ABCMdb

PMID: 15155846

Ren XQ, Furukawa T, Haraguchi M, Sumizawa T, Aoki S, Kobayashi M, Akiyama S
Function of the ABC signature sequences in the human multidrug resistance protein 1.
Mol Pharmacol. 2004 Jun;65(6):1536-42., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCC1 p.Lys1333Met ABCC1 p.Lys684Met ABCC1 p.Gly1433Asp ABCC1 p.Gly771Asp We therefore investigated the effect of mutation of the signature sequences (G771D and G1433D) and of the Walker A motifs (K684M and K1333M) in the NBDs on the 8-azido-[␣-32 P]ATP photolabeling and 8-azido-[␣-32 P]ADP vanadate trapping of MRP1. Login to comment 5 ABCC1 p.Gly771Asp In contrast, the G771D mutation in the signature sequence of NBD1 enhanced the labeling of NBD1 but slightly decreased the labeling of NBD2. Login to comment 6 ABCC1 p.Gly1433Asp The G1433D mutation in the signature motif of NBD2 enhanced the labeling of NBD2 but did not affect the labeling of NBD1. These effects were all substrate-independent. Login to comment 8 ABCC1 p.Lys1333Met ABCC1 p.Lys1333Met ABCC1 p.Lys684Met ABCC1 p.Lys684Met Trapping at both NBD1 and NBD2 was almost completely inhibited by K684M and K1333M mutations and by the K684M/K1333M double mutation. Login to comment 9 ABCC1 p.Gly771Asp The G771D mutation completely inhibited trapping at NBD2 and considerably inhibited trapping at NBD1. Login to comment 10 ABCC1 p.Gly1433Asp However, whereas the G1433D mutation also considerably inhibited trapping at NBD1, it only partially inhibited trapping of NBD2, and the trapping could still be enhanced by leukotriene C4. Login to comment 31 ABCC7 p.Gly551Asp Likewise, mutation of the CFTR signature sequence at G551D did not change the ATP-binding of purified NBD1 but reduced the ATPase activity (Li et al., 1996; Qu et al., 1997). Login to comment 32 ABCB1 p.Arg538Met Mutation of the MDR1 signature sequence at R538M also showed greatly decreased ATPase activity, although some amino acid replacements in the ABC signature region did not affect the ATPase function of MDR1 (Bakos et al., 1997). Login to comment 55 ABCC1 p.Lys684Met ABCC1 p.Lys684Met The MRP1 construct encoding the K684M mutation was generated by site-directed mutagenesis using the reverse primer 5Ј-GAGAGCAGGGACAGCATTCCG- CAGCCC-3Ј (bold indicates a mismatched base encoding the K684M mutation; underlining indicates a silent mutation). Login to comment 56 ABCC1 p.Lys1333Met The MRP1 K1333M mutant was constructed using the oligonucleotide DNA 5Ј CGGGAGCTGGGATGTCGTCCCTGAC3Ј (bold indicates a mismatched base) and the Gene Editor in vitro site-directed mutagenesis system (Promega, Madison, WI) according to the manufacturer`s protocol. Login to comment 57 ABCC1 p.Lys1333Met ABCC1 p.Lys684Met The MRP1 K684M/K1333M double mutant was generated by exchanging DNA fragments from the single mutations. Login to comment 58 ABCC1 p.Gly1433Asp ABCC1 p.Gly771Asp The strategies employed for site-directed mutagenesis of G771D and G1433D in MRP1 cDNA were described previously (Ren et al., 2001). Login to comment 59 ABCC1 p.Gly1433Asp ABCC1 p.Gly1433Asp ABCC1 p.Gly771Asp ABCC1 p.Gly771Asp The primer used to generate G771D and G1433D mutations were forward primers 5Ј-CTGGGGACCAGAAGCAGCGCGTGAG-3Ј and 5Ј-AGTGTCGATCAGCGCCAGCTTGTG-3Ј (underlining indicate mismatched bases encoding G771D and G1433D mutations, respectively). Login to comment 92 ABCC1 p.Lys1333Met ABCC1 p.Lys1333Met ABCC1 p.Gly1433Asp The expression levels of the N-terminal halves of the mutated dual NϩC fragments relative to that for wt NϩC were 0.98, 0.55, 0.41, 1.58, and 0.84 for N K684MϩC, NϩC K1333M, N K684MϩC K1333M, N G771DϩC, and NϩC G1433D, respectively. Login to comment 93 ABCC1 p.Lys1333Met ABCC1 p.Lys1333Met ABCC1 p.Gly1433Asp The expression levels of the C-terminal halves of the mutated dual NϩC fragments relative to that for wt NϩC were 0.85, 0.49, 0.37, 1.21, and 0.51 for N K684MϩC, NϩC K1333M, N K684MϩC K1333M, N G771DϩC ,and NϩC G1433D, respectively. Login to comment 98 ABCC1 p.Lys684Met ABCC1 p.Gly771Asp Furthermore, G771D mutation in signature sequence of NBD1 more effectively lowered LTC4 uptake activity than K684M in Walker A motif of the same NBD, suggesting that the signature sequence has a more important role than the Walker A motif in the transport of the substrate. Login to comment 113 ABCC1 p.Lys1333Met ABCC1 p.Lys684Met Mutation of the Walker A motif in the N-terminal (K684M) NBD1 or the C-terminal (K1333M) NBD2 almost completely inhibited the labeling of the NBD in their respective fragments. Login to comment 116 ABCC1 p.Gly1433Asp ABCC1 p.Gly771Asp Unlike the situation observed with the Walker A motifs, mutation of the signature sequence in the N (G771D) or the C (G1433D) - terminal half enhanced the labeling of the NBD in their respective fragments. Login to comment 127 ABCC1 p.Lys1333Met ABCC1 p.Lys1333Met ABCC1 p.Lys684Met ABCC1 p.Lys684Met Either single or double mutation of the Walker A motifs in NBD1 and/or NBD2 (K684M, K1333M, or K684M/K1333M double mutations) almost completely inhibited trapping by both NBD1 and NBD2 domains (Fig. 7A). Login to comment 129 ABCC1 p.Gly1433Asp ABCC1 p.Gly771Asp However, whereas mutation of the signature sequence of NBD1 (G771D) completely inhibited the trapping at NBD2, mutation of the signature sequence of NBD2 (G1433D) only partially inhibited Fig. 5. Effect of NBD mutations on MRP1-ATP binding activity. Membrane vesicles (50 ␮g of protein) from insect cells coexpressing both N-and C-terminal wt or mutant fragments of MRP1 were incubated on ice with 5 ␮M 8-azido-[␣-32 P]ATP and 5 mM MgCl2 in the presence or absence of 1 ␮M LTC4 as described under Materials and Methods. Login to comment 141 ABCC1 p.Lys1333Met ABCC1 p.Lys684Met ABCC1 p.Gly1433Asp ABCC1 p.Gly771Asp Although ATP-dependent LTC4 transport by G771D and G1433D MRP1 mutants, as well as transport by the K684M and K1333M mutants in the Walker A motifs, were considerably decreased, GSH-dependent photolabeling with azido AG-A of these MRP1 mutants was retained. Login to comment 150 ABCC1 p.Gly771Asp No labeling of either NBD with 8-azido-[␣-32 P]ATP under vanadate-trapping conditions was observed when the G771D mutant half molecule was coexpressed with the wild-type COOH-proximal half-molecule. Login to comment 159 ABCC1 p.Gly1433Asp However, weak labeling of NBD2 and no trapping at NBD1 were observed when the G1433D mutant half molecule was coexpressed with the wild-type NH2-proximal half-molecule. Login to comment 163 ABCC1 p.Gly771Asp Mutation of the signature sequence in NBD1 (G771D) considerably inhibited the transport of LTC4 by the reconstituted MRP1. Login to comment