ABCMdb

ABCG5 p.Cys287Arg

Predicted by SNAP2:	A: N (72%), D: D (75%), E: D (80%), F: N (66%), G: D (66%), H: N (78%), I: N (87%), K: D (80%), L: N (93%), M: N (82%), N: D (59%), P: D (85%), Q: D (59%), R: D (71%), S: D (59%), T: N (66%), V: N (78%), W: D (80%), Y: D (53%),
Predicted by PROVEAN:	A: D, D: D, E: D, F: D, G: D, H: D, I: N, K: D, L: N, M: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] ATP-binding cassette transporter G8 M429V polymorp... Clin Sci (Lond). 2005 Aug;109(2):183-8. Miwa K, Inazu A, Kobayashi J, Higashikata T, Nohara A, Kawashiri M, Katsuda S, Takata M, Koizumi J, Mabuchi H
ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects.
Clin Sci (Lond). 2005 Aug;109(2):183-8., [PMID:15816807]

Abstract [show]
The ratio of serum plant sterols to cholesterol is positively correlated with the fractional cholesterol absorption, whereas serum precursors of cholesterol synthesis are positively correlated with cholesterol synthesis. Recently, two ABC (ATP-binding cassette) transporters, ABCG5 and ABCG8, have been described as playing an important role in the absorption and excretion of sterols. In the present study, we tested the hypothesis that genetic variation in ABCG5/ABCG8 influences the levels of serum plant sterol (sitosterol) and cholesterol precursor (lathosterol) in Japanese primary hypercholesterolaemic patients (n = 100). We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)]. In carriers of the novel M429V variant, the serum level of sitosterol and the sitosterol/cholesterol ratio were significantly higher than those in non-carriers (3.64 compared with 2.56 microg/ml, and 1.45 microg/mg compared with 1.00 microg/mg respectively; P < 0.01 for both), and serum lathosterol tended to be lower (1.95 microg/ml compared with 3.03 microg/ml; P = 0.08), whereas no significant difference was observed in other lipid profiles. These four polymorphisms (1810C/G, 161G/A, 1199C/A and 1285A/G) generated six haplotypes, and the C/G/C/G haplotype was significantly associated with a higher sitosterol level and sitosterol/cholesterol ratio compared with the other five haplotypes (P < 0.05 for both). We conclude that, in 8% of patients with hypercholesterolaemia, the novel ABCG8 M429V variant was associated with higher cholesterol absorption efficiency. Future studies should investigate whether these findings have implications for the optimal cholesterol-lowering drug treatment in hypercholesterolaemic patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)]. Login to comment
14 Nucleotide Annealing Position Mutation change* Forward primer (5 → 3 ) Reverse primer (5 → 3 ) temperature (◦ C) Enzyme Size (bp) ABCG5 Exon 7 C287R 859T → C TCACACACTAACTACCTTCTGTTGTC ATGATGGGGAATGTGAAAGAAA 54 BstUI 191 Exon 13 Q604E 1810C → G ATCTAGATTCACAATGAACTTTCTA GTCCCTGCAAGTTGTAAGAG 53 XhoI 193 ABCG8 Exon 2 C54Y 161G → A GGAGGTCAGAGACCTCAAgT GCCCACCCTTTTATTTCCAC 56 RsaI 107 Exon 8 T400K 1199C → A ACACCTGTGTGGAAAGGTAAGGT GCGGGTTCAGTAATAAAATGACAG 57 MseI 216 Exon 9 M429V 1285A → G ATGCTGTTGCCTCAGCATCT AAGCTGTGTTCCTCTGAGCT 56 Tsp45I 306 Exon 13 A632V 1895C → T ATGTCTGTGTCTCCAGATCCTCAGgG TACAGGACCATGAAGCCACCGCTGAcGCC 63 HaeIII 105 sterols to cholesterol are known to be positively related to cholesterol absorption and negatively to cholesterol synthesis [1-4]. Login to comment
47 Genotype and allele frequencies A novel mutation of C287R and five SNPs (single nucleotide polymorphisms) (including a novel one ABCG8 M429V) were genotyped in our subjects. Login to comment
48 Frequency distributions for the genotypes in exon 7 (C287R) and exon 13 (Q604E) of ABCG5, and in exon 2 (C54Y), exon 8 (T400K), exon 9 (M429V) and exon 13 (A632V) of ABCG8 are shown in Table 3. Login to comment
51 Parameters Value Age (years) 62.4 +- 12.1 Gender (men/women) 48/52 BMI (kg/m2 ) 23.0 +- 3.5 Total cholesterol (mg/dl) 261 +- 48 Triacylglycerol (mg/dl) 135 +- 69 HDL-C (mg/dl) 56 +- 16 LDL-C (mg/dl) 179 +- 48 Sitosterol (µg/ml) 2.63 +- 1.0 Lathosterol (µg/ml) 3.00 +- 1.3 Table 3 Genotype distribution and allele frequencies of the polymorphisms in the ABCG5/ABCG8 gene Gene Mutation Nucleotide change Polymorphism Allele frequency ABCG5 Exon 7 C287R 859T → C T 0.99 C 0.01 Exon 13 Q604E 1810C → G C 0.89 G 0.11 ABCG8 Exon 2 C54Y 161G → A G 0.82 A 0.18 Exon 8 T400K 1199C → A C 0.88 A 0.12 Exon 9 M429V 1285A → G A 0.96 G 0.04 Exon 13 A632V 1895C → T C 0.995 T 0.005 found and the A632V variant was rare in our Japanese subjects. Login to comment
53 Of the six mutation/ polymorphisms, one novel mutation (C287R) and one reported variant (A632V) were excluded from the study because of their rarity (allele frequency 0.01). Login to comment
63 In the two rare cases with the C287R mutation, their serum sitosterol and sitosterol/cholesterol levels were not significantly elevated (2.6 µg/ml and 3.1 µg/ml, and 0.97 µg/mg and 1.48 µg/mg respectively). Login to comment
70 DISCUSSION The main findings of the present study performed in Japanese hypercholesterolaemic subjects are as follows: (i) two novel mutants or polymorphisms, C287R in ABCG5 and M429V in ABCG8, have been identified, and (ii) the M429V polymorphism is positively associated with serum sitosterol and sitosterol/cholesterol levels, whereas the other three polymorphisms are not associated with serum non-cholesterol levels. Login to comment