ABCMdb

ABCC1 p.Lys1333Met

Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Comparison of the functional characteristics of th... J Biol Chem. 2000 Apr 28;275(17):13098-108. Gao M, Cui HR, Loe DW, Grant CE, Almquist KC, Cole SP, Deeley RG
Comparison of the functional characteristics of the nucleotide binding domains of multidrug resistance protein 1.
J Biol Chem. 2000 Apr 28;275(17):13098-108., 2000-04-28 [PMID:10777615]

Abstract [show]
Multidrug Resistance Protein 1 (MRP1) transports diverse organic anionic conjugates and confers resistance to cytotoxic xenobiotics. The protein contains two nucleotide binding domains (NBDs) with features characteristic of members of the ATP-binding cassette superfamily and exhibits basal ATPase activity that can be stimulated by certain substrates. It is not known whether the two NBDs of MRP1 are functionally equivalent. To investigate this question, we have used a baculovirus dual expression vector encoding both halves of MRP1 to reconstitute an active transporter and have compared the ability of each NBD to be photoaffinity-labeled with 8-azido-[(32)P]ATP and to trap 8-azido-[(32)P]ADP in the presence of orthovanadate. We found that NBD1 was preferentially labeled with 8-azido-[(32)P]ATP, while trapping of 8-azido-[(32)P]ADP occurred predominantly at NBD2. Although trapping at NBD2 was dependent on co-expression of both halves of MRP1, binding of 8-azido-ATP by NBD1 remained detectable when the NH(2)-proximal half of MRP1 was expressed alone and when NBD1 was expressed as a soluble polypeptide. Mutation of the conserved Walker A lysine 684 or creation of an insertion mutation between Walker A and B motifs eliminated binding by NBD1 and all detectable trapping of 8-azido-ADP at NBD2. Both mutations decreased leukotriene C(4) (LTC(4)) transport by approximately 70%. Mutation of the NBD2 Walker A lysine 1333 eliminated trapping of 8-azido-ADP by NBD2 but, in contrast to the mutations in NBD1, essentially eliminated LTC(4) transport activity without affecting labeling of NBD1 with 8-azido-[(32)P]ATP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 The primers with the mismatched bases (boldface type) for K684M and K1333M were 5Ј-GGCTGCGGAATGTCGTC- CCTG-3Ј and 5Ј-GGAGCTGGGATGTCGTCCCTG-3Ј, respectively. Login to comment
84 The EcoRI-KpnI fragment with the K1333M mutation was isolated from pGEM-NBD2 and used to replace the equivalent region in pBSMRP1-fc-ATG to generate pBSMRP1-fc-ATG/ K1333M. Login to comment
85 The SphI-KpnI fragment was then isolated from the resulting plasmid and used to replace the same region in pFB-MRP1 and pFB-MRP1/K684M to give pFB-MRP1/K1333M and pFB-MRP1/Double Km, respectively. Login to comment
86 To generate pFBDual-halves/Double KM, the NcoI-KpnI fragment of pBSMRP1-fc-ATG/K1333M was isolated and used to replace the equivalent region of pFBDual-MRP1932-1531. Login to comment
205 In contrast, the rates of ATP-dependent LTC4 uptake by membranes containing either MRP1/K1333M or MRP1/Double KM were less than 5% of that of the membranes expressing the wild-type protein. Login to comment
217 Time and ATP-dependence of uptake is shown for MRP1 (f), NBD1 mutant MRP1/K684M (Œ), NBD2 mutant MRP1/K1333M (), and the double mutant MRP1/Double KM (ࡗ). Login to comment
227 LTC4 Transport by Co-expressed Half-molecules of MRP1 Containing Walker A Lysine Mutations-To further characterize the effect of the Walker A K684M and K1333M substitutions on the ability to photolabel each NBD with 8-azido-␣- [32 P]ATP, these mutations were introduced into each of the half-molecules, which were then expressed either together, or with the appropriate wild-type half-molecule, using dual expression vectors. Login to comment
231 The rates of LTC4 uptake by both halves of MRP1/K1333M and MRP1/Double KM were 8 and 5% that of the wild-type protein, respectively. Login to comment
237 As expected, the K1333M mutation also eliminated all labeling of NBD2. Login to comment
242 Consistent with the results obtained with the full-length protein, no labeling of either NBD was observed when either the K1333M or K684M mutant half-molecules were co-expressed with the appropriate wild-type half of the protein despite the demonstrable transport activity of the latter combination. Login to comment
247 A, membrane proteins from Sf21 cells expressing both halves of wild-type MRP1 (Dual-halves), NBD1 mutant (Dual-halves/ K684M), NBD2 mutant (Dual-halves/K1333M) and double mutant (Dual-halves/Double KM) were separated by SDS-PAGE on a 5-15% gradient gel and transferred to Immobilon-P membranes. Login to comment
250 Time and ATP dependence of uptake is shown for Dual-halves (f), Dual-halves/K684M (Œ), Dual-halves/K1333M (), and Dual-halves/ Double KM (ࡗ). Login to comment
330 In contrast, the K1333M mutation essentially eliminated transport and abolished 8-azido-ADP trapping by NBD2 and the low level of trapping detectable at NBD1. Login to comment
332 The combined results of LTC4 transport and photoaffinity labeling studies with the K684M, Ins708, and K1333M mutants are consistent with a model in which ATP hydrolysis at NBD1 is obligatorily coupled to hydrolysis at NBD2 but not vice versa. Login to comment
334 The lack of reciprocal coupling between the two NBDs of MRP1 and the different consequences of the K684M and K1333M mutations raise an important question with respect to the role played by NBD1 in substrate transport. Login to comment

[hide] Characterization of binding of leukotriene C4 by h... J Biol Chem. 2001 Oct 19;276(42):38636-44. Epub 2001 Aug 15. Qian YM, Qiu W, Gao M, Westlake CJ, Cole SP, Deeley RG
Characterization of binding of leukotriene C4 by human multidrug resistance protein 1: evidence of differential interactions with NH2- and COOH-proximal halves of the protein.
J Biol Chem. 2001 Oct 19;276(42):38636-44. Epub 2001 Aug 15., 2001-10-19 [PMID:11507101]

Abstract [show]
Multidrug resistance protein 1 (MRP1) is capable of actively transporting a wide range of conjugated and unconjugated organic anions. The protein can also transport additional conjugated and unconjugated compounds in a GSH- or S-methyl GSH-stimulated manner. How MRP1 binds and transports such structurally diverse substrates is not known. We have used [(3)H]leukotriene C(4) (LTC(4)), a high affinity glutathione-conjugated physiological substrate, to photolabel intact MRP1, as well as fragments of the protein expressed in insect cells. These studies revealed that: (i) LTC(4) labels sites in the NH(2)- and COOH-proximal halves of MRP1, (ii) labeling of the NH(2)-half of MRP1 is localized to a region encompassing membrane-spanning domain (MSD) 2 and nucleotide binding domain (NBD) 1, (iii) labeling of this region is dependent on the presence of all or part of the cytoplasmic loop (CL3) linking MSD1 and MSD2, but not on the presence of MSD1, (iv) labeling of the NH(2)-proximal site is preferentially inhibited by S-methyl GSH, (v) labeling of the COOH-proximal half of the protein occurs in a region encompassing transmembrane helices 14-17 and appears not to require NBD2 or the cytoplasmic COOH-terminal region of the protein, (vi) labeling of intact MRP1 by LTC(4) is strongly attenuated in the presence of ATP and vanadate, and this decrease in labeling is attributable to a marked reduction in LTC(4) binding to the NH(2)-proximal site, and (vii) the attenuation of LTC(4) binding to the NH(2)-proximal site is a consequence of ATP hydrolysis and trapping of Vi-ADP exclusively at NBD2. These data suggest that MRP1-mediated transport involves a conformational change, driven by ATP hydrolysis at NBD2, that alters the affinity with which LTC(4) binds to one of two sites composed, at least in part, of elements in the NH(2)-proximal half of the protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
149 Consistent with the suggestion that the two NBDs of MRP1 fulfill different functional roles, our previous studies demonstrated that Walker A mutations, K684M and K1333M, in NBD1 and NBD2, respectively, had different effects on the ability of the protein to transport LTC4 (25). Login to comment
151 As shown in Fig. 8C, either the double mutation K684M/K1333M or the single mutation K1333M abolished the ability of vanadate and ATP to inhibit LTC4 binding, whereas mutation K684M did not. Login to comment
235 C, effect of vanadate trapping on [3 H]LTC4 labeling of co-expressed expressed mutant forms of MRP11-932 and MRP1932-1531 in which NBD1 or NBD2 had been in activated by mutation of essential Walker A mutations (K684M in NBD1 and K1333M in NBD). Login to comment

[hide] The MRP-related and BCRP/ABCG2 multidrug resistanc... Curr Drug Metab. 2004 Feb;5(1):21-53. Haimeur A, Conseil G, Deeley RG, Cole SP
The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation.
Curr Drug Metab. 2004 Feb;5(1):21-53., [PMID:14965249]

Abstract [show]
Several members of different families of the ATP-binding cassette (ABC) superfamily of transport proteins are capable of transporting an extraordinarily structurally diverse array of endo- and xenobiotics and their metabolites across cell membranes. Together, these transporters play an important role in the absorption, disposition and elimination of these chemicals in the body. In tumor cells, increased expression of these drug transporters is associated with resistance to multiple chemotherapeutic agents. In this review, current knowledge of the biochemical, physiological and pharmacological properties of nine members of the multidrug resistance protein (MRP)-related ABCC family (MRP1, MRP2, MRP3, MRP4, MRP5, MRP6, MRP7, ABCC11 and ABCC12) as well as the G family member, ABCG2/BCRP, are summarized. A focus is placed on the structural similarities and differences of these drug transporters as well as the molecular determinants of their substrate specificities and transport activities. Factors that regulate expression of the MRP-related proteins and ABCG2/BCRP are also reviewed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
240 In contrast, the comparable mutation in the WA motif of NBD2 (Lys1333 to Met) completely abolishes transport activity indicating an essential requirement for ATP hydrolysis by this domain [184]. Login to comment

[hide] Functional studies on the MRP1 multidrug transport... Anticancer Res. 2004 Mar-Apr;24(2A):449-55. Szentpetery Z, Sarkadi B, Bakos E, Varadi A
Functional studies on the MRP1 multidrug transporter: characterization of ABC-signature mutant variants.
Anticancer Res. 2004 Mar-Apr;24(2A):449-55., [PMID:15152943]

Abstract [show]
BACKGROUND: MRP1 is a key multidrug resistance ATP-binding Cassette (ABC) transporter in tumor cells. A functionally important signature motif is conserved within all ABC domains. Our current studies aimed to elucidate the role of these motifs in the cooperation of MRP1 ABC domains. MATERIALS AND METHODS: We designed human MRP1 mutants based on a bacterial ABC structure. Conserved leucines (Leu) were replaced by arginines (Arg), while glycines (Gly) were substituted for aspartic acids (Asp). The activity of these mutants was assayed by measuring ATPase activity and vesicular transport. ATP-binding and transition-state formation were studied by a photoreactive ATP analog. RESULTS: The Leu to Arg mutants retained both ATPase and transport activity, while the Gly to Asp mutants were inactive in all functional assays, while showing normal ATP-binding. CONCLUSION: Our results reinforce the notion that a single mutation in one of the ABC-signature regions affects the function of the whole protein. The relative role of the conservative leucines and glycines in MRP1 indicates a similar three-dimensional structure within the catalytic center of various ABC proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 When a highly conserved lysine residue within the Walker A motif in MRP1 was substituted for methionine in either the N-ABC or in the C-ABC unit, the K1333M mutation in the C-ABC nearly abolished ATP-dependent LTC4 uptake, whereas the K684M substitution in the N-ABC had a less pronounced effect (22,23). Login to comment

[hide] Function of the ABC signature sequences in the hum... Mol Pharmacol. 2004 Jun;65(6):1536-42. Ren XQ, Furukawa T, Haraguchi M, Sumizawa T, Aoki S, Kobayashi M, Akiyama S
Function of the ABC signature sequences in the human multidrug resistance protein 1.
Mol Pharmacol. 2004 Jun;65(6):1536-42., [PMID:15155846]

Abstract [show]
Human multidrug resistance protein 1 (MRP1) is a membrane ATP-binding cassette transporter that confers multidrug resistance to tumor cells by effluxing intracellular drugs in an ATP-dependent manner. The mechanisms by which transport occurs and by which ATP hydrolysis is coupled to drug transport are not fully elucidated. In particular, the function of the signature sequences in the nucleotide binding domains (NBDs) of MRP1 is unknown. We therefore investigated the effect of mutation of the signature sequences (G771D and G1433D) and of the Walker A motifs (K684M and K1333M) in the NBDs on the 8-azido-[alpha-32P]ATP photolabeling and 8-azido-[alpha-32P]ADP vanadate trapping of MRP1. Both mutations in the Walker A motif almost completely inhibited the labeling of the mutated NBD with 8-azido-[alpha-32P]ATP but not the labeling of the other intact NBD. In contrast, the G771D mutation in the signature sequence of NBD1 enhanced the labeling of NBD1 but slightly decreased the labeling of NBD2. The G1433D mutation in the signature motif of NBD2 enhanced the labeling of NBD2 but did not affect the labeling of NBD1. These effects were all substrate-independent. Photolabeling of NBD2 and a very slight photolableing of NBD1 were detectable under vanadate trapping conditions with 8-azido-[alpha-32P]ATP. Trapping at both NBD1 and NBD2 was almost completely inhibited by K684M and K1333M mutations and by the K684M/K1333M double mutation. The G771D mutation completely inhibited trapping at NBD2 and considerably inhibited trapping at NBD1. However, whereas the G1433D mutation also considerably inhibited trapping at NBD1, it only partially inhibited trapping of NBD2, and the trapping could still be enhanced by leukotriene C4. Our findings suggest that both signature sequences of MRP1 are involved in ATP hydrolysis and must be intact for the ATP hydrolysis and the transport by MRP1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 We therefore investigated the effect of mutation of the signature sequences (G771D and G1433D) and of the Walker A motifs (K684M and K1333M) in the NBDs on the 8-azido-[␣-32 P]ATP photolabeling and 8-azido-[␣-32 P]ADP vanadate trapping of MRP1. Login to comment
8 Trapping at both NBD1 and NBD2 was almost completely inhibited by K684M and K1333M mutations and by the K684M/K1333M double mutation. Login to comment
56 The MRP1 K1333M mutant was constructed using the oligonucleotide DNA 5Ј CGGGAGCTGGGATGTCGTCCCTGAC3Ј (bold indicates a mismatched base) and the Gene Editor in vitro site-directed mutagenesis system (Promega, Madison, WI) according to the manufacturer`s protocol. Login to comment
57 The MRP1 K684M/K1333M double mutant was generated by exchanging DNA fragments from the single mutations. Login to comment
92 The expression levels of the N-terminal halves of the mutated dual NϩC fragments relative to that for wt NϩC were 0.98, 0.55, 0.41, 1.58, and 0.84 for N K684MϩC, NϩC K1333M, N K684MϩC K1333M, N G771DϩC, and NϩC G1433D, respectively. Login to comment
93 The expression levels of the C-terminal halves of the mutated dual NϩC fragments relative to that for wt NϩC were 0.85, 0.49, 0.37, 1.21, and 0.51 for N K684MϩC, NϩC K1333M, N K684MϩC K1333M, N G771DϩC ,and NϩC G1433D, respectively. Login to comment
113 Mutation of the Walker A motif in the N-terminal (K684M) NBD1 or the C-terminal (K1333M) NBD2 almost completely inhibited the labeling of the NBD in their respective fragments. Login to comment
127 Either single or double mutation of the Walker A motifs in NBD1 and/or NBD2 (K684M, K1333M, or K684M/K1333M double mutations) almost completely inhibited trapping by both NBD1 and NBD2 domains (Fig. 7A). Login to comment
141 Although ATP-dependent LTC4 transport by G771D and G1433D MRP1 mutants, as well as transport by the K684M and K1333M mutants in the Walker A motifs, were considerably decreased, GSH-dependent photolabeling with azido AG-A of these MRP1 mutants was retained. Login to comment

[hide] Functional interactions between nucleotide binding... Mol Pharmacol. 2005 Jun;67(6):1944-53. Epub 2005 Mar 8. Payen L, Gao M, Westlake C, Theis A, Cole SP, Deeley RG
Functional interactions between nucleotide binding domains and leukotriene C4 binding sites of multidrug resistance protein 1 (ABCC1).
Mol Pharmacol. 2005 Jun;67(6):1944-53. Epub 2005 Mar 8., [PMID:15755910]

Abstract [show]
Multidrug resistance protein 1 (MRP1) is a member of the "C" branch of the ATP-binding cassette transporter superfamily. The NH(2)-proximal nucleotide-binding domain (NBD1) of MRP1 differs functionally from its COOH-proximal domain (NBD2). NBD1 displays intrinsic high-affinity ATP binding and little ATPase activity. In contrast, ATP binding to NBD2 is strongly dependent on nucleotide binding by NBD1, and NBD2 is more hydrolytically active. We have demonstrated that occupancy of NBD2 by ATP or ADP markedly decreased substrate binding by MRP1. We have further explored the relationship between nucleotide and substrate binding by examining the effects of various ATP analogs and ADP trapping, as well as mutations in conserved functional elements in the NBDs, on the ability of MRP1 to bind the photoactivatable, high-affinity substrate cysteinyl leukotriene C(4) (LTC(4))(.) Overall, the results support a model in which occupancy of both NBD1 and NBD2 by ATP results in the formation of a low-affinity conformation of the protein. However, nonhydrolyzable ATP analogs (beta,gamma-imidoadenosine 5'-triphosphate and adenylylmethylene diphosphonate) failed to substitute for ATP or adenosine 5'-O-(thiotriphosphate) (ATPgammaS) in decreasing LTC(4) photolabeling. Furthermore, mutations of the signature sequence in either NBD that had no apparent effect on azido-ATP binding abrogated the formation of a low-affinity substrate binding state in the presence of ATP or ATPgammaS. We suggest that the effect of these mutations, and possibly the failure of some ATP analogs to decrease LTC(4) binding, may be attributable to an inability to elicit a conformational change in the NBDs that involves interactions between the signature sequence and the gamma-phosphate of the bound nucleotide.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
126 Mutation of the conserved Walker A Lys684 in NBD1 (Fig. 2) to methionine substantially reduces but does not eliminate MRP1 transport activity, whereas the comparable mutation in NBD2, K1333M, essentially inactivates the protein (Gao et al., 2000; Hou et al., 2000). Login to comment

[hide] Hydrogen-bond formation of the residue in H-loop o... Biochim Biophys Acta. 2007 Feb;1768(2):324-35. Epub 2006 Nov 18. Yang R, Chang XB
Hydrogen-bond formation of the residue in H-loop of the nucleotide binding domain 2 with the ATP in this site and/or other residues of multidrug resistance protein MRP1 plays a crucial role during ATP-dependent solute transport.
Biochim Biophys Acta. 2007 Feb;1768(2):324-35. Epub 2006 Nov 18., [PMID:17187755]

Abstract [show]
MRP1 couples ATP binding/hydrolysis to solute transport. We have shown that ATP binding to nucleotide-binding-domain 1 (NBD1) plays a regulatory role whereas ATP hydrolysis at NBD2 plays a crucial role in ATP-dependent solute transport. However, how ATP is hydrolyzed at NBD2 is not well elucidated. To partially address this question, we have mutated the histidine residue in H-loop of MRP1 to either a residue that prevents the formation of hydrogen-bonds with ATP and other residues in MRP1 or a residue that may potentially form these hydrogen-bonds. Interestingly, substitution of H827 in NBD1 with residues that prevented formation of these hydrogen-bonds had no effect on the ATP-dependent solute transport whereas corresponding mutations in NBD2 almost abolished the ATP-dependent solute transport completely. In contrast, substitutions of H1486 in H-loop of NBD2 with residues that might potentially form these hydrogen-bonds exerted either full function or partial function, implying that hydrogen-bond formation between the residue at 1486 and the gamma-phosphate of the bound ATP and/or other residues, such as putative catalytic base E1455, together with S769, G771, T1329 and K1333, etc., holds all the components necessary for ATP binding/hydrolysis firmly so that the activated water molecule can efficiently hydrolyze the bound ATP at NBD2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Accordingly, mutations of the residues that should interact with the γ-phosphate of the bound ATP [28,29], such as K1333M [19] or G771A [30], also almost abolished the ATP-dependent solute transport activity completely. Login to comment

[hide] A molecular understanding of ATP-dependent solute ... Cancer Metastasis Rev. 2007 Mar;26(1):15-37. Chang XB
A molecular understanding of ATP-dependent solute transport by multidrug resistance-associated protein MRP1.
Cancer Metastasis Rev. 2007 Mar;26(1):15-37., [PMID:17295059]

Abstract [show]
Over a million new cases of cancers are diagnosed each year in the United States and over half of these patients die from these devastating diseases. Thus, cancers cause a major public health problem in the United States and worldwide. Chemotherapy remains the principal mode to treat many metastatic cancers. However, occurrence of cellular multidrug resistance (MDR) prevents efficient killing of cancer cells, leading to chemotherapeutic treatment failure. Numerous mechanisms of MDR exist in cancer cells, such as intrinsic or acquired MDR. Overexpression of ATP-binding cassette (ABC) drug transporters, such as P-glycoprotein (P-gp or ABCB1), breast cancer resistance protein (BCRP or ABCG2) and/or multidrug resistance-associated protein (MRP1 or ABCC1), confers an acquired MDR due to their capabilities of transporting a broad range of chemically diverse anticancer drugs. In addition to their roles in MDR, there is substantial evidence suggesting that these drug transporters have functions in tissue defense. Basically, these drug transporters are expressed in tissues important for absorption, such as in lung and gut, and for metabolism and elimination, such as in liver and kidney. In addition, these drug transporters play an important role in maintaining the barrier function of many tissues including blood-brain barrier, blood-cerebral spinal fluid barrier, blood-testis barrier and the maternal-fetal barrier. Thus, these ATP-dependent drug transporters play an important role in the absorption, disposition and elimination of the structurally diverse array of the endobiotics and xenobiotics. In this review, the molecular mechanism of ATP-dependent solute transport by MRP1 will be addressed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
259 In contrast, mutation of the Walker A motif K1333 residue in NBD2, such as K1333L [40, 141, 148], K1333M [16, 63, 118], K1333R [61] or K1333E [61], mainly affected ATP binding (at 4°C) at the mutated NBD2 [61, 148] and significantly decreased the ATP hydrolysis at the mutated NBD2 [61, 148]. Login to comment