ABCB1 p.Arg538Met
| Predicted by SNAP2: | A: D (91%), C: D (85%), D: D (95%), E: D (91%), F: D (91%), G: D (91%), H: D (85%), I: D (91%), K: D (85%), L: D (91%), M: D (91%), N: D (91%), P: D (95%), Q: D (85%), S: D (85%), T: D (85%), V: D (85%), W: D (95%), Y: D (91%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Function of the ABC signature sequences in the hum... Mol Pharmacol. 2004 Jun;65(6):1536-42. Ren XQ, Furukawa T, Haraguchi M, Sumizawa T, Aoki S, Kobayashi M, Akiyama S
Function of the ABC signature sequences in the human multidrug resistance protein 1.
Mol Pharmacol. 2004 Jun;65(6):1536-42., [PMID:15155846]
Abstract [show]
Human multidrug resistance protein 1 (MRP1) is a membrane ATP-binding cassette transporter that confers multidrug resistance to tumor cells by effluxing intracellular drugs in an ATP-dependent manner. The mechanisms by which transport occurs and by which ATP hydrolysis is coupled to drug transport are not fully elucidated. In particular, the function of the signature sequences in the nucleotide binding domains (NBDs) of MRP1 is unknown. We therefore investigated the effect of mutation of the signature sequences (G771D and G1433D) and of the Walker A motifs (K684M and K1333M) in the NBDs on the 8-azido-[alpha-32P]ATP photolabeling and 8-azido-[alpha-32P]ADP vanadate trapping of MRP1. Both mutations in the Walker A motif almost completely inhibited the labeling of the mutated NBD with 8-azido-[alpha-32P]ATP but not the labeling of the other intact NBD. In contrast, the G771D mutation in the signature sequence of NBD1 enhanced the labeling of NBD1 but slightly decreased the labeling of NBD2. The G1433D mutation in the signature motif of NBD2 enhanced the labeling of NBD2 but did not affect the labeling of NBD1. These effects were all substrate-independent. Photolabeling of NBD2 and a very slight photolableing of NBD1 were detectable under vanadate trapping conditions with 8-azido-[alpha-32P]ATP. Trapping at both NBD1 and NBD2 was almost completely inhibited by K684M and K1333M mutations and by the K684M/K1333M double mutation. The G771D mutation completely inhibited trapping at NBD2 and considerably inhibited trapping at NBD1. However, whereas the G1433D mutation also considerably inhibited trapping at NBD1, it only partially inhibited trapping of NBD2, and the trapping could still be enhanced by leukotriene C4. Our findings suggest that both signature sequences of MRP1 are involved in ATP hydrolysis and must be intact for the ATP hydrolysis and the transport by MRP1.
Comments [show]
None has been submitted yet.
No. Sentence Comment
32 Mutation of the MDR1 signature sequence at R538M also showed greatly decreased ATPase activity, although some amino acid replacements in the ABC signature region did not affect the ATPase function of MDR1 (Bakos et al., 1997).
X
ABCB1 p.Arg538Met 15155846:32:43
status: NEW[hide] Characterization of the human multidrug resistance... Biochem J. 1997 May 1;323 ( Pt 3):777-83. Bakos E, Klein I, Welker E, Szabo K, Muller M, Sarkadi B, Varadi A
Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region.
Biochem J. 1997 May 1;323 ( Pt 3):777-83., 1997-05-01 [PMID:9169612]
Abstract [show]
A number of mutants with single amino acid replacements were generated in the highly conserved ATP-binding cassette (ABC)-signature region (amino acids 531-543) of the N-terminal half of the human multidrug resistance (MDR1) protein. The cDNA variants were inserted into recombinant baculoviruses and the MDR1 proteins were expressed in Spodoptera frugiperda (Sf9) insect cells. The level of expression and membrane insertion of the MDR1 variants was examined by immunostaining, and MDR1 function was followed by measuring drug-stimulated ATPase activity. We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure. The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity. Increasing the ATP concentration did not restore MDR1 ATPase activity in these variants. Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1. We found no alteration in the drug-sensitivity of ATP cleavage in any of the MDR1 variants that had measurable ATPase activity. These observations suggest that the ABC-signature region is essential for MDR1 protein stability and function, but alterations in this region do not seem to modulate MDR1-drug interactions directly.
Comments [show]
None has been submitted yet.
No. Sentence Comment
18 insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity.
X
ABCB1 p.Arg538Met 9169612:18:87
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Arg538Met 9169612:38:311
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Arg538Met 9169612:64:131
status: NEWX
ABCB1 p.Arg538Met 9169612:64:221
status: NEW73 In immunoflow cytometry experiments, the mutant MDR1 proteins G534D, R538M and I541R were recognized by both monoclonal antibodies, in a manner indistinguishable from that of the wild-type protein (Figure 3).
X
ABCB1 p.Arg538Met 9169612:73:69
status: NEW90 An interesting finding was that the MDR1 mutant R538M showed a reduced maximal level of drug-stimulated ATPase activity in the presence of each of the four drugs studied.
X
ABCB1 p.Arg538Met 9169612:90:48
status: NEW95 As demonstrated in Figure 5, the ATPase reaction catalysed by the R538M mutant MDR1 also had a similar KATP m value as the Figure 5 MgATP-concentration-dependence of vanadate-sensitive ATPase activity in isolated Sf9 cell membranes The ATPase activity of the isolated Sf9 cell membranes was estimated by measuring Pi liberation in the presence of 30 µM verapamil, as described in the Experimental section.
X
ABCB1 p.Arg538Met 9169612:95:66
status: NEW145 In the central polar region of the ABC signature, the replacement of arginine at position 538 with methionine (R538M) created an MDR1 protein with a lowered maximum level of drug-stimulated ATPase activity (approx.
X
ABCB1 p.Arg538Met 9169612:145:69
status: NEWX
ABCB1 p.Arg538Met 9169612:145:111
status: NEW147 This difference was observed with each of the four drugs used in this study (Figure 4), suggesting that the R538M MDR1 shows lower maximum activity but not altered substrate specificity.
X
ABCB1 p.Arg538Met 9169612:147:108
status: NEW154 The (fully expressed) R538M mutant had decreased maximum MDR1 ATPase activity, while the G534D and I541R mutants showed a complete loss of activity despite retaining a wild-type ABC signature region in the C-terminal half of the protein.
X
ABCB1 p.Arg538Met 9169612:154:22
status: NEW[hide] The power of the pump: mechanisms of action of P-g... Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13. Ambudkar SV, Kim IW, Sauna ZE
The power of the pump: mechanisms of action of P-glycoprotein (ABCB1).
Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13., [PMID:16352426]
Abstract [show]
Members of the superfamily of ATP-binding cassette (ABC) transporters mediate the movement of a variety of substrates including simple ions, complex lipids and xenobiotics. At least 18 ABC transport proteins are associated with disease conditions. P-glycoprotein (Pgp, ABCB1) is the archetypical mammalian ABC transport protein and its mechanism of action has received considerable attention. There is strong biochemical evidence that Pgp moves molecular cargo against a concentration gradient using the energy of ATP hydrolysis. However, the molecular details of how the energy of ATP hydrolysis is coupled to transport remain in dispute and it has not been possible to reconcile the data from various laboratories into a single model. The functional unit of Pgp consists of two nucleotide binding domains (NBDs) and two trans-membrane domains which are involved in the transport of drug substrates. Considerable progress has been made in recent years in characterizing these functionally and spatially distinct domains of Pgp. In addition, our understanding of the domains has been augmented by the resolution of structures of several non-mammalian ABC proteins. This review considers: (i) the role of specific conserved amino acids in ATP hydrolysis mediated by Pgp; (ii) emerging insights into the dimensions of the drug binding pocket and the interactions between Pgp and the transport substrates and (iii) our current understanding of the mechanisms of coupling between energy derived from ATP binding and/or hydrolysis and efflux of drug substrates.
Comments [show]
None has been submitted yet.
No. Sentence Comment
53 Hoof et al. (1994) Human L531R Decreased cell surface expression Bakos et al. (1997) G534V K536I Normal cell surface expression K536R Normal ATP hydrolysis I541T R543S LSGGQ or linker peptide or signature motif Human R538M Normal cell surface expression Decreased ATP hydrolysis Bakos et al. (1997) I541R Normal cell surface expression No ATP hydrolysis Walker B Mouse D551N D1196N No ATP hydrolysis, required for Mg2+ binding Urbatsch et al. (1998) Human D555A D1200A Same as above Hrycyna et al. (1999) Walker B Mouse E552A E1197A Trapping of ATP, no steady-state hydrolysis Tombline et al. (2004b) Mouse E552Q E1197Q No steady-state ATP hydrolysis Vigano et al. (2002) Human E556A E1201A Trapping of ATP or ADP in the absence of vanadate, low levels of ATP hydrolysis Sauna et al. (2002) D-loop Mouse D558N D1203N Decreased ATP hydrolysis Urbatsch et al. (2000b) the ABC transporter superfamily.
X
ABCB1 p.Arg538Met 16352426:53:217
status: NEW