ABCG8 p.Met429Val
| Predicted by SNAP2: | A: D (63%), C: N (57%), D: D (85%), E: D (85%), F: N (66%), G: D (80%), H: D (75%), I: N (72%), K: D (85%), L: N (93%), N: D (80%), P: D (85%), Q: N (53%), R: D (85%), S: D (71%), T: D (66%), V: N (78%), W: D (80%), Y: D (75%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: N, G: D, H: D, I: N, K: D, L: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: N, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] ATP-binding cassette transporter G8 M429V polymorp... Clin Sci (Lond). 2005 Aug;109(2):183-8. Miwa K, Inazu A, Kobayashi J, Higashikata T, Nohara A, Kawashiri M, Katsuda S, Takata M, Koizumi J, Mabuchi H
ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects.
Clin Sci (Lond). 2005 Aug;109(2):183-8., [PMID:15816807]
Abstract [show]
The ratio of serum plant sterols to cholesterol is positively correlated with the fractional cholesterol absorption, whereas serum precursors of cholesterol synthesis are positively correlated with cholesterol synthesis. Recently, two ABC (ATP-binding cassette) transporters, ABCG5 and ABCG8, have been described as playing an important role in the absorption and excretion of sterols. In the present study, we tested the hypothesis that genetic variation in ABCG5/ABCG8 influences the levels of serum plant sterol (sitosterol) and cholesterol precursor (lathosterol) in Japanese primary hypercholesterolaemic patients (n = 100). We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)]. In carriers of the novel M429V variant, the serum level of sitosterol and the sitosterol/cholesterol ratio were significantly higher than those in non-carriers (3.64 compared with 2.56 microg/ml, and 1.45 microg/mg compared with 1.00 microg/mg respectively; P < 0.01 for both), and serum lathosterol tended to be lower (1.95 microg/ml compared with 3.03 microg/ml; P = 0.08), whereas no significant difference was observed in other lipid profiles. These four polymorphisms (1810C/G, 161G/A, 1199C/A and 1285A/G) generated six haplotypes, and the C/G/C/G haplotype was significantly associated with a higher sitosterol level and sitosterol/cholesterol ratio compared with the other five haplotypes (P < 0.05 for both). We conclude that, in 8% of patients with hypercholesterolaemia, the novel ABCG8 M429V variant was associated with higher cholesterol absorption efficiency. Future studies should investigate whether these findings have implications for the optimal cholesterol-lowering drug treatment in hypercholesterolaemic patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
3 We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)].
X
ABCG8 p.Met429Val 15816807:3:83
status: VERIFIED14 Nucleotide Annealing Position Mutation change* Forward primer (5 → 3 ) Reverse primer (5 → 3 ) temperature (◦ C) Enzyme Size (bp) ABCG5 Exon 7 C287R 859T → C TCACACACTAACTACCTTCTGTTGTC ATGATGGGGAATGTGAAAGAAA 54 BstUI 191 Exon 13 Q604E 1810C → G ATCTAGATTCACAATGAACTTTCTA GTCCCTGCAAGTTGTAAGAG 53 XhoI 193 ABCG8 Exon 2 C54Y 161G → A GGAGGTCAGAGACCTCAAgT GCCCACCCTTTTATTTCCAC 56 RsaI 107 Exon 8 T400K 1199C → A ACACCTGTGTGGAAAGGTAAGGT GCGGGTTCAGTAATAAAATGACAG 57 MseI 216 Exon 9 M429V 1285A → G ATGCTGTTGCCTCAGCATCT AAGCTGTGTTCCTCTGAGCT 56 Tsp45I 306 Exon 13 A632V 1895C → T ATGTCTGTGTCTCCAGATCCTCAGgG TACAGGACCATGAAGCCACCGCTGAcGCC 63 HaeIII 105 sterols to cholesterol are known to be positively related to cholesterol absorption and negatively to cholesterol synthesis [1-4].
X
ABCG8 p.Met429Val 15816807:14:522
status: NEW47 Genotype and allele frequencies A novel mutation of C287R and five SNPs (single nucleotide polymorphisms) (including a novel one ABCG8 M429V) were genotyped in our subjects.
X
ABCG8 p.Met429Val 15816807:47:135
status: VERIFIED48 Frequency distributions for the genotypes in exon 7 (C287R) and exon 13 (Q604E) of ABCG5, and in exon 2 (C54Y), exon 8 (T400K), exon 9 (M429V) and exon 13 (A632V) of ABCG8 are shown in Table 3.
X
ABCG8 p.Met429Val 15816807:48:136
status: VERIFIED51 Parameters Value Age (years) 62.4 +- 12.1 Gender (men/women) 48/52 BMI (kg/m2 ) 23.0 +- 3.5 Total cholesterol (mg/dl) 261 +- 48 Triacylglycerol (mg/dl) 135 +- 69 HDL-C (mg/dl) 56 +- 16 LDL-C (mg/dl) 179 +- 48 Sitosterol (µg/ml) 2.63 +- 1.0 Lathosterol (µg/ml) 3.00 +- 1.3 Table 3 Genotype distribution and allele frequencies of the polymorphisms in the ABCG5/ABCG8 gene Gene Mutation Nucleotide change Polymorphism Allele frequency ABCG5 Exon 7 C287R 859T → C T 0.99 C 0.01 Exon 13 Q604E 1810C → G C 0.89 G 0.11 ABCG8 Exon 2 C54Y 161G → A G 0.82 A 0.18 Exon 8 T400K 1199C → A C 0.88 A 0.12 Exon 9 M429V 1285A → G A 0.96 G 0.04 Exon 13 A632V 1895C → T C 0.995 T 0.005 found and the A632V variant was rare in our Japanese subjects.
X
ABCG8 p.Met429Val 15816807:51:635
status: VERIFIED57 Sitosterol Lathosterol Sitosterol/chol Polymorphism Genotype n (µg/ml) P value (µg/ml) P value (µg/mg) P value Lathosterol/chol (µg/mg) P value ABCG5 Exon 13 Q604E (1810C → G) QQ 78 2.63 +- 1.06 0.81 2.97 +- 1.36 0.73 1.03 +- 0.3 0.97 1.19 +- 0.55 0.84 QE 21 2.69 +- 0.72 3.09 +- 1.12 1.03 +- 0.40 1.16 +- 0.38 EE 1 1.2 3.2 0.6 1.57 ABCG8 Exon 2 C54Y (161G → A) CC 67 2.69 +- 0.98 0.19 2.82 +- 1.11 0.06 1.05 +- 0.36 0.06 1.12 +- 0.45 0.2 CY 30 2.57 +- 1.06 3.20 +- 1.33 1.02 +- 0.43 1.27 +- 0.57 YY 3 1.93 +- 0.31 4.23 +- 3.17 0.65 +- 0.12 1.38 +- 0.98 ABCG8 Exon 8 T400K (1199C → A) TT 76 2.64 +- 0.98 0.85 2.87 +- 1.10 0.14 1.03 +- 0.37 0.96 1.14 +- 0.45 0.17 TK 24 2.60 +- 1.07 3.34 +- 1.70 1.03 +- 0.44 1.31 +- 0.66 KK 0 ABCG8 Exon 9 M429V (1285A → G) MM 92 2.56 +- 0.94 0.003 3.03 +- 1.30 0.08 1.00 +- 0.36 0.002 1.19 +- 0.51 0.16 MV 8 3.64 +- 1.26 1.95 +- 0.53 1.45 +- 0.56 0.84 +- 0.36 VV 0 Table 5 Effect of the four polymorphism haplotypes in the ABCG5/ABCG8 gene on serum non-cholesterol levels Values are means +- S.D. The haplotype effects on serum non-cholesterol levels were assigned in all individuals using PHASE in 94 individuals.
X
ABCG8 p.Met429Val 15816807:57:780
status: VERIFIEDX
ABCG8 p.Met429Val 15816807:57:801
status: NEW67 Of the 16 possible four-polymorphism haplotypes [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1285A/G (M429V)], six haplotypes were estimated to be present.
X
ABCG8 p.Met429Val 15816807:67:110
status: VERIFIED70 DISCUSSION The main findings of the present study performed in Japanese hypercholesterolaemic subjects are as follows: (i) two novel mutants or polymorphisms, C287R in ABCG5 and M429V in ABCG8, have been identified, and (ii) the M429V polymorphism is positively associated with serum sitosterol and sitosterol/cholesterol levels, whereas the other three polymorphisms are not associated with serum non-cholesterol levels.
X
ABCG8 p.Met429Val 15816807:70:178
status: VERIFIEDX
ABCG8 p.Met429Val 15816807:70:229
status: VERIFIED4 In carriers of the novel M429V variant, the serum level of sitosterol and the sitosterol/cholesterol ratio were significantly higher than those in non-carriers (3.64 compared with 2.56 µg/ml, and 1.45 µg/mg compared with 1.00 µg/mg respectively; P < 0.01 for both), and serum lathosterol tended to be lower (1.95 µg/ml compared with 3.03 µg/ml; P = 0.08), whereas no significant difference was observed in other lipid profiles.
X
ABCG8 p.Met429Val 15816807:4:25
status: VERIFIED6 We conclude that, in 8% of patients with hypercholesterolaemia, the novel ABCG8 M429V variant was associated with higher cholesterol absorption efficiency.
X
ABCG8 p.Met429Val 15816807:6:80
status: VERIFIED55 The novel M429V variant of ABCG8 was found to be positively associated with both higher sitosterol concentrations and their ratio to cholesterol (P < 0.01 for both).
X
ABCG8 p.Met429Val 15816807:55:10
status: VERIFIED74 Among the four polymorphisms examined, only the M429V variant was significantly associated with sitosterol concentration and its ratio to cholesterol.
X
ABCG8 p.Met429Val 15816807:74:48
status: VERIFIED93 In the present study, the novel M429V variant may have similar therapeutic implications of statins.
X
ABCG8 p.Met429Val 15816807:93:32
status: VERIFIED94 Finally, we did not find a specific ABCG5/ABCG8 haplotype that was more significantly associated with non-cholesterol sterol concentrations than the M429V variant alone.
X
ABCG8 p.Met429Val 15816807:94:149
status: VERIFIED95 This strongly suggests that the novel M429V variant itself, or another as yet undefined linked variant, has functional significance.
X
ABCG8 p.Met429Val 15816807:95:38
status: VERIFIED96 In terms of putative topology, M429V is predicted to be located in the first transmembrane domain of an N-terminal site.
X
ABCG8 p.Met429Val 15816807:96:31
status: VERIFIED97 From this point of view, the M429V variant is the marker rather than the cause of higher serum sitosterol concentration.
X
ABCG8 p.Met429Val 15816807:97:29
status: VERIFIED98 In conclusion, in 8% of Japanese patients with primary hypercholesterolaemia, the novel ABCG8 M429V variant is associated with higher serum sitosterol concentrations (probably due to higher cholesterol absorption efficiency), whereas no relationships with serum lipid concentrations are observed under dietary restriction.
X
ABCG8 p.Met429Val 15816807:98:94
status: VERIFIED[hide] A detailed Hapmap of the Sitosterolemia locus span... BMC Med Genet. 2006 Feb 28;7:13. Pandit B, Ahn GS, Hazard SE, Gordon D, Patel SB
A detailed Hapmap of the Sitosterolemia locus spanning 69 kb; differences between Caucasians and African-Americans.
BMC Med Genet. 2006 Feb 28;7:13., [PMID:16507104]
Abstract [show]
BACKGROUND: Sitosterolemia is an autosomal recessive disorder that maps to the sitosterolemia locus, STSL, on human chromosome 2p21. Two genes, ABCG5 and ABCG8, comprise the STSL and mutations in either cause sitosterolemia. ABCG5 and ABCG8 are thought to have evolved by gene duplication event and are arranged in a head-to-head configuration. We report here a detailed characterization of the STSL in Caucasian and African-American cohorts. METHODS: Caucasian and African-American DNA samples were genotypes for polymorphisms at the STSL locus and haplotype structures determined for this locus RESULTS: In the Caucasian population, 13 variant single nucleotide polymorphisms (SNPs) were identified and resulting in 24 different haplotypes, compared to 11 SNPs in African-Americans resulting in 40 haplotypes. Three polymorphisms in ABCG8 were unique to the Caucasian population (E238L, INT10-50 and G575R), whereas one variant (A259V) was unique to the African-American population. Allele frequencies of SNPs varied also between these populations. CONCLUSION: We confirmed that despite their close proximity to each other, significantly more variations are present in ABCG8 compared to ABCG5. Pairwise D' values showed wide ranges of variation, indicating some of the SNPs were in strong linkage disequilibrium (LD) and some were not. LD was more prevalent in Caucasians than in African-Americans, as would be expected. These data will be useful in analyzing the proposed role of STSL in processes ranging from responsiveness to cholesterol-lowering drugs to selective sterol absorption.
Comments [show]
None has been submitted yet.
No. Sentence Comment
27 In this paper, we report the detailed characterization of the SNPs present at the STSL in Caucasians drawn from Table 1: Polymorphisms reported at the STSL locus Name Position in the gene Polymorphism dbSNP cluster ID Restriction enzyme site altered Nucleotide Position ABCG5 P9P Exon 1 C/T rs49854016 BstN 1 22881725 R50C* Exon 2 C/T rs6756629 - 22881023 V523I Exon 11 G/A ss49854017 - 22863069 C600Y Exon 13 G/A ss49854018 - 22856345 Q604E* Exon 13 G/C rs6720173 Sml I 22856334 V622M Exon 13 G/A ss49854019 - 22856280 ABCG8 5' UTR-41 5' UTR C/T ss49854020 BstE II 22882085 5' UTR-19* 5' UTR T/G rs3806471 Tsp45 I 22882107 P17P Exon 1 G/C ss49854021 - 22882176 D19H* Exon 1 G/C rs11887534 - 22882180 INT1-21* Intron 1 C/A ss4148209 Mnl I 22887558 INT1-7* Intron 1 C/T ss4148210 BsmA 1 22887572 C54Y* Exon 2 G/A ss4148211 SexA I 22887676 E238L* Exon 6 G/A ss49854010 - 22895692 A259V* Exon 6 C/T ss49854012 Hae III 22895756 Q340E Exon 7 C/G ss49854024 - 22915101 T400K* Exon 8 C/A ss4148217 Mse I 22915366 M429V Exon 9 G/A - 22916932 INT9-19 Intron 9 C/T ss49854025 - 22917460 INT10-50* Intron 10 C/T ss4148220 - 22918168 A565A* Exon 11 C/T ss4148221 - 22918424 G575R* Exon 11 G/C rs49584011 Hha I 22918452 A632V* Exon 13 C/T rs6544718 Sty I 22920858 *Only these SNPs were found to be variant in the present study and the haplotypes (See Table 2 and 3) are ordered with these reported in sequence.
X
ABCG8 p.Met429Val 16507104:27:1006
status: VERIFIED66 All of the SNPs shown in Table 1 except M429V in ABCG8 were analyzed.
X
ABCG8 p.Met429Val 16507104:66:40
status: VERIFIED67 M429V was reported only recently in a Japanese cohort [29], and was not included for analyses in this study.
X
ABCG8 p.Met429Val 16507104:67:0
status: VERIFIED114 Of the remaining 9 SNPs we genotyped and found no variants (Table 1), with the exception of M429V, which we did not genotype, the HapMap Consortium also do not report any genotyping data.
X
ABCG8 p.Met429Val 16507104:114:92
status: VERIFIED158 Additionally, one cSNP, M429V, which was reported to be relatively more frequent in the Japanese population [29], was also absent from the HapMap dataset analyzing the Chinese Han and the Tokyo Japanese DNA samples.
X
ABCG8 p.Met429Val 16507104:158:24
status: VERIFIED197 For example, the M429V SNP was reported in the Japanese samples and seems to play a role in cholesterol absorption [29].
X
ABCG8 p.Met429Val 16507104:197:17
status: VERIFIED[hide] Polymorphisms in ABCG5/G8 transporters linked to h... Nutr Rev. 2008 Jun;66(6):343-8. Rudkowska I, Jones PJ
Polymorphisms in ABCG5/G8 transporters linked to hypercholesterolemia and gallstone disease.
Nutr Rev. 2008 Jun;66(6):343-8., [PMID:18522623]
Abstract [show]
ATP-binding cassette (ABC) transporters function in the homeostasis of lipids. Dysfunction of ABC transporters is frequently associated with disease. This review examines links between polymorphisms of ABC G5 (ABCG5) and G8 (ABCG8) transporter genes to hypercholesterolemia and to gallstone disease risk. Various polymorphisms (A632V, T400K, D19H, M429V, and C54Y) in the ABCG8 and ABCG5 (Q604E) gene have been found to be associated with several facets of cholesterol metabolism, including baseline cholesterol level, cholesterol kinetics, individual responsiveness of plasma cholesterol to dietary and pharmaceutical interventions for hypercholesterolemia, and increased risk of gallstones. Clearly, the ABCG5 and ABCG8 genes play an important role in cholesterol homeostasis. However, more research is needed to establish how specific polymorphisms of these genes confer to higher risk of these diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
3 Various polymorphisms (A632V, T400K, D19H, M429V, and C54Y) in the ABCG8 and ABCG5 (Q604E) gene have been found to be associated with several facets of cholesterol metabolism, including baseline cholesterol level, cholesterol kinetics, individual responsiveness of plasma cholesterol to dietary and pharmaceutical interventions for hypercholesterolemia, and increased risk of gallstones.
X
ABCG8 p.Met429Val 18522623:3:43
status: VERIFIED29 ROLE OF RACE-RELATED DIFFERENCES IN ABC GENOTYPES Miwa et al.,15 studying a Japanese population, concluded that carriers of a novel ABCG8 M429V allele or a specific haplotype (wild-type allele of Q604E ABCG5, and wild-type allele of C54Y, wild-type allele of T400K, mutant allele of M429V in the ABCG8 gene), were associated with higher cholesterol absorption efficiency, as well as lower cholesterol synthesis rates.
X
ABCG8 p.Met429Val 18522623:29:138
status: VERIFIEDX
ABCG8 p.Met429Val 18522623:29:283
status: VERIFIED31 Also, polymorphisms of Q604E and T400K alleles may not be as important in the regulation of non-cholesterol-sterol levels in the Japanese population.15 In a more recent trial, no detection of this SNP (ABCG8 M429V allele) was recorded in either the Caucasian or the African-American population studied, thereby potentially demonstrating a race-specific polymorphism.16 In general, these studies demonstrate the benefits of using an intermediate phenotype, such as cholesterol absorption and synthesis, to determine the link between SNPs and blood lipids in relation to a dietary treatment.
X
ABCG8 p.Met429Val 18522623:31:208
status: VERIFIED[hide] A genome-wide association scan identifies the hepa... Nat Genet. 2007 Aug;39(8):995-9. Epub 2007 Jul 15. Buch S, Schafmayer C, Volzke H, Becker C, Franke A, von Eller-Eberstein H, Kluck C, Bassmann I, Brosch M, Lammert F, Miquel JF, Nervi F, Wittig M, Rosskopf D, Timm B, Holl C, Seeger M, ElSharawy A, Lu T, Egberts J, Fandrich F, Folsch UR, Krawczak M, Schreiber S, Nurnberg P, Tepel J, Hampe J
A genome-wide association scan identifies the hepatic cholesterol transporter ABCG8 as a susceptibility factor for human gallstone disease.
Nat Genet. 2007 Aug;39(8):995-9. Epub 2007 Jul 15., [PMID:17632509]
Abstract [show]
With an overall prevalence of 10-20%, gallstone disease (cholelithiasis) represents one of the most frequent and economically relevant health problems of industrialized countries. We performed an association scan of >500,000 SNPs in 280 individuals with gallstones and 360 controls. A follow-up study of the 235 most significant SNPs in 1,105 affected individuals and 873 controls replicated the disease association of SNP A-1791411 in ABCG8 (allelic P value P(CCA) = 4.1 x 10(-9)), which was subsequently attributed to coding variant rs11887534 (D19H). Additional replication was achieved in 728 German (P = 2.8 x 10(-7)) and 167 Chilean subjects (P = 0.02). The overall odds ratio for D19H carriership was 2.2 (95% confidence interval: 1.8-2.6, P = 1.4 x 10(-14)) in the full German sample. Association was stronger in subjects with cholesterol gallstones (odds ratio = 3.3), suggesting that His19 might be associated with a more efficient transport of cholesterol into the bile.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 The coding SNPs responsible for amino acid changes L36P, Q340E, M429V and G575R were monomorphic.
X
ABCG8 p.Met429Val 17632509:48:64
status: NEW[hide] ATP-binding cassette transporter G5 and G8 polymor... PLoS One. 2012;7(5):e37972. Epub 2012 May 24. Li Q, Yin RX, Wei XL, Yan TT, Aung LH, Wu DF, Wu JZ, Lin WX, Liu CW, Pan SL
ATP-binding cassette transporter G5 and G8 polymorphisms and several environmental factors with serum lipid levels.
PLoS One. 2012;7(5):e37972. Epub 2012 May 24., [PMID:22655090]
Abstract [show]
BACKGROUND: The association of ATP-binding cassette (ABC) transporter single nucleotide polymorphisms (SNPs) and serum lipid profiles is inconsistent. The present study was undertaken to detect the association of ABCG5/G8 SNPs and several environmental factors with serum lipid levels. METHODOLOGY/PRINCIPAL FINDINGS: Genotyping of the ABCG5 (rs4131229 and rs6720173) and ABCG8 (rs3806471 and rs4148211) SNPs was performed in 719 unrelated subjects of Mulao nationality and 782 participants of Han nationality. There were no differences in the genotypic and allelic frequencies of four SNPs between the two ethnic groups besides the genotypic frequencies of rs4131229 SNP in Han. The levels of triglyceride (TG), apolipoprotein (Apo) A1, and ApoA1/ApoB ratio (rs4131229); low-density lipoprotein cholesterol (LDL-C) and ApoB (rs6720173); high-density lipoprotein cholesterol (HDL-C), ApoA1, ApoB, and ApoA1/ApoB ratio (rs3806471); and HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han were different among their genotypes (P<0.05-0.001). The levels of LDL-C (rs6720173) and ApoA1 (rs3806471) in Mulao were also different among their genotypes (P<0.05 for each). The levels of TC, TG, HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4131229); LDL-C and ApoB (rs6720173); HDL-C, ApoA1, and ApoA1/ApoB ratio (rs3806471); and TG, HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han males; and ApoA1/ApoB ratio (rs4131229); LDL-C, ApoB, and ApoA1/ApoB ratio (rs3806471); HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han females were different between the genotypes (P<0.05-0.001). The levels of LDL-C in Mulao females were also different between GG and GC/CC genotypes of rs6720173 (P<0.05). The correlation between serum lipid parameters and genotypes of four SNPs was observed in Han, especially in Han males. Serum lipid parameters were also correlated with several environmental factors. CONCLUSIONS: The associations of four ABCG5/G8 SNPs and serum lipid levels are different between the Mulao and Han populations, or between males and females, suggesting that there may be a racial/ethnic- and/or sex-specific association between ABCG5/G8 SNPs and some serum lipid parameters.
Comments [show]
None has been submitted yet.
No. Sentence Comment
241 020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000 hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers.
X
ABCG8 p.Met429Val 22655090:241:1181
status: NEWX
ABCG8 p.Met429Val 22655090:241:1293
status: NEW239 020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000 hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers.
X
ABCG8 p.Met429Val 22655090:239:1181
status: NEWX
ABCG8 p.Met429Val 22655090:239:1293
status: NEW[hide] The potential influence of genetic variants in gen... Atherosclerosis. 2010 May;210(1):14-27. Epub 2009 Nov 5. Lu Y, Feskens EJ, Boer JM, Muller M
The potential influence of genetic variants in genes along bile acid and bile metabolic pathway on blood cholesterol levels in the population.
Atherosclerosis. 2010 May;210(1):14-27. Epub 2009 Nov 5., [PMID:19932478]
Abstract [show]
The liver is currently known to be the major organ to eliminate excess cholesterol from our body. It accomplishes this function in two ways: conversion of cholesterol molecules into bile acids (BAs) and secretion of unesterified cholesterol molecules into bile. BAs are synthesized in the hepatocytes, secreted into bile and delivered to the lumen of the small intestine where they act as detergents to facilitate absorption of fats and fat-soluble vitamins. About 95% of BAs are recovered in the ileum during each cycle of the enterohepatic circulation. Five percent are lost and replaced by newly synthesized BAs, which amounts to approximately 500 mg/day in adult humans. In contrast to the efficiency of the BAs' enterohepatic circulation, 50% of the 1000 mg of cholesterol secreted daily into bile is lost in feces. It is known that rare human mutations in certain genes in bile acid and bile metabolic pathway influence blood cholesterol levels. With the recent success of genome-wide association studies, we are convinced that common genetic variants also play a role in the genetic architecture of plasma lipid traits. In this review, we summarized the current state of knowledge about genetic variations in bile acid and bile metabolic pathway, and assessed their impact on blood cholesterol levels and cholesterol metabolic kinetics in the population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1795 In 100 hypercholesterolaemic Japanese subjects, Miwa et al. [56] reported that carriers of the M429V variant of ABCG8 or a specific haplotype (wild-type allele of Q604E ABCG5, and wild-type allele of C54Y, wild-type allele of T400K, mutant allele of M429V ABCG8) had higher cholesterol absorption efficiency than non-carriers.
X
ABCG8 p.Met429Val 19932478:1795:95
status: NEWX
ABCG8 p.Met429Val 19932478:1795:250
status: NEW1865 Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians No modulating effect from Y54C on cholesterol lowering response to atorvastatin ABCG8 M429V (A > G) Miwa et al. [56] 100 hypercholesterolaemic Japanese subjects M429V variant associated with higher cholesterol absorption ABCG8 rs4131229 (T > C), rs3806471 (A > C) Junyent et al. [47] 845 self-identified Puerto Ricans Lower HDL-C in rare allele carriers than wild-type homozygotes, no difference in TC and LDL-C ABCG8 rs6709904 (A > G) Junyent et al. [47] 845 self-identified Puerto Ricans Lower LDL-C in rare allele carriers than wild-type homozygotes, no difference in TC and HDL-C NPC1L1 g.-113A > Gg.-18C > A-g.1679C > G (L272L, rs2072183) Simon et al. [66] 1208 hypercholesterolemic individuals participating in the ezetimibe + statin treatment arm of the EASE trial [104] and 1132 hypercholesterolemic individuals participating in Vytorin vs.
X
ABCG8 p.Met429Val 19932478:1865:160
status: NEWX
ABCG8 p.Met429Val 19932478:1865:235
status: NEW[hide] Association between non-responsiveness to plant st... Appl Physiol Nutr Metab. 2008 Aug;33(4):728-34. Rudkowska I, AbuMweis SS, Nicolle C, Jones PJ
Association between non-responsiveness to plant sterol intervention and polymorphisms in cholesterol metabolism genes: a case-control study.
Appl Physiol Nutr Metab. 2008 Aug;33(4):728-34., [PMID:18641716]
Abstract [show]
Plant sterol (PS) consumption decreases low-density lipoprotein cholesterol (LDL-C) levels; however, high variability of responsiveness of lipid levels to PS intervention has been observed. We hypothesized that common single-nucleotide polymorphisms (SNPs) in the genes for the ATP binding cassette proteins G5 (ABCG5) and G8 (ABCG8), Niemann-Pick C1-like 1 (NPC1L1), or other proteins of the cholesterol pathway, would underline inter-individual variations in response to PS. Twenty-six hyperlipidemic subjects completed a randomized trial of 3 PS phases and a control phase. Three non-responders were identified who failed on 3 consecutive occasions to decrease either total cholesterol or LDL-C level vs. control. It was observed that after 3 PS phases compared with a control phase, cholesterol absorption changed to a lesser degree (-7.7% +/- 10.8%) in the non-responders than in the top 3 responders (-22.1% +/- 8.8%); however, cholesterol synthesis rates did not differ between sub-groups. No common polymorphisms in ABCG8, ABCG5, or NPC1L1 were demonstrated between the 3 top responders and the non-responders. Yet, 1 non-responsive subject did demonstrate a rare SNP in NPC1L1. Results indicate PS intake did not decrease cholesterol absorption rates to the same degree in certain subjects, possibly clarifying the inter-individual variability in the cholesterol-lowering effect; hence, this work should be expanded.
Comments [show]
None has been submitted yet.
No. Sentence Comment
124 Also, the M429V SNP in ABCG8 was reported to participate in cholesterol absorption efficiency in the Japanese population (Miwa et al. Fig. 3.
X
ABCG8 p.Met429Val 18641716:124:10
status: NEW[hide] Association of ATP binding cassette transporter G8... Lipids Health Dis. 2012 May 1;11:46. Li Q, Wei XL, Yin RX
Association of ATP binding cassette transporter G8 rs4148217 SNP and serum lipid levels in Mulao and Han nationalities.
Lipids Health Dis. 2012 May 1;11:46., [PMID:22548731]
Abstract [show]
BACKGROUND: The association of ATP binding cassette transporter G8 gene (ABCG8) rs4148217 single nucleotide polymorphism (SNP) and serum lipid profiles is still controversial in diverse racial/ethnic groups. Mulao nationality is an isolated minority in China. The aim of this study was to evaluate the association of ABCG8 rs4148217 SNP and several environmental factors with serum lipid levels in the Guangxi Mulao and Han populations. METHODS: A total of 634 subjects of Mulao nationality and 717 participants of Han nationality were randomly selected from our previous samples. Genotyping of the ABCG8 rs4148217 SNP was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. RESULTS: The genotypic and allelic frequencies of ABCG8 rs4148217 SNP were different between the two nationalities (P < 0.01 for each), the frequency of A allele was higher in Mulao than in Han. The A allele carriers in Han had lower high-density lipoprotein cholesterol (HDL-C) and apolipoprotein (Apo) A1 levels than the A allele noncarriers (P < 0.05 for each), whereas the A allele carriers in Mulao had lower ApoA1 levels than the A allele noncarriers (P < 0.05). Subgroup analyses showed that the A allele carriers in Han had lower HDL-C and higher triglyceride (TG) levels in females but not in males than the A allele noncarriers (P < 0.05 for each), and the A allele carriers in Mulao had lower ApoA1 levels in females but not in males than the A allele noncarriers (P < 0.05). The levels of TG and HDL-C in Han, and ApoA1 in Mulao were associated with genotypes in females but not in males (P < 0.05-0.01). Serum lipid parameters were also correlated with several environmental factors (P < 0.05-0.001). CONCLUSIONS: The ABCG8 rs4148217 SNP is associated with serum TG, HDL-C and ApoA1 levels in our study populations, but this association is different between the Mulao and Han populations. There is a sex (female)-specific association in both ethnic groups.
Comments [show]
None has been submitted yet.
No. Sentence Comment
262 Miwa K, Inazu A, Kobayashi J, Higashikata T, Nohara A, Kawashiri M, Katsuda S, Takata M, Koizumi J, Mabuchi H: ATP-binding cassette transporter G8 M429V polymorphismas a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects.
X
ABCG8 p.Met429Val 22548731:262:147
status: NEW[hide] ABCG5/ABCG8 in cholesterol excretion and atheroscl... Clin Chim Acta. 2014 Jan 20;428:82-8. doi: 10.1016/j.cca.2013.11.010. Epub 2013 Nov 16. Yu XH, Qian K, Jiang N, Zheng XL, Cayabyab FS, Tang CK
ABCG5/ABCG8 in cholesterol excretion and atherosclerosis.
Clin Chim Acta. 2014 Jan 20;428:82-8. doi: 10.1016/j.cca.2013.11.010. Epub 2013 Nov 16., [PMID:24252657]
Abstract [show]
Cholesterol is essential for the growth and function of all mammalian cells, but abnormally increased blood cholesterol is a major risk factor for atherosclerotic cardiovascular disease. ATP-binding cassette (ABC) transporters G5 (ABCG5) and G8 (ABCG8) form an obligate heterodimer that limits intestinal absorption and facilitates biliary secretion of cholesterol and phytosterols. Consistent with their function, ABCG5 and ABCG8 are located on the apical membrane of enterocytes and hepatocytes. Liver X receptor is the major positive regulator of ABCG5 and ABCG8 expression. Mutations in either of the two genes cause sitosterolemia, a condition in which cholesterol and plant sterols accumulate in the circulation leading to premature cardiovascular disease. Overexpression of ABCG5 and ABCG8 in mice retards diet-induced atherosclerosis because of reduced circulating and hepatic cholesterol. In the current review, we summarize recent developments and propose a future framework that provides new perspectives on the regulation of cholesterol metabolism and treatment of atherosclerotic cardiovascular disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
748 In hypercholesterolemic Japanese subjects, serum sitosterol levels and the sitosterol/cholesterol ratio are higher in carriers of the ABCG8 M429V variant than non-carriers [30].
X
ABCG8 p.Met429Val 24252657:748:140
status: NEW[hide] ABCG8 polymorphisms and renal disease in type 2 di... Metabolism. 2015 Jun;64(6):713-9. doi: 10.1016/j.metabol.2015.03.005. Epub 2015 Mar 14. Nicolas A, Fatima S, Lamri A, Bellili-Munoz N, Halimi JM, Saulnier PJ, Hadjadj S, Velho G, Marre M, Roussel R, Fumeron F
ABCG8 polymorphisms and renal disease in type 2 diabetic patients.
Metabolism. 2015 Jun;64(6):713-9. doi: 10.1016/j.metabol.2015.03.005. Epub 2015 Mar 14., [PMID:25804128]
Abstract [show]
BACKGROUND AND AIM: Sterols, bile acids and their receptors have been involved in diabetic nephropathy. The ATP-binding cassette transporters G5 and G8 (ABCG5 and ABCG8) play an important role in intestinal sterol absorption and bile acid secretion. The aim of our study was to assess the associations between two ABCG8 coding polymorphisms, T400K and D19H, and the incidence of renal events in type 2 diabetic subjects. METHODS: Participants were the 3137 French type 2 diabetic subjects with micro- or macro-albuminuria from the genetic substudy of the DIABHYCAR trial. The mean duration of follow-up was 4years. Renal events were defined as a doubling of serum creatinine concentration or end-stage renal disease at follow-up. We then used a second population (DIAB2NEPHROGENE) of 2140 type 2 diabetic patients for the purpose of validation. RESULTS: In DIABHYCAR, the 400K allele was significantly associated with a higher risk of incident renal events in a multiple adjusted model (HR: 1.75 [95% CI 1.20-2.56], P=0.003). This association was still significant after further adjustments for baseline values of estimated glomerular filtration rate and urinary albumin excretion. In the validation population, the 400K allele was associated with the prevalence of end-stage renal disease (OR=2.01 [95% CI 1.15-3.54], P=0.015). No significant association was found between the D19H polymorphism and the risk of diabetic nephropathy. CONCLUSIONS: A polymorphism of the sterol transporter ABCG8 has been associated with the prevalence of end-stage renal disease and with the incidence of new renal events in type 2 diabetic patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
194 [18] Miwa K, Inazu A, Kobayashi J, Higashikata T, Nohara A, Kawashiri M, et al. ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects.
X
ABCG8 p.Met429Val 25804128:194:116
status: NEW