 26 (9.49) 9T/9T 1 (0.02) 0 Total 5,198 (100) 274 (100) 394delTTd c.262_263delTT 3 0.10 G178Rd p.G178R 3 0.10 V520Fd p.V520F 3 0.10 2143delTd c.2012delT 2 0.06 935delAe c.803delA 2 0.06 A455Eb p.A455E 2 0.06 Q890Xd p.Q890X 2 0.06 S549Rd p.S549R 2 0.06 2869insGd c.2737insG 1 0.03 405ߙ+ߙ3A>Ce c.273ߙ+ߙ3A>C 1 0.03 G480Ce p.G480C 1 0.03 M1101Kd p.M1101K 1 0.03 Y122Xd p.Y122X 1 0.03 Total 3,088 100 a 1898ߙ+ߙ5G>Te , 444delA, G330X, S364Pe , K710X, and S1196X mutations were not detected in the target population. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] Molecular genetic testing for cystic fibrosis: lab... Genet Med. 2015 Mar;17(3):219-25. doi: 10.1038/gim.2014.93. Epub 2014 Jul 31. Lyon E, Schrijver I, Weck KE, Ferreira-Gonzalez A, Richards CS, Palomaki GE
Molecular genetic testing for cystic fibrosis: laboratory performance on the College of American Pathologists external proficiency surveys.
Genet Med. 2015 Mar;17(3):219-25. doi: 10.1038/gim.2014.93. Epub 2014 Jul 31., [PMID:25077647]

Abstract [show]
BACKGROUND: Molecular testing for cystic fibrosis mutations is widespread and routine in reproductive decision making and diagnosis. Our objective was to assess the level of performance of laboratories for this test. METHODS: The College of American Pathologists administers external proficiency testing with multiple DNA samples distributed biannually. RESULTS are analyzed, reviewed, and graded by the joint College of American Pathologists/American College of Medical Genetics and Genomics Biochemical and Molecular Genetics Committee. Assessment is based on genotype and associated clinical interpretation. RESULTS: Overall, 357 clinical laboratories participated in the proficiency testing survey between 2003 and 2013 (322 in the United States and 35 international). In 2013, US participants reported performing nearly 120,000 tests monthly. Analytical sensitivity and specificity of US laboratories were 98.8% (95% confidence interval: 98.4-99.1%) and 99.6% (95% confidence interval: 99.4-99.7%), respectively. Analytical sensitivity improved between 2003 and 2008 (from 97.9 to 99.3%; P = 0.007) and remained steady thereafter. Clinical interpretation matched the intended response for 98.8, 86.0, and 91.0% of challenges with no, one, or two mutations, respectively. International laboratories performed similarly. DISCUSSION: Laboratory testing for cystic fibrosis in the United States has improved since 2003, and these data demonstrate a high level of quality. Neither the number of samples tested nor test methodology affected performance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 One sample with a "non-ACMG" mutation, V520F, was sent as a challenge in three surveys: MGL5-2009A (which also included a sample with the non-ACMG mutation 3905insT), MGL2-2010B, and MGL5-2010B. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
357 Moreover, a large ''hot spot`` region for natural CFTR mutations is located at the NBD1:ICL4 interface, involving (1) six ICL4 positions (H1054D, G1061R, L1065P, R1066H/R1066C, F1074L, and L1077P), which line the path followed by F508 during the MD1 conformational transition from its initial to its final position, and (2) seven positions in NBD1 (S492F, I507del, F508del, V520F, A559T, R560K/R560T, and A561E) (Fig. 7c). Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment
79 This mutation is found more frequently in the Swedish CF population, where it is associated with lower lung function.23 Of interest is that the MIP score ranked the clinically unclassified missense mutation V520F into a similar severe range of CFTR mutations as other class I CF-causing nonsense variants. Login to comment
103 The highest MIP scores were calculated for class I mutations, including nonsense variants, the missense variant V520F, and the Scandinavian variant 394delTT. Login to comment
104 Nonsense variants and c.262_263delTT have been associated with a more severe CF phenotype when compared with F508del.23,27 Little clinical information is available for V520F, but the location of the amino acid substitution may indicate impairment of channel function. Login to comment
109 While non-CFTR modifier genes as well as environmental factors largely influence the development and progression of lung disease and nutritional decline,33-36 we demonstrate that the severity of the underlying CFTR genotype Table 2ߒ Meconium ileus prevalence scores and CFTR function CFTR mutation MIP score CFTR function (%wt) High MIP score ߓ V520F 0.38 0.2 ߓ N1303K 0.25 0.5 ߓ F508del 0.27 0.4 ߓ R560T 0.27 0.1 ߓ A559T 0.24 0 ߓ G551D 0.15 1 ߓ G85E 0.14 0.8 ߓ R1066C 0.13 0 Low MIP score ߓ R347P 0.1 0 ߓ R117C 0.1 2.9 ߓ R117H 0.07 33 ߓ R347H 0.06 5 ߓ R334W 0.05 1.3 ߓ A455E 0.05 6 ߓ L206W 0.04 5 ߓ M1101K 0.04 0 ߓ P67L 0.0 8 The table compares meconium ileus prevalence (MIP) scores and measured cystic fibrosis transmembrane conductance regulator (CFTR) function in Fisher rat thyroid determined by VanGoor et al.24 for the major and missense cystic fibrosis-causing variants for which patient group size was ࣙ10 in at least the US group. Login to comment