ABCMdb

ABCC1 p.Thr73Ile

Predicted by SNAP2:	A: N (72%), C: N (57%), D: D (85%), E: D (75%), F: D (71%), G: D (80%), H: D (63%), I: D (53%), K: D (75%), L: D (53%), M: D (59%), N: D (66%), P: D (66%), Q: D (53%), R: D (75%), S: N (57%), V: N (66%), W: D (85%), Y: D (71%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Linkage disequilibrium and haplotype architecture ... Ann Hum Genet. 2004 Nov;68(Pt 6):563-73. Wang H, Hao B, Zhou K, Chen X, Wu S, Zhou G, Zhu Y, He F
Linkage disequilibrium and haplotype architecture for two ABC transporter genes (ABCC1 and ABCG2) in Chinese population: implications for pharmacogenomic association studies.
Ann Hum Genet. 2004 Nov;68(Pt 6):563-73., [PMID:15598215]

Abstract [show]
Information about linkage disequilibrium (LD) patterns and haplotype structures for candidate genes is instructive for the design and analysis of genetic association studies for complex diseases and drug response. ABCC1 and ABCG2 are genes coding for two multidrug resistance (MDR) associated transporters; they are also related to some pathophysiological traits. To pinpoint the LD profiles of these MDR genes in Chinese, we systemically screened 27 unrelated individuals for single nucleotide polymorphisms (SNPs) in the coding and regulatory regions of these genes, and thereby characterized their haplotype structures. Despite marked variations in haplotype diversity, LD pattern and intragenic recombination intensity between the two genes, both loci could be partitioned into several LD blocks, in which a modest number of haplotypes accounted for a high fraction of the sampled chromosomes. We concluded that each locus has its own genomic LD profile, but that they still share a common segmental LD architecture with low haplotype diversity. Our data will benefit genetic association studies of complex traits and drug response possibly related to these genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 SNP Nucleotide sequence Minor allele dbSNP ID effect position (major/minor) frequency (%) ABCC1 1 5`FR/-1862 gacccG/Aggcca 44.4 2 5`FR/-1830 atcctA/Gtctac 1.9 3 5`FR/-1680 gaggaG/Aaaaag 1.9 4 5`FR/-471 cggatA/Gctgtc 7.4 5 E2/218 caaaaC/Tcaaaa 3.7 Thr73Ile 6 I2/-26 gttgtG/Aggggg 1.9 rs8187842 7 I3/-66 ctgggT/Cgacaa 37.0 rs4148337 8 I7/+54 ccactC/Actgtg 9.3 rs903880 9 I7/+64 ggcctC/Gaatcc 48.1 rs246232 10 E8/816 cagccG/Agtgaa 1.9 wobble 11 E8/825 aaggtT/Cgtgta 38.9 rs246221 wobble 12 E9/1062 gtgaaT/Cgacac 35.2 rs35587 wobble 13 I9/+8 aggggA/Gcgctg 37.0 rs35588 14 I12/-37 cactcA/Ggggca 20.4 rs35604 15 E13/1684 tggccT/Ctgtgc 20.4 rs35605 wobble 16 I13/+105 ccggtC/Tgggct 20.4 rs35606 17 I14/+105 ccagcC/Tgcttg 1.9 18 I15/+627 gctgtA/Gtttta 25.8 rs35628 19 I15/+669 aatctG/Ttagaa 7.4* rs4148353 20 I15/-967 ctttcT/Ggctgt 37.0 rs152029 21 E16/2007 atcccC/Tgaagg 3.7 rs2301666 wobble 22 E17/2168 tctccG/Aagaaa 5.6 rs4148356 Arg723Gln 23 I18/-30 gcactG/Cacgtg 16.7 rs2074087 24 I22/+62 aattaT/Ctccct 27.8 rs3887893 25 I22/-43 gtcagC/Ttccct 3.7 26 E27/3915 gaggaC/Tctgga 1.9 wobble 27 E28/4002 aagtcG/Atccct 11.1 rs2239330 wobble 28 I28/-35 tcagcA/Gtgaca 27.8 rs212087 29 I30/+30 gcacaG/Atggcc 29.6 rs212088 30 3`UTR/+801 accccC/Gactcc 33.3 rs129081 noncoding 31 3`UTR/+866 tactgT/Atccca 14.8 rs212090 noncoding 32 3`FR/+1513 gttctT/Ctaagg 27.8 ABCG2 1 5`UTR/-407 cgcagC/Tgcctc 1.9 2 5`UTR/-376 ggggaG/Acgctc 1.9 3 E2/34 tcccaG/Atgtca 20.4 rs2231137 Val12Met 4 I2/+36 ttttaA/Gtttac 25.9 rs4148152 5 I3/+10 gtataA/Ggagag 20.4 rs2231138 6 E5/421 acttaC/Agttct 22.2 rs2231142 Gln141Lys 7 E7/805 acgggC/Tctgct 3.7 Pro269Ser 8 I9/-126 agccaT/Gtgagt 7.4 9 I11/+20 gttctA/Gggaac 31.5 rs2231153 10 I12/+49 cctatG/Tggtga 16.7 rs2231156 11 I13/+40 tgtttT/Ctttcc 24.1 rs2231157 12 I13/-21 tgactC/Tttagt 29.6 rs2231162 13 I14/-46 ttcttG/Aaaatt 48.1 rs2725267 SNPs in specific regions, i.e. 5`flanking region (5`FR), 5`untranslated region (5`UTR), intron (I), exon (E), 3`UTR, and 3`FR, are presented as region/+(-): for 5`FR and 5`UTR, n nucleotides upstream (-) from the translation initiation site; for 3`UTR and 3`FR, n nt downstream (+) from the third base of stop codon; for coding regions, n corresponds to positions of their cDNA with the first base of start codon set to 1; and for introns, n nt upstream (-) from 3` site or downstream (+) from 5` site of introns. Login to comment

[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
830 A thorough investigation on the functional significance of 10 non-synonymous SNP, leading to amino acid changes C43S, T73I, S92F, T117; R230Q, R633Q, R723Q, A989T, C1047S. Login to comment
852 Table 5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to Le Saux et al., 2000; Ito et al., 2001; Moriya et al., 2002; Conrad et al., 2002; Oselin et al., 2003b; Wang et al., 2004) Position/ Nucleotide Aminoacid or effect Orientals Caucasians Function 128G>C C43S 0.01 - elevateda 218C>T T73I 0.00-0.04 - 257C>T S92F 0.00 0.00 decreaseda 350C>T T117M - 0.02 (decreased)a 689G>A R230N 0.00 0.00 (decreased)a 816G>A synonymous - 0.04 825T>C synonymous - 0.30 1057G>A V353M 0.00 0.005 elevateda 1299G>T R433S - 0.01 elevated Vmax of doxorubicin, decreased transport of LTC4 a,b 1684T>C synonymous - 0.80 1898G>A R633Q - 0.01 (decreased)a 2012G>T G671V - 0.03 doxorubicine-induced cardiomyopathyc 2168G>A R723Q 0.01-0.07 - decreaseda 2965G>A A989T 0.00 0.005 (decreased)a 3140G>C C1047S 0.00 0.00 3173G>A R1058Q 0.01 - 4002G>A synonymous - 0.28 4535C>T S1512L - 0.03 decreaseda a Letourneau et al. (2005). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Letourneau et al. (2005) studied the influence of 10 non-synonymous variations (Thr73Ile, Ser92Phe, Thr117Met, Arg230Gln, Arg633Gln, Arg723Gln, Ala989Thr, Cys1047Ser, Arg1056Gln, and Ser1512Leu) on MRP1 expression using membrane vesicles isolated from transfected cells and assesed transport activity for 3 known MRP1 substrates (LTC4, estradiol-17-β-glucuronide, and methotrexate). Login to comment
81 MRP1 (ABCC1) NH2 NBD NBD in out Membrane Cys43Ser Ser92Phe Thr117Met Arg230Gln Val353Met Arg633Gln Gly671Val Arg723Gln Arg433Ser Ala989Thr Cys1047Ser Val1146Ile Arg1058Gln Thr1401Met Ser1512Leu Thr73Ile COOH NBD NBD COOH NBD COOH NBD NBD Table1MRP1(ABCC1)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 128G>CCys43SerExon2--1[1]-Decreaseinvincristineresistance[2]rs41395947 Disruptedplasmamembranetraffickingin transfectedcells[2] 218C>TThr73IleExon2--1[1]3.7Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] rs41494447 257C>TSer92PheExon30a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 350C>TThr117MetExon3-100[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] 689G>AArg230GlnExon70a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 1057G>AVal353MetExon90a 0.5a 0a -- 1299G>TArg433SerExon10-1.4[6]--Changesintransportandresistance[7] 1898G>AArg633GlnExon13-[8]--Noinfluenceonexpressionandtransportin membranevesicles[4] 2012G>TGly671ValExon16-2.8[6]--Noinfluenceonexpressionandtransportin membranevesicles[6] Associatedwithanthracycline-induced cardiotoxicity[9] 2168G>AArg723GlnExon17--7.3[1]5.6Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4]noinfluenceonmRNA expressioninenterocytes(n=1)[10] rs4148356 2965G>AAla989ThrExon220a 0.5a 0a -Noinfluenceonexpressionandtransportin membranevesicles(non-significantreduction inE17βGtransport)[4] 323 3140G>CCys1047SerExon234.5a 0a 0a -Noinfluenceonexpressionandtransportin membranevesicles[4] rs13337489 3173G>AArg1058GlnExon23--1[1]-Noinfluenceonexpressionandtransportin membranevesicles[4] rs41410450 3436G>AVal1146IleExon24-----rs28706727 4102C>TThr1401MetExon29-----rs8057331 4535C>TSer1512LeuExon31-[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]

Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 A thorough investigation on the functional significance of ten nonsynonymous SNPs, leading to amino acid changes C43S, T73I, S92F, T117; R230Q, R633Q, R723Q, A989T, C1047S. Login to comment
155 ABCC2 (Multidrug Resistance-Associated Protein 2) Table 6.5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to (33, 77-80, 136)) Position Amino acid or effect Orientals Caucasians Function c.128G>C C43S 0.01 - Elevateda c. 218C>T T73I 0.00-0.04 - c. 257C>T S92F 0.00 0.00 Decreaseda c. 350C>T T117M - 0.02 (Decreased)a c. 689G>A R230N 0.00 0.00 (Decreased)a c. 816G>A Synonymous - 0.04 c. 825T>C Synonymous - 0.30 c. 1057G>A V353M 0.00 0.005 Elevateda c. 1299G>T R433S - 0.01 Elevated vmax of doxorubicin, decreased transport of LTC4 a,b c. 1684T>C Synonymous - 0.80 c. 1898G>A R633Q - 0.01 (Decreased)a c. 2012G>T G671V - 0.03 Doxorubicine-induced cardiomyopathyc c. 2168G>A R723Q 0.01-0.07 - Decreaseda c. 2965G>A A989T 0.00 0.005 (Decreased)a c. 3140G>C C1047S 0.00 0.00 c. 3173G>A R1058Q 0.01 - c. 4002G>A Synonymous - 0.28 c. 4535C>T S1512L - 0.03 Decreaseda References: a [81], b [77], c [84] an inducible expression of ABCC2, which contributes also to the phenomenon of drug resistance. Login to comment

[hide] Pharmacogenetics of membrane transporters: an upda... Mol Biotechnol. 2010 Feb;44(2):152-67. Sissung TM, Baum CE, Kirkland CT, Gao R, Gardner ER, Figg WD
Pharmacogenetics of membrane transporters: an update on current approaches.
Mol Biotechnol. 2010 Feb;44(2):152-67., [PMID:19950006]

Abstract [show]
This review provides an overview of the pharmacogenetics of membrane transporters including selected ABC transporters (ABCB1, ABCC1, ABCC2, and ABCG2) and OATPs (OATP1B1 and OATP1B3). Membrane transporters are heavily involved in drug clearance and alters drug disposition by actively transporting substrate drugs between organs and tissues. As such, polymorphisms in the genes encoding these proteins may have significant effects on the absorption, distribution, metabolism and excretion of compounds, and may alter pharmacodynamics of many agents. This review discusses the techniques used to identify substrates and inhibitors of these proteins and subsequently to assess the effect of genetic mutation on transport, both in vitro and in vivo. A comprehensive list of substrates for the major drug transporters is included. Finally, studies linking transporter genotype with clinical outcomes are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Those studied include C43S, T73I, S92F, T117M, R230Q, V353M, R433S, R633Q, G671V, R723Q, A989T, C1047S, R1058Q, A1337T, and S1512L. Login to comment

[hide] Polymorphism of the ABC transporter genes, MDR1, M... Pharmacogenetics. 2001 Mar;11(2):175-84. Ito S, Ieiri I, Tanabe M, Suzuki A, Higuchi S, Otsubo K
Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects.
Pharmacogenetics. 2001 Mar;11(2):175-84., [PMID:11266082]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Four of the 16 mutations were associated with an amino acid substitution; G to C transversion at position 128 (G128C, Cys to Ser at codon 43) in exon 2, C to T at 218 (C218T, Thr to Ile at 73) in exon 2, G to A at 2168 (G2168A, Arg to Gln at 723) in exon 17 and G to A at 3173 (G3173A, Arg to Gln at 1058) in exon 23 (position numbering from Grant et al., 1997) (Fig. 2). Login to comment
63 In the MRP1 gene, we identi®ed four missense mutations, G128C (Cys43Ser), C218T (Thr73Ile), G2168A (Arg723Gln) and G3173A (Arg1058Gln). Login to comment
67 Frequencies of mutations in the MRP1 gene in a Japanese population (n 48) Primer pair Location Nucleic acid Nucleotide sequence Amino acid Genotype Allele frequency substitutiona substitution Wild-type Mutation w/w w/m m/m w m MR12/1 Exon 2 G128C gccttGttttt gccttCttttt Cys43Ser 47 1 0 0.990 0.010 MR12/1 Exon 2 C218T caaaaCcaaaa caaaaTcaaaa Thr73Ile 47 1 0 0.990 0.010 MR18/1 Exon 8 T825C aaggtTgtgta aaggtCgtgta Val275Val 18 24 6 0.625 0.375 MR19/1 Exon 9 T1062C gtgaaTgacac gtgaaCgacac Asn354Asn 17 28 3 0.646 0.354 MR113/1 Exon 13 T1684C tggccTtgtgc tggccCtgtgc Leu562Leu 31 15 2 0.802 0.198 MR116/1 Exon 16 C2007T atcccCgaagg atcccTgaagg Pro669Pro 40 8 0 0.917 0.083 MR117/1 Exon 17 G2168A tctccGagaaa tctccAagaaa Arg723Gln 41 7 0 0.927 0.073 MR120/1 Exon 20 C2665T gcggtCcaggg gcggtTcaggg Pro889Pro 47 1 0 0.990 0.010 MR120/1 Exon 20 T2694C gagaaTggcat gagaaCggcat Asn898Asn 47 1 0 0.990 0.010 MR123/1 Exon 23 G3173A cctgcGgtcac cctgcAgtcac Arg1058Gln 47 1 0 0.990 0.010 MR128/1 Exon 28 G4002A aagtcGtccct aagtcAtccct Ser1334Ser 36 9 3 0.844 0.156 MR131/1 Exon 31 C4524T gagtaCggcgc gagtaTggcgc Tyr1508Tyr 47 1 0 0.990 0.010 MR19/1 Intron 9 A12188G aggggAcgctg aggggGcgctg ± 17 28 3 0.646 0.354 MR112/1 Intron 11 C1474À48T atgggCtgatc atgggTtgatc ± 44 3 1 0.948 0.052 MR119/1 Intron 18 C2461À30G gcactCacgtg gcactGacgtg ± 27 14 7 0.708 0.292 MR119/1 Intron 18 T2461À38C acacaTgtgca acacaCgtgca ± 41 7 0 0.927 0.073 The positions of the identi®ed polymorphisms correspond to positions of the MRP1 gene (Grant et al., 1997; EMBL/GenBank accession no. Login to comment

[hide] Polymorphisms of MRP1 (ABCC1) and related ATP-depe... Pharmacogenet Genomics. 2005 Aug;15(8):523-33. Conseil G, Deeley RG, Cole SP
Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters.
Pharmacogenet Genomics. 2005 Aug;15(8):523-33., [PMID:16006996]

Abstract [show]
Genetic variations in drug metabolizing enzymes and targets are established determinants of adverse drug reactions and interactions, but less is known about the role of genetic polymorphisms in membrane transport proteins. MRP1 (ABCC1) is one of 13 polytopic membrane proteins that comprise the 'C' subfamily of the ATP-binding cassette (ABC) superfamily of transport proteins. MRP1 and related ABCC family members, including MRP2, 3, 4 and 5 (ABCC2, 3, 4 and 5), each have a distinctive pattern of tissue expression and substrate specificity. Together, these five transporters play important roles in the disposition and elimination of drugs and other organic anions, and in maintenance of blood-tissue barriers, as confirmed by enhanced chemosensitivity of respective knockout mice. Moreover, Mrp2 (Abcc2) deficient animals display mild conjugated hyperbilirubinemia, corresponding to a human condition known as Dubin-Johnson syndrome (DJS). Naturally occurring mutations in MRP/ABCC-related drug transporters have been reported, some of which are non-synonymous single nucleotide polymorphisms. The consequences of the resulting amino acid changes can sometimes be predicted from in vitro site-directed mutagenesis studies or from knowledge of mutations of analogous (conserved) residues in ABCC proteins that cause DJS, Pseudoxanthoma elasticum (ABCC6), cystic fibrosis (CFTR/ABCC7) or persistent hyperinsulinemic hypoglycemia of infancy (SUR1/ABCC8). Continual updating of databases of sequence variants and haplotype analysis, together with in vitro biochemical validation assays and pharmacological studies in knockout animals, should make it possible to determine how genetic variation in the MRP-related transporters contributes to the range of responses to drugs and chemicals observed in different human populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
148 Fig. 3 Exon 1 2 3 MSDMSD NBD1 MSD NBD2 C4535T(S1512L) G3173A (R1058Q) G3140C (C1047S) G2965A (A989T) G2168A (R723Q) G2012T(G671V) G1898A (R633Q) G1299T(R433S) G1057A (V353M) G689A (R230Q) C350T(T117M) C257T(S92F) C218T(T73I) C128C (C43S) (TM1-5) (TM6-11) (TM12-17) 4 5 6 7 8 9101112 1314 151617 1819 20 21 22 23 242526272829 30 31 Location of non-synonymous SNPs in the coding regions of the genes in the MRP1/ABCC1 gene. Login to comment

[hide] Functional characterization of non-synonymous sing... Pharmacogenet Genomics. 2005 Sep;15(9):647-57. Letourneau IJ, Deeley RG, Cole SP
Functional characterization of non-synonymous single nucleotide polymorphisms in the gene encoding human multidrug resistance protein 1 (MRP1/ABCC1).
Pharmacogenet Genomics. 2005 Sep;15(9):647-57., [PMID:16041243]

Abstract [show]
The 190-kDa ATP-binding cassette (ABC) multidrug resistance protein 1 (MRP1) encoded by the MRP1/ABCC1 gene mediates the active cellular efflux of glucuronide, glutathione and sulfate conjugates. It can also confer resistance to a diverse spectrum of chemotherapeutic agents and transport a variety of toxicants. In the present study, we examined 10 MRP1/ABCC1 missense genetic variants [non-synonymous single nucleotide polymorphisms (SNPs)] to determine whether or not they affect expression or function of the transporter. Variants 218C>T (Thr73Ile), 257C>T (Ser92Phe), 350C>T (Thr117Met), 689G>A (Arg230Gln), 1898G>A (Arg633Gln), 2168G>A (Arg723Gln), 2965G>A (Ala989Thr), 3140G>C (Cys1047Ser), 3173G>A (Arg1058Gln) and 4535C>T (Ser1512Leu) were recreated using site-directed mutagenesis and transfected into human embryonic kidney cells. Immunoblotting experiments showed that all mutant proteins were expressed at levels comparable to wild-type MRP1. Vesicular transport assays revealed that the Ala989Thr mutation caused a significant decrease in estradiol 17beta-glucuronide transport due to a decrease in apparent affinity (Km) for this organic anion. The transport properties of the other mutants were comparable to wild-type MRP1. When the MRP1/ABCC1 non-synonymous SNPs were evaluated by the SIFT algorithm using subsets of homologs and orthologs of MRP1/ABCC1, Arg230Gln, Val353Met, Arg433Ser, Gly671Val and Arg1058 mutations were predicted to be deleterious, whereas the PolyPhen algorithm predicted Ser92Phe and Gly671Val to be potentially damaging. Thus most predictions of these algorithms were not in accordance with our experimental results. In conclusion, our data suggest that none of the MRP1/ABCC1 variants studied are likely by themselves to have major deleterious effects in healthy individuals, and the SIFT and PolyPhen algorithms appear to be poor predictors of the phenotypic consequences of these MRP1 mutations at least in vitro.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Variants 218C > T (Thr73Ile), 257C > T (Ser92Phe), 350C > T (Thr117Met), 689G > A (Arg230Gln), 1898G > A (Arg633Gln), 2168G > A (Arg723Gln), 2965G > A (Ala989Thr), 3140G > C (Cys1047Ser), 3173G > A (Arg1058Gln) and 4535C > T (Ser1512Leu) were recreated using site-directed mutagenesis and transfected into human embryonic kidney cells. Login to comment
28 Of these mutations, the Fig. 1 128G >C (C43S) 128G >T(T73I) 689G >A (R230Q)1057G >A (V353M) 1299G >T(R433S) 1898G >A (R633Q) 2012G >T(G671V) 2168G >A (R723Q) 3173G >A (R1058Q) 4535C >T(S1512L) 3140G >C (C1047S) 2965G >A (A989T) 350C >T(T117M) 257C >T(S92F) 313029282726252423222120181716151413121110987654321 19 MSD1 MSD1 MSD2 MSD3 MSD2 NBD1 MSD3 NBD2 TM 1 2 3 4 5 6 7 8 Val353Met Ala989Thr Cys1047Ser Arg1058Gln NBD2NBD1 Ser1512Leu Arg633Gln Arg433Ser Arg723Gln Thr73lle Thr117Met Arg230Gln Cys43Ser Ser92Phe Gly671Val 9 10 11 12 13 14 15 16 17 (a) (b) Location of reported non-synonymous single nucleotide polymorphisms (SNPs) in MRP1/ABCC1. Login to comment
45 The template for creating the Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln mutants was prepared by subcloning a 865-bp XbaI/BamHI fragment encoding amino acids 1-840 of MRP1 from pcDNA3.1(-)MRP1k into pGEM-3z (Promega, Madison, Wisconsin, USA) [18,21]. Login to comment
46 The template for generating Table 1 Frequencies of non-synonymous single nucleotide polymorphisms in MRP1/ABCC1 Variant Amino acid substitution Allelic frequency Population References 128G > C Cys43Ser 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 218C > T Thr73Ile 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 3.7% (2/54) Chinese [37] 257C > T Ser92Phe 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 350C > T Thr117Met 1.6% (1/64) Caucasian [28] 689G > A Arg230Gln 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1057G > A Val353Met 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1299G > T Arg433Ser 1.4% (1/72) Caucasian [20] 0% (0/110) Caucasian [19] 1898G > A Arg633Gln 0.8% (2/234) Caucasian [29] 2012G > T Gly671Val 2.8% (2/72) Caucasian [20] 2.6% (6/234) Caucasian [29] 2168G > A Arg723Gln 3.8% (1/26) Japanese [16] 1% (1/96) Japanese [30] 7.3% (7/96) Japanese [17] 5.6% (3/54) Chinese [37] 2965G > A Ala989Thr 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3140G > C Cys1047Ser 0% (0/220) Caucasian www.pharmGKB.org 4.5% (9/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3173G > A Arg1058Gln 0% (0./26) Japanese [16] 1% (1/96) Japanese [17] 4535C > T Ser1512Leu 3.1% (2/24) Caucasian [28] Characterization of MRP1/ABCC1 variants in vitro Le´tourneau et al. 649 the Arg633Gln and Arg723Gln mutants was created by subcloning a HindIII fragment (1329 bp) encoding amino acids 517-959 into pGEM-3z [20]. Login to comment
50 Mutagenesis was performed according to the manufacturer`s instructions with the following sense primers (substituted nucleotides for amino acid mutation are underlined, introduced or disrupted restriction sites are italicized and other silent substitutions are in lower case letters) as follows: Thr73Ile (50 -G ATG ACA CCT CTC AAC AAA ATC AAAACTGCCTTGGG-30 ); Ser92Phe (50 -GG GCA GAC CTG TTC TAC TTT TTC TGG GAA AG-30 ) (EarI); Thr117Met (50 -CTC TTG GGC ATC ACC ATG CTG CTT GCT ACC-30 ); Arg230Gln (50 -GG TTG ATT GTA CAG GGC TAC CGC C-30 ) (BsrGI); Arg633Gln (50 -GAC AGC ATC GAG CGA CAG CCT GTG AAA GAC GGC GG-30 ) (Eam1105I); Arg723Gln (50 -CAG AAT GAC TCT CTC CAA GAA AAt ATC CTT TTT GGA TGT CAG C-30 ) (PleI); Ala989Thr (50 -C ATG TGT AAC CAC GTG TCC ACG CTG GCT TCC-30 ) (PmlI); Cys1047Ser (50 - GCT TCC CGC TCT CTG CAT GTG GAC CTG C-30 ) (PmlI); Arg1058Gln (50 -CTG CTG CAC AGC ATC CTC CAG TCA CCC ATG AGC-30 ) (BstEII); and Ser1512Leu (50 -CAG GAG TAC GGA GCC CCA TTG GAC CTt CTG CAG CAG-30 ) (NarI). Login to comment
51 Following mutagenesis, the desired fragment was subcloned back into pcDNA3.1(-) MRP1k as a XbaI/BamHI fragment (865 bp) for the Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln mutants; a Bsu36I/Esp3I fragment (721 bp) for the Arg633Gln and Arg723Gln mutants; a Esp3I/EcoRI fragment (1313 bp) for the Ala989Thr, Cys1047Ser, Arg1058Gln mutants; and a EcoRI/KpnI fragment (778 bp) for the Ser1512Leu mutant. Login to comment
83 Expression levels of MRP1 mutants To investigate the effect of the amino acid substitutions resulting from the non-synonymous SNPs on MRP1 protein expression and function, MRP1 expression vectors containing the mutations responsible for the substitutions (Thr73Ile, Ser92Phe, Thr117Met, Arg230Gln, Arg633Gln, Arg723Gln, Thr989Ala, Cys1047Ser, Arg1058Gln, Ser1512Leu) were generated by site-directed mutagenesis and transfected into HEK293T cells. Login to comment
87 The mutants were considered in four groups based on their location in the transporter: (a) MSD1/CL3 mutants Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln; (b) NBD1 mutants Arg633Gln and Arg723Gln; (c) MSD3 mutants Ala989Thr, Cys1047Ser and Arg1058Gln; and (d) COOH-terminus mutant Ser1512Leu. Login to comment
158 This observation may be construed as being Table 2 Conservation of the amino acids substituted by non-synonymous SNP of human MRP1/ABCC1a Protein Speciesb C43S T73I S92F T117Mc R230Q V353M R433S R633Qc G671V R723Q A989T C1047S R1058Q S1512L MRP1 Human C T S T R V R R G R A C R S Monkey C T S M R V R R G Q A C R S Dog C T S M R V R R G R A R R S Cow C A S M Q V R R G R A R R S Rat C A S M Q V R W G R A R R S Mouse C T S M H V R R G R A R R S MRP2 Human L A V T K A K R G K A I R E Monkey L A V T K A K R G K A I R E Dog L A V T K A K R G K A I Q Q Rat L A A T K V K R G K A A R E Mouse L A A T K V K V G K A T R E Rabbit L A V T K V K R G K A I R E MRP3 Human C L S M Y I R K G Q A V R A Rat C L S M L L R K G Q A L R V MRP4 Human - - - - I F K R G R Y T K Y MRP5 Human - - - - V T R S G R T R R S MRP6 Human P A A M R I R S G V A L R A CFTR Human - - - - R Y K A G K L I Q Q SUR1 Human V L L A T V Q R G E L R L E SUR2 Human V L H T Q V Q R G E I N L P Pgp Human - - - - - E K S G A G R R Q YCF1 Saccharomyces cervisiae A I L V T V K L G K S Y R G Mrp1 Caenorhabditis elegans T L D F L I R T G R G L R K Mrp2 Caenorhabditis elegans T F D I L I K T G R G I R K AtMRP2 Arabidopsis thaliana Q L R W L M S P G R R K R E AtMRP1 Arabidopsis thaliana H T A V L M S P G R R K R E a Aligned using Clustal W (http://pbil.univ-lyon1.fr/). Login to comment

[hide] Nucleotide sequence analyses of the MRP1 gene in f... BMC Genomics. 2006 May 10;7:111. Wang Z, Sew PH, Ambrose H, Ryan S, Chong SS, Lee EJ, Lee CG
Nucleotide sequence analyses of the MRP1 gene in four populations suggest negative selection on its coding region.
BMC Genomics. 2006 May 10;7:111., [PMID:16684361]

Abstract [show]
BACKGROUND: The MRP1 gene encodes the 190 kDa multidrug resistance-associated protein 1 (MRP1/ABCC1) and effluxes diverse drugs and xenobiotics. Sequence variations within this gene might account for differences in drug response in different individuals. To facilitate association studies of this gene with diseases and/or drug response, exons and flanking introns of MRP1 were screened for polymorphisms in 142 DNA samples from four different populations. RESULTS: Seventy-one polymorphisms, including 60 biallelic single nucleotide polymorphisms (SNPs), ten insertions/deletions (indel) and one short tandem repeat (STR) were identified. Thirty-four of these polymorphisms have not been previously reported. Interestingly, the STR polymorphism at the 5' untranslated region (5'UTR) occurs at high but different frequencies in the different populations. Frequencies of common polymorphisms in our populations were comparable to those of similar populations in HAPMAP or Perlegen. Nucleotide diversity indices indicated that the coding region of MRP1 may have undergone negative selection or recent population expansion. SNPs E10/1299 G>T (R433S) and E16/2012 G>T (G671V) which occur at low frequency in only one or two of four populations examined were predicted to be functionally deleterious and hence are likely to be under negative selection. CONCLUSION: Through in silico approaches, we identified two rare SNPs that are potentially negatively selected. These SNPs may be useful for studies associating this gene with rare events including adverse drug reactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 B A C SNPe1* SNPe2 SNPe3 SNPe4 SNPe5 SNPe6* SNPe7 SNPe8 SNPe9* SNPe10 SNPe11 SNPe12* SNPe13* SNPe14 SNPe15 SNPe16* SNPe17 SNPe18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 mRNA of ABCC1 CH ML IN CAU SNPe1* E2/218 C>T T73I 0.65 benign - 1.39 2.86 0 0 SNPe2 E6/651 G>A - - - 0 0 2.86 0 SNPe3 E8/816 G>A - - - 2.78 0 0 0 Oselin et al. Login to comment

[hide] Genetic variations and haplotype structures of the... Drug Metab Pharmacokinet. 2007 Feb 25;22(1):48-60. Fukushima-Uesaka H, Saito Y, Tohkin M, Maekawa K, Hasegawa R, Kawamoto M, Kamatani N, Suzuki K, Yanagawa T, Kajio H, Kuzuya N, Yasuda K, Sawada J
Genetic variations and haplotype structures of the ABC transporter gene ABCC1 in a Japanese population.
Drug Metab Pharmacokinet. 2007 Feb 25;22(1):48-60., 2007-02-25 [PMID:17329911]

Abstract [show]
Multidrug resistance-related protein 1 (MRP1), an ATP-binding cassette transporter encoded by the ABCC1 gene, is expressed in many tissues, and functions as an efflux transporter for glutathione-, glucuronate- and sulfate-conjugates as well as unconjugated substrates. In this study, the 31 exons and their flanking introns of ABCC1 were comprehensively screened for genetic variations in 153 Japanese subjects to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCC1 that is necessary for pharmacogenetic studies of the substrate drugs. Eighty-six genetic variations including 31 novel ones were found: 1 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 20 in the coding exons (9 synonymous and 11 nonsynonymous variations), 4 in the 3'-UTR, and 60 in the introns. Of these, eight novel nonsynonymous variations, 726G>T (Trp242Cys), 1199T>C (Ile400Thr), 1967G>C (Ser656Thr), 2530G>A (Gly844Ser), 3490G>A (Val1164Ile), 3550G>A (Glu1184Lys), 3901C>T (Arg1301Cys), and 4502A>G (Asp1501Gly), were detected with an allele frequency of 0.003. Based on the LD profiles, the analyzed regions of the gene were divided into five LD blocks (Blocks -1 and 1 to 4). The multiallelic repeat polymorphism in the 5'-UTR was defined as Block -1. For Blocks 1, 2, 3 and 4, 32, 23, 23 and 13 haplotypes were inferred, and 9, 7, 7 and 6 haplotypes commonly found on > or = 10 chromosomes accounted for > or = 91% of the inferred haplotypes in each block. Haplotype-tagging single nucleotide polymorphisms for each block were identified to capture the common haplotypes. This study would provide fundamental and useful information for the pharmacogenetic studies of MRP1-dependently effluxed drugs in Japanese.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 We also detected three known nonsynonymous variations, 218CÀT (Thr73Ile), 2168GÀA (Arg723Gln), and 3173GÀA (Arg1058Gln) at frequencies of 0.007, 0.065 and 0.003, respectively. These frequencies were similar to those found in the earlier reports for Japanese11) and Chinese.21) One of the variations, Arg723Gln, leads to reduced transport activities for LTC4, estradiol 17b-glucuronide and methotrexate.12) We did not detect three previously reported variations: 2012GÀT (Gly671Val; found with approximately 0.03 frequency in Caucasians), 3140GÀC (Cys1047Ser; 0.05 in African-Americans), and 4535CÀT (Ser1512Leu; 0.03 in Caucasians).8,9,12) These SNPs might be ethnic- specic. Login to comment
109 In Block 1 (Table 3), 4 haplotype groups (*1 to *4) were inferred, and the *2 to *4 groups were represented by the nonsynonymous variations, 218CÀT (Thr73Ile) (*2), 726GÀT (Trp242Cys) (*3), and 1199TÀC (Ile400Thr) (*4). Login to comment
113 In addition to these 8 htSNPs, 3 nonsynonymous variations, 218CÀT (Thr73Ile), 726GÀT (Trp242Cys), and 1199TÀC (Ile400Thr) may be included in the htSNPs in order to detect *2 to *4 haplotypes because they might have the functional signicance. Login to comment

[hide] Multidrug resistance associated proteins as determ... Curr Drug Metab. 2007 Dec;8(8):787-802. Yu XQ, Xue CC, Wang G, Zhou SF
Multidrug resistance associated proteins as determining factors of pharmacokinetics and pharmacodynamics of drugs.
Curr Drug Metab. 2007 Dec;8(8):787-802., [PMID:18220559]

Abstract [show]
The multidrug resistance associated proteins (MRP1, MRP2, MRP3, MRP4, MRP5, MRP6, MRP7, MRP8 and MRP9) belong to the ATP-binding cassette superfamily (ABCC family) of transporters. They are expressed differentially in the liver, kidney, intestine, brain and other tissues. These transporters are localized to the apical and/or basolateral membrane of the hepatocytes, enterocytes, renal proximal tubule cells and endothelial cells of the blood-brain barrier. Several MRPs (mainly MRP1-3) are associated with tumor resistance which is often caused by an increased efflux and decreased intracellular accumulation of natural product anticancer drugs and other anticancer agents. MRPs transport a structurally diverse array of important endogenous substances and xenobiotics and their metabolites (in particular conjugates) with different substrate specificity and transport kinetics. Most MRPs are subject to induction and inhibition by a variety of compounds. Several nuclear receptors, including pregnane X receptor (PXR), liver X receptor (LXR), and farnesoid receptor (FXR) participate in the regulation of MRPs. MRPs play an important role in the absorption, distribution and elimination of various drugs in the body and thus may affect their efficacy and toxicity and cause drug-drug interactions. MRPs located in the blood-brain barrier can restrict the penetration of compounds into the central nervous system. Mutation of MRP2 causes Dubin-Johnson syndrome, while mutations in MRP6 are responsible for pseudoxanthoma elasticum. More recently, mutations in mouse Mrp6/Abcc6 gene is associated with dystrophic cardiac calcification (DCC), a disease characterized by hydroxyapatite deposition in necrotic myocytes. A single nucleotide polymorphism, 538G>A in the MRP8/ABCC11 gene, is responsible for determination of earwax type. A better understanding of the function and regulating mechanism of MRPs can help minimize and avoid drug toxicity, unfavourable drug-drug interactions, and to overcome drug resistance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
405 Important Single Nucleotide Polymorphisms (SNPs) of MRP Genes MRP Chromosomal location Amino acid variation Nucleotide variation Location References Cys43Ser Thr73Ile G128C C218T Exon2 Exon2 [239] Arg433Ser G1299T Exon10 [258] Gly671Val G2012T Exon16 [259] Arg723Gln G2168A Exon17 [239] MRP1 16p13.11-p13.12 Arg1058Gln G3173A Exon23 [239] C-24T Promoter [100, 239] Val417Ile G1249A Exon10 [100, 238, 239] Gly676Arg G2026C Exon16 [237] Try709Arg T2125C Exon17 [236] Arg768Trp Ser789Phe C2302T C2366T Exon18 Exon18 [100, 238, 239] I1173F R1150H A3517T G3449A Exon25 Exon25 [240] Ile1324Ile C3972T Exon28 [100, 239] MRP2 10q23-24 Ala1450Thr G4348A Exon31 [100, 238, 239] (Table 2) contd…. Login to comment

[hide] Characterization and analyses of multidrug resista... Pharmacogenet Genomics. 2009 Mar;19(3):206-16. Yin JY, Huang Q, Yang Y, Zhang JT, Zhong MZ, Zhou HH, Liu ZQ
Characterization and analyses of multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphisms in Chinese population.
Pharmacogenet Genomics. 2009 Mar;19(3):206-16., [PMID:19214144]

Abstract [show]
OBJECTIVE: To explore the distribution frequencies of four common single nucleotide polymorphisms (SNPs) of MRP1/ABCC1 in a mainland Chinese population and investigate whether these SNPs affect the expression and function of the MRP1/ABCC1. METHODS: The genotype of 208 healthy volunteers was determined using PCR-restriction fragment length polymorphism. The four candidated SNPs were recreated by site-directed mutagenesis and tested for their effect on MRP1/ABCC1 expression and multidrug resistance function in stable transfected HEK293 and CHO-K1 cell lines. Real-time PCR, western blot and confocal microscopy were used to determine the mRNA, protein expression, and protein trafficking. At last, the effect of mutations on MRP1/ABCC1-mediate drug resistance was determined using methyl thiazolyl tetrazolium assay. RESULTS: The allelic frequencies of Cys43Ser (128G>C), Thr73Ile (218C>T), Arg723Gln (2168G>A), and Arg1058Gln (3173G>A) in mainland Chinese were 0.5, 1.4, 5.8, and 0.5%, respectively. None of these mutations had any effect on MRP1/ABCC1 expression and trafficking, but that Arg723Gln mutation significantly reduced MRP1/ABCC1-mediated resistance to daunorubicin, doxorubicin, etoposide, vinblastine, and vincristine. The Cys43Ser mutation did not affect all tested drug resistance. In contrast, the Thr73Ile mutation reduced resistance to methotrexate and etoposide, whereas the Arg1058Gln mutation increased the response of two anthracycline drugs and etoposide in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells. CONCLUSION: The allelic frequency of the Arg723Gln mutation is relatively higher than other SNPs in mainland Chinese population and therefore this mutation significantly reduces MRP1/ABCC1 activity in multidrug resistance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Results The allelic frequencies of Cys43Ser (128G > C), Thr73Ile (218C > T), Arg723Gln (2168G > A), and Arg1058Gln (3173G > A) in mainland Chinese were 0.5, 1.4, 5.8, and 0.5%, respectively. Login to comment
8 In contrast, the Thr73Ile mutation reduced resistance to methotrexate and etoposide, whereas the Arg1058Gln mutation increased the response of two anthracycline drugs and etoposide in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells. Login to comment
23 The four most common nonsynonymous SNPs in the Asian population are Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations [15,17]. Login to comment
24 While Cys43Ser (128G > C) is located in the first transmembrane (TM), Thr73Ile (218C > T), Arg723Gln (2168G > A) and Arg1058Gln (3173G > A) are located in the first intracellular loop, the first NBD, and the seventh intracellular loop, respectively (Fig. 1a). Login to comment
35 Fig. 1 COOH L0 NBD1 NBD2 NH2 KCFQNTVLVWVPCFYLWACFPFYF TM1(a) CL1 Thr73Ile …AWIQNDSLRENILFGC… NBD1 Arg723Gln * * * * …DLLHSILRSPMSFF… CL7 Arg1058Gln PFYFLYLSRHDRGYIQMTPLNKTK Cys43Ser Cys43Ser Thr73Ile Arg723Gln Arg1058Gln 1 Human Monkey Bovine Dog Mouse Rat Chicken 2 3 4 5 6 7 (b) Location and conservation of the amino acid residues with polymorphisms in multidrug-resistance-associated protein 1 (MRP1/ABCC1). Login to comment
51 Site-directed mutagenesis For site mutagenesis, cassettes containing various domains of MRP1/ABCC1 cDNA were first released from the full-length cDNA by double digestion (Not I/BamH I for Cys43Ser and Thr73Ile mutation; EcoN I/BsmB I for Arg723Gln mutation; and BsmB I/EcoR I for Arg1058Gln mutation), cloned into pGEM-T Easy (Promega), followed by site-directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, USA) with the following primers (the substituted nucleotides are italicized): 50 -TCGTGTGGGTGCCTTGTTTTTACCTCTGGGC-30 (Cys43Ser); 50 -GATGACACCTCTCAACAAAACCAAA ACTGCCTTGGGATTTT-30 (Thr73lle); 50 -GGATTC AGAATGATTCTCTCCAAGAAAACATCCTTTTTGGA TG-30 (Arg723Gln); 50 -GCACAGCATCCTGCGGTCAC CCATGAGCT-30 (Arg1058Gln). Login to comment
62 The real-time PCR was carried Table 1 Primers and PCR condition for determining polymorphisms Polymorphisms Oligonucleotide primers Annealing temperature (1C) Restriction enzyme Cys43Ser (128G > C) F: GGTCCTCGTGTGGGTGCCAT 57.5 Nla III R: TAGAAGAAGGAACTTAGGGTCAACT Thr73Ile (218C > T) F: TCAGATGACACCTCTCAACAGAA 56.7 Hinf I R: CCAGTTTTCACCTCCCACATTAT Arg723Gln (2168G > A) F: GCCTGGATTCAGAATGATTCTCTTC 52.0 Taq I R: TACTGACCTTCTCGCCAATCTCTGT Arg1058Gln (3173G > A) F: TCTGCATTGTGGAGTTTT 53.0 Pst I R: GACGAAGAAGTAGATGAGGC F, forward; R, reverse. Login to comment
96 Genotyping for the Thr73Ile mutation identified 202 CC homozygotes and six CT heterozygotes. Login to comment
97 The frequencies of T and C alleles of the SNP for the Thr73Ile mutation were 1.4 and 98.6%, respectively. Login to comment
101 The genotyping and allelic frequencies of SNPs for Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations are shown in Table 2. Login to comment
102 The distribution of these SNPs in different populations and their comparison are summarized in Table 3. mRNA and protein expression levels of MRP1/ABCC1 mutants To determine whether these SNPs affect MRP1/ABCC1 expression, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations were recreated in MRP1/ABCC1 cDNA by site-directed mutagenesis and transiently transfected into HEK293 and CHO-K1 cells. Login to comment
107 Subcellular localization of wild-type and mutant MRP1/ABCC1 To further determine whether Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations influence the trafficking of MRP1/ABCC1 to the cell surface, we detected the subcellular localization of wild-type and mutant MRP1/ABCC1 in transiently transfected HEK293 and CHO-K1 cells through the process of immunostaining. Login to comment
108 As shown in Fig. 3, strong plasma membrane staining was observed with all cells that are transfected with either wild-type or mutant MRP1/ABCC1, but not in the Table 3 Comparison of distributive frequencies of MRP1/ABCC1 Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln polymorphisms in different ethnic populations Allelic frequency (n) SNPs (nucleic acid substitution) m w Population References NCBI SNP ID Cys43Ser (128G > C) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41395947 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study Thr73Ile (218C > T) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41494447 0 (0/26) 1 (26/26) Japanese [14] 0.037 (2/54) 0.963 (52/54) Chinese [17] 0.014 (1/72) 0.986 (71/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0(0/72) 1 (72/72) Caucasian [15] 0.014 (6/416) 0.986 (410/416) Chinese This study Arg723Gln (2168G > A) 0.073 (7/96) 0.927 (89/96) Japanese [16] rs4148356 0.038 (1/26) 0.962 (25/26) Japanese [14] 0.056(3/54) 0.944 (51/54) Chinese [17] 0 (0/72) 1 (72/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0 (0/72) 1 (72/72) Caucasian [15] 0.058 (24/416) 0.942 (392/416) Chinese* This study Arg1058Gln (3173G > A) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41410450 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study m, mutant; MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism; w, wild-type. Login to comment
112 HEK293 and CHO-K1 cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 followed by preparation of RNAs for quantitative real-time reverse-transcribed PCR analysis of MRP1/ABCC1 R. level (relative level) (a), or preparation of cell lysates for western blot analysis of MRP1/ABCC1 protein level (b). Login to comment
117 HEK293 (a) and CHO-K1 (b) cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1, followed by fixation and immunostaining of MRP1/ABCC1 using MRPr1 antibody and fluorescein isothiocyanate-conjugated secondary antibody. Login to comment
126 HEK293 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment
136 CHO-K1 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment
140 In HEK293 cells, the Thr73Ile mutation was also found to cause less resistance to vincristine and methotrexate (Tables 4 and 5 and Fig. 4). Login to comment
142 Discussion In this study, we identified the allelic frequencies of Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln in a mainland Chinese population. Login to comment
148 In the 208 Chinese volunteers enrolled in this study, few had Cys43Ser, Thr73Ile, and Arg1058Gln polymorphisms. Login to comment
154 However, the frequencies of the Arg723Gln A allele and the Thr73Ile Tallele in the Chinese population were higher than the Caucasians (P < 0.05) of whom these alleles have not been found. Login to comment
177 The selective effect on drug resistance also exists for the Thr73Ile mutation in the first cytoplasmic loop. Login to comment
181 For example, the Thr73Ile mutation decreased vinblastine resistance in CHO-K1 cells, but not in HEK293 cells. Login to comment
184 It is possible that HEK293 cells are able to suppress the Thr73Ile mutation-induced changes in both MRP1/ ABCC1 structure and activity. Login to comment

[hide] Structural and functional properties of human mult... Curr Med Chem. 2011;18(3):439-81. He SM, Li R, Kanwar JR, Zhou SF
Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1).
Curr Med Chem. 2011;18(3):439-81., [PMID:21143116]

Abstract [show]
Multidrug ABC transporters such as P-glycoprotein (P-gp/MDR1/ABCB1) and multidrug resistance protein 1 (MRP1/ABCC1) play an important role in the extrusion of drugs from the cell and their overexpression can be a cause of failure of anticancer and antimicrobial chemotherapy. Recently, the mouse P-gp/Abcb1a structure has been determined and this has significantly enhanced our understanding of the structure-activity relationship (SAR) of mammalian ABC transporters. This paper highlights our current knowledge on the structural and functional properties and the SAR of human MRP1/ABCC1. Although the crystal structure of MRP1/ABCC1 has yet to be resolved, the current topological model of MRP1/ABCC1 contains two transmembrane domains (TMD1 and TMD2) each followed by a nucleotide binding domain (NBD) plus a third NH2-terminal TMD0. MRP1/ABCC1 is expressed in the liver, kidney, intestine, brain and other tissues. MRP1/ABCC1 transports a structurally diverse array of important endogenous substances (e.g. leukotrienes and estrogen conjugates) and xenobiotics and their metabolites, including various conjugates, anticancer drugs, heavy metals, organic anions and lipids. Cells that highly express MRP1/ABCC1 confer resistance to a variety of natural product anticancer drugs such as vinca alkaloids (e.g. vincristine), anthracyclines (e.g. etoposide) and epipodophyllotoxins (e.g. doxorubicin and mitoxantrone). MRP1/ABCC1 is associated with tumor resistance which is often caused by an increased efflux and decreased intracellular accumulation of natural product anticancer drugs and other anticancer agents. However, most compounds that efficiently reverse P-gp/ABCB1-mediated multidrug resistance have only low affinity for MRP1/ABCC1 and there are only a few effective and relatively specific MRP1/ABCC1 inhibitors available. A number of site-directed mutagenesis studies, biophysical and photolabeling studies, SAR and QSAR, molecular docking and homology modeling studies have documented the role of multiple residues in determining the substrate specificity and inhibitor selectivity of MRP1/ABCC1. Most of these residues are located in the TMs of TMD1 and TMD2, in particular TMs 4, 6, 7, 8, 10, 11, 14, 16, and 17, or in close proximity to the membrane/cytosol interface of MRP1/ABCC1. The exact transporting mechanism of MRP1/ABCC1 is unclear. MRP1/ABCC1 and other multidrug transporters are front-line mediators of drug resistance in cancers and represent important therapeutic targets in future chemotherapy. The crystal structure of human MRP1/ABCC1 is expected to be resolved in the near future and this will provide an insight into the SAR of MRP1/ABCC1 and allow for rational design of anticancer drugs and potent and selective MRP1/ABCC1 inhibitors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
816 There are at least 15 naturally occurring mutations identified in MRP1/ABCC1, including Cys43Ser in TM1, Thr73Ile in CL1, Ser92Phe in TM2, Arg230Asn in L0, Val353Met at TM6/TM7 interface, Arg433Ser in TM8, Gly671Val in TM11, Arg723Gln located between the Walker A and Walker B motifs of NBD1, Ala861Thr at NBD1/TM12 interface, Ala989Thr in TM12, Cys1047Ser in TM13, Arg1058Gln in CL7, Val1146Ile in CL7, Thr1337Ala between the Walker A and Walker B motifs of NBD2, and Thr1401Met, and many of them have been found to affect its transport activity [171, 362, 363, 366, 367, 377-384]. Login to comment
820 When Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln were separately transfected in CHO-K1 or HEK293 cells, the cells displayed altered resistance profiles to a panel of anticancer drugs compared to the wild-type [366]. Login to comment
825 In HEK293 cells, the Thr73Ile mutation displayed a lower resistance to vincristine and MTX [366]. Login to comment
828 For example, the frequencies of the Arg723Gln A allele and the Thr73Ile T allele in Chinese population were higher than the Caucasians [366]. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

[hide] Genetic association analysis of transporters ident... Pharmacogenet Genomics. 2012 Jun;22(6):447-65. Grover S, Gourie-Devi M, Bala K, Sharma S, Kukreti R
Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs.
Pharmacogenet Genomics. 2012 Jun;22(6):447-65., [PMID:22565165]

Abstract [show]
OBJECTIVE: The ATP-binding cassette (ABC) superfamily of transporters is known to efflux antiepileptic drugs (AEDs) primarily in the brain, gastrointestinal tract, liver, and kidneys. In addition, they are also known to be involved in estrogen disposition and may modulate seizure susceptibility and drug response. The objective of the present study was to investigate the role of genetic variants from ABC transporters in seizure control in epilepsy patients treated with monotherapy of first-line AEDs for 12 months. METHODS: On the basis of gene coverage and functional significance, a total of 98 single nucleotide polymorphisms from ABCB1, ABCC1, and ABCC2 were genotyped in 400 patients from North India. Of these, 216 patients were eligible for therapeutic assessment. Genetic variants were compared between the 'no-seizures' and the 'recurrent-seizures' groups. Bonferroni corrections for multiple comparisons and adjustment for covariates were performed before assessment of associations. RESULTS: Functionally relevant promoter polymorphisms from ABCC2: c.-1549G>A and c.-1019A>G either considered alone or in haplotype and diplotype combinations were observed for a significant association with seizure control in women (odds ratio>3.5, P<10, power>95%). Further, low protein-expressing CGT and TGT (c.-24C>T, c.1249G>A, c.3972C>T) haplotypes were always observed to be present in combination with the AG (c.-1549G>A, c.-1019A>G) haplotype that was over-represented in women with 'no seizures'. CONCLUSION: The distribution of the associated variants supports the involvement of ABCC2 in controlling seizures in women possibly by lowering of its expression. The biological basis of this finding could be an altered interaction of ABCC2 with AEDs and estrogens. These results necessitate replication in a larger pool of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 - 330-21247T > C Intron 1 0.005 6 rs4148731 chr7:87239329 c.-330 - 8935C > T Intron 1 0.000 7 rs9282564 chr7:87229440 c.61A > G Exon 3 (Asn21Asp) 0.000 8 rs9282565 chr7:87214875 c.239C > A Exon 5 (Ala80Glu) 0.000 9 rs28381826 chr7:87214531 c.286 + 297G > A Intron 5 0.000 10 rs1989830 chr7:87205663 c.287 - 6124C > T Intron 5 0.135 11 rs2520464 chr7:87201086 c.287 - 1547A > G Intron 5 0.409 12 rs2235023 chr7:87190452 c.827+ 127G > A Intron 9 0.000 13 rs10276036 chr7:87180198 c.1000 - 44C > T Intron 10 0.401 14 rs2229109 chr7:87179809 c.1199G > A Exon 12 (Ser400Asn) 0.000 15 rs1128503 chr7:87179601 c.1236T > C Exon 13 (Gly412Gly) 0.390 16 rs2235036 chr7:87175271 c.1795G > A Exon 16 (Ala599Thr) 0.000 17 rs2235039 chr7:87165854 c.2401G > A Exon 21 (Val801Met) 0.000 18 rs2235040 chr7:87165750 c.2481 + 24G > A Intron 21 0.155 19 rs2032581 chr7:87160810 c.2485A > G Exon 22 (Ile829Val) 0.000 20 rs2032582 chr7:87160618 c.2677T/A > G Exon 22 (Ser/Thr893Ala) 0.318 21 rs7779562 chr7:87144816 c.3085 -72G > C Intron 25 0.043 22 rs2707944 chr7:87144641 c.3188C > G Exon 26 (Ala1063Gly) 0.000 23 rs2229107 chr7:87138659 c.3421A > T Exon 27 (Thr1141Ser) 0.000 24 rs1045642 chr7:87138645 c.3435T > C Exon 27 (Ile1145Ile) m Expression and activity [28] m mRNA expression [29] Altered substrate specificity [30] 0.375 25 rs2235048 chr7:87138511 c.3489 + 80C > T Intron 27 0.381 26 rs17064 chr7:87133470 c.3932A > T 30 UTR 0.000 ABCC1 1 rs504348 chr16:16043174 rs50438C > G Near gene region k Promoter activity [31] 0.135 2 rs215106 chr16:16047542 c.48 + 3886A > G Intron 1 0.210 3 rs215049 chr16:16070768 c.48 + 27112G > C Intron 1 0.245 4 rs246220 chr16:16082128 c.49 - 19545C > G Intron 1 0.118 5 rs119774 chr16:16086833 c.49 - 14840G > A Intron 1 0.089 6 rs246217 chr16:16090354 c.49 - 11319C > A Intron 1 0.118 7 rs2014800 chr16:16099966 c.49 - 1707C > T Intron 1 0.398 8 rs41494447 chr16:16101842 c.218C > T Exon 2 (Thr73Ile) 0.000 9 rs4781712 chr16:16103232 c.226 - 401A > G Intron 2 0.355 10 rs246240 chr16:16119024 c.616 -7942A > G Intron 5 0.114 11 rs924135 chr16:16123459 c.616 - 3507A > T Intron 5 0.412 12 rs903880 chr16:16130514 c.809 + 54C > A Intron 7 0.147 13 rs8187852 chr16:16139709 c.1057G > A Exon 9 (Met353Val) 0.000 14 rs35587 chr16:16139714 c.1062T > C Exon 9 (Asn354Asn) 0.182 15 rs35592 chr16:16141823 c.1219 - 176T > C Intron 9 0.172 16 rs60782127 chr16:16142079 c.1299G > T Exon 10 (Arg433Ser) k Transport of leukotriene C4 and estrone sulfate [32] 0.008 17 rs3765129 chr16:16149901 c.1474 - 48C > T Intron 11 0.032 18 rs35597 chr16:16158034 c.1678 - 3979G > A Intron 12 0.320 19 rs35621 chr16:16168608 c.1913 - 1575C > T Intron 14 0.103 20 rs45511401 chr16:16173232 c.2012G > T Exon 16 (Gly671Val) 0.024 21 rs4148356 chr16:16177275 c.2168G > A Exon 17 (Arg723Gln) 0.000 22 rs3851713 chr16:16184873 c.2644 + 428A > T Intron 19 0.340 23 rs2239995 chr16:16192565 c.2645 - 3919G > A Intron 19 0.324 24 rs11864374 chr16:16201885 c.2871 + 1155G > A Intron 21 0.338 25 rs35529209 chr16:16205325 c.2965G > A Exon 22 (Thr989Ala) k Transport of estradiol 17b-glucuronide [32] 0.000 26 rs3887893 chr16:16205501 c.3079 + 62G > A Intron 22 0.448 27 rs13337489 chr16:16208683 c.3140G > C Exon 23 (Ser1047Cys) 0.000 28 rs2299670 chr16:16220858 c.3819 + 1090A > G Intron 26 0.399 29 rs8057331 chr16:16230411 c.4202C > T Exon 29 (Thr1401Met) 0.000 30 rs212090 chr16:16236004 c.5462T > A 30 UTR 0.357 31 rs212093 chr16:16237754 rs212093G > A Near gene region 0.429 32 rs4148382 chr16:16238494 rs4148382G > A Near gene region 0.034 ABCC2 1 g.-1774G > delG chr10:101535688 g.-1774G > delG Near gene region k Promoter activity [33] 0.000 2 rs1885301 chr10:101541053 c.-1549G > A Near gene region k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k Clearance of irinotecan (ABCC2*2 containing the G allele) [34] 0.379 450 Pharmacogenetics and Genomics 2012, Vol 22 No 6 Table 2 (continued) N dbSNP ida Positionb Allelesc Gene location (effect) Function MAF 3 rs2804402 chr10:101541583 c. Login to comment

[hide] Importance of ABCC1 for cancer therapy and prognos... Drug Metab Rev. 2014 Aug;46(3):325-42. doi: 10.3109/03602532.2014.901348. Epub 2014 Mar 26. Kunicka T, Soucek P
Importance of ABCC1 for cancer therapy and prognosis.
Drug Metab Rev. 2014 Aug;46(3):325-42. doi: 10.3109/03602532.2014.901348. Epub 2014 Mar 26., [PMID:24670052]

Abstract [show]
Multidrug resistance presents one of the most important causes of cancer treatment failure. Numerous in vitro and in vivo data have made it clear that multidrug resistance is frequently caused by enhanced expression of ATP-binding cassette (ABC) transporters. ABC transporters are membrane-bound proteins involved in cellular defense mechanisms, namely, in outward transport of xenobiotics and physiological substrates. Their function thus prevents toxicity as carcinogenesis on one hand but may contribute to the resistance of tumor cells to a number of drugs including chemotherapeutics on the other. Within 48 members of the human ABC superfamily there are several multidrug resistance-associated transporters. Due to the well documented susceptibility of numerous drugs to efflux via ABC transporters it is highly desirable to assess the status of ABC transporters for individualization of treatment by their substrates. The multidrug resistance associated protein 1 (MRP1) encoded by ABCC1 gene is one of the most studied ABC transporters. Despite the fact that its structure and functions have already been explored in detail, there are significant gaps in knowledge which preclude clinical applications. Tissue-specific patterns of expression and broad genetic variability make ABCC1/MRP1 an optimal candidate for use as a marker or member of multi-marker panel for prediction of chemotherapy resistance. The purpose of this review was to summarize investigations about associations of gene and protein expression and genetic variability with prognosis and therapy outcome of major cancers. Major advances in the knowledge have been identified and future research directions are highlighted.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 Letourneau et al. (2005) studied the influence of 10 DOI: 10.3109/03602532.2014.901348 ABCC1 and cancer therapy and prognosis non-synonymous SNPs - Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Arg723Gln (G2168A, rs4148356), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450) and Ser1512Leu (C4535T, rs369410659) - on ABCC1 expression using membrane vesicles isolated from transfected cells and assessed transport activity for three known ABCC1 substrates. Login to comment
159 NCBI ID Reference Amino acid exchange Nucleotide exchange Location Function MAFa rs41395947 Cys43Ser G128C Exon 2 Non-synonymous Unknown rs41494447 Thr73Ile C218T Exon 2 Non-synonymous T &#bc; 0.003 rs8187844 Ser92Phe C257T Exon 3 Non-synonymous T &#bc; 0.004 rs8187848 Arg230Gln G689A Exon 7 Non-synonymous A &#bc; 0.009 rs2230669 Pro272Pro G816A Exon 8 Synonymous A &#bc; 0.037 rs246221 Val275Val T825C Exon 8 Synonymous C &#bc; 0.301 rs35592 non-coding T-176C Intron 9 Non-coding C &#bc; 0.257 rs60782127 Arg433Ser G1299T Exon 10 Non-synonymous T &#bc; 0.004 rs35605 Leu562Leu T1684C Exon 13 Synonymous T &#bc; 0.173 rs112282109 Arg633Gln G1898A Exon 14 Non-synonymous A &#bc; 0.004 rs45511401 Gly671Val G2012T Exon 16 Non-synonymous T &#bc; 0.050 rs4148356 Arg723Gln G2168A Exon17 Non-synonymous A &#bc; 0.027 rs35529209 Ala989Thr G2965A Exon 22 Non-synonymous Unknown rs13337489 Cys1047Ser G3140C Exon 23 Non-synonymous C &#bc; 0.000 rs41410450 Arg1058Gln G3173A Exon 23 Non-synonymous Unknown rs2238476 non-coding G-1960A Intron 23 Non-coding T &#bc; 0.062 rs2230671 Ser1334Ser G4002A Exon 28 Synonymous T &#bc; 0.208 rs28364006 Thr1337Ala A4009G Exon 28 Non-synonymous Unknown rs369410659 Ser1512Leu C4535T Exon 31 Non-synonymous Unknown a Minor allele frequencies for Caucasinans in dbSNP based on HapMap-CEU population or 1000 genomes. Login to comment

[hide] Non-coding polymorphisms in nucleotide binding dom... PLoS One. 2014 Jul 31;9(7):e101740. doi: 10.1371/journal.pone.0101740. eCollection 2014. Kunicka T, Vaclavikova R, Hlavac V, Vrana D, Pecha V, Raus K, Trnkova M, Kubackova K, Ambrus M, Vodickova L, Vodicka P, Soucek P
Non-coding polymorphisms in nucleotide binding domain 1 in ABCC1 gene associate with transcript level and survival of patients with breast cancer.
PLoS One. 2014 Jul 31;9(7):e101740. doi: 10.1371/journal.pone.0101740. eCollection 2014., [PMID:25078270]

Abstract [show]
OBJECTIVES: ATP-Binding Cassette (ABC) transporters may cause treatment failure by transporting of anticancer drugs outside of the tumor cells. Multidrug resistance-associated protein 1 coded by the ABCC1 gene has recently been suggested as a potential prognostic marker in breast cancer patients. This study aimed to explore tagged haplotype covering nucleotide binding domain 1 of ABCC1 in relation with corresponding transcript levels in tissues and clinical phenotype of breast cancer patients. METHODS: The distribution of twelve ABCC1 polymorphisms was assessed by direct sequencing in peripheral blood DNA (n = 540). RESULTS: Tumors from carriers of the wild type genotype in rs35623 or rs35628 exhibited significantly lower levels of ABCC1 transcript than those from carriers of the minor allele (p = 0.003 and p = 0.004, respectively). The ABCC1 transcript levels significantly increased in the order CT-GT>CC-GT>CC-GG for the predicted rs35626-rs4148351 diplotype. Chemotherapy-treated patients carrying the T allele in rs4148353 had longer disease-free survival than those with the GG genotype (p = 0.043). On the other hand, hormonal therapy-treated patients with the AA genotype in rs35628 had significantly longer disease-free survival than carriers of the G allele (p = 0.012). CONCLUSIONS: Taken together, our study shows that genetic variability in the nucleotide binding domain 1 has a significant impact on the ABCC1 transcript level in the target tissue and may modify survival of breast cancer patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
215 Ten other non-synonymous SNPs leading to amino acid substitutions (Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450), and Ser1512Leu (C4535T, rs369410659)) followed earlier had no effect on ABCC1 expression either, indicating that single amino acid substitutions may not necessarily influence the activity of the final protein [44]. Login to comment