ABCMdb

PMID: 18430864

Liu Y, Yang Y, Qi J, Peng H, Zhang JT
Effect of cysteine mutagenesis on the function and disulfide bond formation of human ABCG2.
J Pharmacol Exp Ther. 2008 Jul;326(1):33-40. Epub 2008 Apr 22., [PubMed]

Sentences

No. Mutations Sentence Comment

37 ABCG2 p.Arg482Thr ABCG2 p.Arg482Gly It is interesting to note that two nonsynonymous mutations, R482G and R482T, resulted in the ability of ABCG2 to transport substrates, such as rhodamine 123, which cannot be transported by the wild-type isoform (Han and Zhang, 2004). Login to comment 108 ABCG2 p.Cys374Ala ABCG2 p.Cys284Ala To map which of the three cysteine residues are functionally important, we engineered four more constructs by mutating all or partial of the three cysteines Cys284, Cys374, and Cys438 to alanines and generated constructs I3-CL, I2-CL, C284A, and C374A (see Fig. 5A). Login to comment 111 ABCG2 p.Cys592Ala ABCG2 p.Cys603Ala ABCG2 p.Cys608Ala ABCG2 p.Cys55Ala ABCG2 p.Cys374Ala ABCG2 p.Cys374Ala ABCG2 p.Cys284Ala ABCG2 p.Cys284Ala ABCG2 p.Cys635Ala ABCG2 p.Cys438Ala ABCG2 p.Cys43Ala ABCG2 p.Cys544Ala ABCG2 p.Cys119Ala ABCG2 p.Cys491Ala Mutation of one or two of these residues (I2-CL, C284A, and C374A) did not signifi- TABLE 1 Primers used for construction of cysless mutants Mutations Primer Sequence RESa C43A TTTCATAACATTGCCTATCGAGTAAAACTGAAG BsrDI C55A GCTTTCTACCTGCACGAAAACCAGTTGAG BsgI C119A GCCAATTTCAAAGCGAATTCAGGTTACGTGG EcoRI C284A GAATCAGCTGGATATCACGCTGAGGCCTATAATAAC EcoRV C374A ACACCACCTCCTTCGCTCATCAACTCAGATG None C438A CTGACGACCAACCAAGCTTTCAGCAGTGTTTC HindIII C491A TATATTTACCGCTATAGTATACTTCATGTTAGG AccI C544A CTTCTCATGACGATCGCTTTTGTGTTTATGATG PvuI C592A GGACAAAACTTCGCCCCGGGACTCAATGCAA SmaI C603A/C608A AGGAAACAATCCTGCTAACTATGCAACAGCTACTGGCGAAGAATATTT -NspI C635A CACGTGGCCTTGGCTGCAATGATTGTTATTTTC BsrDI a Restriction (RES) enzyme digestion sites engineered in the primer for the convenience of detection. Login to comment 112 ABCG2 p.Cys603Ala ABCG2 p.Cys608Ala The primer sequence for the C603A/C608A mutant does not contain the NspI site present in the wild-type sequence. Login to comment 114 ABCG2 p.Cys374Ala ABCG2 p.Cys284Ala ABCG2 p.Cys438Ala I3-CL with C284A, C374A, and C438A mutations also lost most of its ability to transport another substrate, Hoechst 33342 (Fig. 5D). Login to comment 131 ABCG2 p.Cys592Ala ABCG2 p.Cys603Ala ABCG2 p.Cys608Ala To test this hypothesis, we engineered another construct that has all three cysteine residues in the third extracellular loop mutated to alanine (C592A, C603A, and C608A) to determine whether dimers linked by intermolecular disulfide bonds exist with this mutant. Login to comment 145 ABCG2 p.Cys284Ala To test this possibility, we studied other mutant I2-CL, C284A, and I3-CL using the nonreducing SDS-PAGE. As shown in Fig. 6C, the mutant I3-CL had a single dimeric ABCG2R482G band of fast mobility on the nonreducing SDS-PAGE (Fig. 6C, lane 8), similar to the I5-CL mutant (see Fig. 6B). Login to comment 146 ABCG2 p.Cys284Ala However, the mutant C284A had an additional dimeric band of medium mobility, whereas the I2-CL has an additional dimeric band of slow mobility (Fig. Fig. 5. Login to comment 150 ABCG2 p.Cys374Ala ABCG2 p.Cys374Ala ABCG2 p.Cys284Ala ABCG2 p.Cys284Ala ABCG2 p.Cys438Ala C, relative activity of mutant ABCG2R482G I2-CL, C284A, I3-CL, and C374A compared with wild-type and ABCG2R482G as determined using flow cytometry for mitoxantrone (MX) accumulation in Sf9 cells. Data shown are from three independent experiments with S.D. D, effect of C284A, C374A, and C438A mutations (construct I3-CL) on efflux of Hoechst 33342 (Hoechst) as determined using flow cytometry. Login to comment 154 ABCG2 p.Cys284Ala B, nonreducing and reducing SDS-PAGE of wild-type and cysteine-mutant ABCG2R482G CL, C9-CL, I5-CL, and C4-CL. C, nonreducing SDS-PAGE of cysteine-mutant ABCG2R482G constructs L3-CL, I2-CL, C284A, and I3-CL compared with wild-type and CL mutant. Login to comment 157 ABCG2 p.Cys284Ala Because the mutant construct C284A has the wild-type Cys374 and Cys438 residues and both mutants I2-CL and I3-CL have these two cysteine residues mutated, it is possible that these two cysteines are involved in the formation of intramolecular disulfide bonds that result in the dimeric protein of medium mobility on nonreducing SDS-PAGE. Login to comment 169 ABCG2 p.Cys374Ala ABCG2 p.Cys284Ala The observation that the single mutation of these two cysteine residues (C284A and C374A) did not substantially affect ABCG2R482G activity confirms the fact that their mutations did not severely influence the nucleotide-binding activity. Login to comment 171 ABCG2 p.Cys438Ala Mutation of Cys438 to alanine along with Cys374 (construct I2-CL) did not affect ABCG2R482G activity. Login to comment 172 ABCG2 p.Cys438Ala C438A mutation alone also did not affect ABCG2R482G function (Kage et al., 2005). Login to comment