ABCG2 p.Cys491Ala
| Predicted by SNAP2: | A: N (72%), D: D (80%), E: D (80%), F: D (63%), G: D (53%), H: D (71%), I: N (57%), K: D (85%), L: N (53%), M: D (53%), N: D (66%), P: D (80%), Q: D (80%), R: D (85%), S: N (78%), T: N (66%), V: N (57%), W: D (91%), Y: D (75%), |
| Predicted by PROVEAN: | A: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Effect of cysteine mutagenesis on the function and... J Pharmacol Exp Ther. 2008 Jul;326(1):33-40. Epub 2008 Apr 22. Liu Y, Yang Y, Qi J, Peng H, Zhang JT
Effect of cysteine mutagenesis on the function and disulfide bond formation of human ABCG2.
J Pharmacol Exp Ther. 2008 Jul;326(1):33-40. Epub 2008 Apr 22., [PMID:18430864]
Abstract [show]
ABCG2 is a member of the ATP-binding cassette (ABC) transporter superfamily. Its overexpression causes multidrug resistance in cancer chemotherapy. Based on its apparent half size in sequence when compared with other traditional ABC transporters, ABCG2 has been thought to exist and function as a homodimer linked by intermolecular disulfide bonds. However, recent evidence suggests that ABCG2 may exist as a higher form of oligomers due to noncovalent interactions. In this study, we attempted to create a cysless mutant ABCG2 as a tool for further characterization of this molecule. However, we found that the cysless mutant ABCG2 is well expressed but not functional. Mapping of the cysteine residues showed that three cysteine residues (Cys284, Cys374, and Cys438) are required concurrently for the function of ABCG2 and potentially for intramolecular disulfide bond formation. We also found that the cysteine residues (Cys592, Cys603, and Cys608) in the third extracellular loop are involved in forming intermolecular disulfide bonds and that mutation of these residues does not affect the expression or drug transport activity of human ABCG2. Thus, we conclude that Cys284, Cys374, and Cys438, which may be involved in intramolecular disulfide bond formation, are concurrently required for ABCG2 function, whereas Cys592, Cys603, and Cys608, potentially involved in intermolecular disulfide bond formation, are not required.
Comments [show]
None has been submitted yet.
No. Sentence Comment
111 Mutation of one or two of these residues (I2-CL, C284A, and C374A) did not signifi- TABLE 1 Primers used for construction of cysless mutants Mutations Primer Sequence RESa C43A TTTCATAACATTGCCTATCGAGTAAAACTGAAG BsrDI C55A GCTTTCTACCTGCACGAAAACCAGTTGAG BsgI C119A GCCAATTTCAAAGCGAATTCAGGTTACGTGG EcoRI C284A GAATCAGCTGGATATCACGCTGAGGCCTATAATAAC EcoRV C374A ACACCACCTCCTTCGCTCATCAACTCAGATG None C438A CTGACGACCAACCAAGCTTTCAGCAGTGTTTC HindIII C491A TATATTTACCGCTATAGTATACTTCATGTTAGG AccI C544A CTTCTCATGACGATCGCTTTTGTGTTTATGATG PvuI C592A GGACAAAACTTCGCCCCGGGACTCAATGCAA SmaI C603A/C608A AGGAAACAATCCTGCTAACTATGCAACAGCTACTGGCGAAGAATATTT -NspI C635A CACGTGGCCTTGGCTGCAATGATTGTTATTTTC BsrDI a Restriction (RES) enzyme digestion sites engineered in the primer for the convenience of detection.
X
ABCG2 p.Cys491Ala 18430864:111:440
status: VERIFIED