ABCMdb

ABCC2 p.Gln1382Arg

ClinVar:	c.4145A>G , p.Gln1382Arg D , Pathogenic
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), R: N (82%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] The identification of two germ-line mutations in t... Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21. Yoshioka S, Katayama K, Okawa C, Takahashi S, Tsukahara S, Mitsuhashi J, Sugimoto Y
The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein.
Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21., [PMID:17373578]

Abstract [show]
PURPOSE: We examined the effects of the nine nonsynonymous germ-line mutations/SNPs in the breast cancer resistance protein (BCRP/ABCG2) gene on the expression and function of the protein. MATERIALS AND METHODS: We generated cDNAs for each of these mutants (G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP) and compared the effects of their exogenous expression in PA317 cells with a wild-type control. RESULTS: PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65kDa), which is slightly smaller than wild-type (70kDa), but this mutant did not appear on the cell surface or confer drug resistance. PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products. In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38. PA/T153M cells (C458T BCRP-transfectants) and PA/D620N cells (G1858A BCRP-transfectants) expressed lower amounts of BCRP and showed lower levels of resistance to SN-38 compared with PA/WT cells. CONCLUSIONS: We have shown that T623C BCRP encodes a non-functional BCRP and that T1291C BCRP encodes a low-functional BCRP. Hence, these mutations may affect the pharmacokinetics of BCRP substrates in patients harboring these alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
157 Q1382R MRP2 is a mutation Fig. 4. Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

[hide] The MRP-related and BCRP/ABCG2 multidrug resistanc... Curr Drug Metab. 2004 Feb;5(1):21-53. Haimeur A, Conseil G, Deeley RG, Cole SP
The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation.
Curr Drug Metab. 2004 Feb;5(1):21-53., [PMID:14965249]

Abstract [show]
Several members of different families of the ATP-binding cassette (ABC) superfamily of transport proteins are capable of transporting an extraordinarily structurally diverse array of endo- and xenobiotics and their metabolites across cell membranes. Together, these transporters play an important role in the absorption, disposition and elimination of these chemicals in the body. In tumor cells, increased expression of these drug transporters is associated with resistance to multiple chemotherapeutic agents. In this review, current knowledge of the biochemical, physiological and pharmacological properties of nine members of the multidrug resistance protein (MRP)-related ABCC family (MRP1, MRP2, MRP3, MRP4, MRP5, MRP6, MRP7, ABCC11 and ABCC12) as well as the G family member, ABCG2/BCRP, are summarized. A focus is placed on the structural similarities and differences of these drug transporters as well as the molecular determinants of their substrate specificities and transport activities. Factors that regulate expression of the MRP-related proteins and ABCG2/BCRP are also reviewed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
373 These include Arg768Trp and Gln1382Arg which have been recently characterized in vitro [275]. Login to comment
376 Inhibitors of MRP2 have been described but few, if any, are known to be highly specific for this transporter alone. studies showed that the maturation and apical localization of the NBD1 MRP2-Arg768Trp mutant was deficient while substrate-induced ATP hydrolysis was impaired in the NBD2 MRP2-Gln1382Arg mutant. Login to comment

[hide] Polymorphisms of MRP1 (ABCC1) and related ATP-depe... Pharmacogenet Genomics. 2005 Aug;15(8):523-33. Conseil G, Deeley RG, Cole SP
Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters.
Pharmacogenet Genomics. 2005 Aug;15(8):523-33., [PMID:16006996]

Abstract [show]
Genetic variations in drug metabolizing enzymes and targets are established determinants of adverse drug reactions and interactions, but less is known about the role of genetic polymorphisms in membrane transport proteins. MRP1 (ABCC1) is one of 13 polytopic membrane proteins that comprise the 'C' subfamily of the ATP-binding cassette (ABC) superfamily of transport proteins. MRP1 and related ABCC family members, including MRP2, 3, 4 and 5 (ABCC2, 3, 4 and 5), each have a distinctive pattern of tissue expression and substrate specificity. Together, these five transporters play important roles in the disposition and elimination of drugs and other organic anions, and in maintenance of blood-tissue barriers, as confirmed by enhanced chemosensitivity of respective knockout mice. Moreover, Mrp2 (Abcc2) deficient animals display mild conjugated hyperbilirubinemia, corresponding to a human condition known as Dubin-Johnson syndrome (DJS). Naturally occurring mutations in MRP/ABCC-related drug transporters have been reported, some of which are non-synonymous single nucleotide polymorphisms. The consequences of the resulting amino acid changes can sometimes be predicted from in vitro site-directed mutagenesis studies or from knowledge of mutations of analogous (conserved) residues in ABCC proteins that cause DJS, Pseudoxanthoma elasticum (ABCC6), cystic fibrosis (CFTR/ABCC7) or persistent hyperinsulinemic hypoglycemia of infancy (SUR1/ABCC8). Continual updating of databases of sequence variants and haplotype analysis, together with in vitro biochemical validation assays and pharmacological studies in knockout animals, should make it possible to determine how genetic variation in the MRP-related transporters contributes to the range of responses to drugs and chemicals observed in different human populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
157 For example, homozygous DJS mutations Arg768Trp (C2302T) and Gln1382Arg (A4145G) are located in NBD1 and NBD2, respectively, and in vitro studies have shown that both mutations have substantial phenotypic consequences [40]. Login to comment
158 Thus, the Arg768Trp mutation impairs maturation and sorting of MRP2 to the apical membrane, whereas the Gln1382Arg mutation decreases organic anion (LTC4) transport and substrate-induced ATP hydrolysis [45]. Login to comment

[hide] A T3587G germ-line mutation of the MDR1 gene encod... Mol Cancer Ther. 2006 Apr;5(4):877-84. Mutoh K, Mitsuhashi J, Kimura Y, Tsukahara S, Ishikawa E, Sai K, Ozawa S, Sawada J, Ueda K, Katayama K, Sugimoto Y
A T3587G germ-line mutation of the MDR1 gene encodes a nonfunctional P-glycoprotein.
Mol Cancer Ther. 2006 Apr;5(4):877-84., [PMID:16648557]

Abstract [show]
The human multidrug resistance gene 1 (MDR1) encodes a plasma membrane P-glycoprotein (P-gp) that functions as an efflux pump for various structurally unrelated anticancer agents. We have identified two nonsynonymous germ-line mutations of the MDR1 gene, C3583T MDR1 and T3587G MDR1, in peripheral blood cell samples from Japanese cancer patients. Two patients carried the C3583T MDR1 allele that encodes H1195Y P-gp, whereas a further two carried T3587G MDR1 that encodes I1196S P-gp. Murine NIH3T3 cells were transfected with pCAL-MDR-IRES-ZEO constructs carrying either wild-type (WT), C3583T, or T3587G MDR1 cDNA and selected with zeocin. The resulting zeocin-resistant mixed populations of transfected cells were designated as 3T3/WT, 3T3/H1195Y, and 3T3/I1196S, respectively. The cell surface expression of I1196S P-gp in 3T3/I1196S cells could not be detected by fluorescence-activated cell sorting, although low expression of I1196S P-gp was found by Western blotting. H1195Y P-gp expression levels in 3T3/H1195Y cells were slightly lower than the corresponding WT P-gp levels in 3T3/WT cells. By immunoblotting analysis, both WT P-gp and H1195Y P-gp were detectable as a 145-kDa protein, whereas I1196S P-gp was visualized as a 140-kDa protein. 3T3/I1196S cells did not show any drug resistance unlike 3T3/H1195Y cells. Moreover, a vanadate-trap assay showed that the I1196S P-gp species lacks ATP-binding activity. Taken together, we conclude from these data that T3587G MDR1 expresses a nonfunctional P-gp and this is therefore the first description of such a germ-line mutation. We contend that the T3587G MDR1 mutation may affect the pharmacokinetics of MDR1-related anticancer agents in patients carrying this allele.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
191 Q1382R MRP2, a mutation that is located between the Walker A and the signature C regions of the second ATP-binding site, results in a lack of ATP hydrolysis activity (36). Login to comment

[hide] Genetic association analysis of transporters ident... Pharmacogenet Genomics. 2012 Jun;22(6):447-65. Grover S, Gourie-Devi M, Bala K, Sharma S, Kukreti R
Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs.
Pharmacogenet Genomics. 2012 Jun;22(6):447-65., [PMID:22565165]

Abstract [show]
OBJECTIVE: The ATP-binding cassette (ABC) superfamily of transporters is known to efflux antiepileptic drugs (AEDs) primarily in the brain, gastrointestinal tract, liver, and kidneys. In addition, they are also known to be involved in estrogen disposition and may modulate seizure susceptibility and drug response. The objective of the present study was to investigate the role of genetic variants from ABC transporters in seizure control in epilepsy patients treated with monotherapy of first-line AEDs for 12 months. METHODS: On the basis of gene coverage and functional significance, a total of 98 single nucleotide polymorphisms from ABCB1, ABCC1, and ABCC2 were genotyped in 400 patients from North India. Of these, 216 patients were eligible for therapeutic assessment. Genetic variants were compared between the 'no-seizures' and the 'recurrent-seizures' groups. Bonferroni corrections for multiple comparisons and adjustment for covariates were performed before assessment of associations. RESULTS: Functionally relevant promoter polymorphisms from ABCC2: c.-1549G>A and c.-1019A>G either considered alone or in haplotype and diplotype combinations were observed for a significant association with seizure control in women (odds ratio>3.5, P<10, power>95%). Further, low protein-expressing CGT and TGT (c.-24C>T, c.1249G>A, c.3972C>T) haplotypes were always observed to be present in combination with the AG (c.-1549G>A, c.-1019A>G) haplotype that was over-represented in women with 'no seizures'. CONCLUSION: The distribution of the associated variants supports the involvement of ABCC2 in controlling seizures in women possibly by lowering of its expression. The biological basis of this finding could be an altered interaction of ABCC2 with AEDs and estrogens. These results necessitate replication in a larger pool of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
116 Of all the blocks, block 1 (rs1885301-rs2804402) in the promoter region and Table 2 (continued) N dbSNP ida Positionb Allelesc Gene location (effect) Function MAF 33 rs3758395 chr10:101602004 c.3741 + 154T > C Intron 26 0.190 34 rs17216177 chr10:101603522 c.3742 - 34T > C Intron 26 0.000 35 rs3740066 chr10:101604207 c.3972C > T Exon 28 (Ile1324Ile) m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of irinotecan (ABCC2*2 containing C allele) [34] 0.327 36 rs72558202 chr10:101605538 c.4145A > G Exon 29 (Gln1382Arg) 0.000 37 rs3740065 chr10:101605693 c.4146 + 154A > G Intron 29 0.211 38 rs56296335 chr10:101610393 c.4348G > C Exon 31 (Ala1450Ser) k Activity, kexpression and impaired membrane localization [40] 0.000 39 rs3740063 chr10:101610723 c.4508 + 170T > C Intron 31 0.345 40 rs8187710 chr10:101611294 c.4544G > A Exon 32 (Cys1515Tyr) m Expression [41] 0.017 452 Pharmacogenetics and Genomics 2012, Vol 22 No 6 block 2 (rs4919395-rs2756104-rs4148385-rs2180990- rs35191126) spanning introns 1 and 2, separated by a 1.5 kb region, were smaller spanning .5 and 6 kb regions, respectively. Login to comment

[hide] Mutational analysis of ABCC2 gene in two siblings ... Clin Genet. 2010 Dec;78(6):598-600. doi: 10.1111/j.1399-0004.2010.01497.x. Pacifico L, Carducci C, Poggiogalle E, Caravona F, Antonozzi I, Chiesa C, Maggiore G
Mutational analysis of ABCC2 gene in two siblings with neonatal-onset Dubin Johnson syndrome.
Clin Genet. 2010 Dec;78(6):598-600. doi: 10.1111/j.1399-0004.2010.01497.x., [PMID:21044052]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 The study of allelic segregation in Letter to the Editor R100X R393W IVS6_IVS7del L441M IVS13 +2 T>A IVS15 +2 T>C G676R IVS18 +2 T>C R768W * 2748_2883del * R1066X * 3399_3400del L1173F 3615_3843del* Y1275X * R1310X Q1382R R1392_M1393del S325X W709R T1273A IVS8 +4 A>G 1256_1272delins CT 4292_4293delR1150H E1352Q * Exon 1 32 Fig. 1. Login to comment

[hide] ABCC2/Abcc2: a multispecific transporter with domi... Drug Metab Rev. 2010 Aug;42(3):402-36. Jemnitz K, Heredi-Szabo K, Janossy J, Ioja E, Vereczkey L, Krajcsi P
ABCC2/Abcc2: a multispecific transporter with dominant excretory functions.
Drug Metab Rev. 2010 Aug;42(3):402-36., [PMID:20082599]

Abstract [show]
ABCC2/Abcc2 (MRP2/Mrp2) is expressed at major physiological barriers, such as the canalicular membrane of liver cells, kidney proximal tubule epithelial cells, enterocytes of the small and large intestine, and syncytiotrophoblast of the placenta. ABCC2/Abcc2 always localizes in the apical membranes. Although ABCC2/Abcc2 transports a variety of amphiphilic anions that belong to different classes of molecules, such as endogenous compounds (e.g., bilirubin-glucuronides), drugs, toxic chemicals, nutraceuticals, and their conjugates, it displays a preference for phase II conjugates. Phenotypically, the most obvious consequence of mutations in ABCC2 that lead to Dubin-Johnson syndrome is conjugate hyperbilirubinemia. ABCC2/Abcc2 harbors multiple binding sites and displays complex transport kinetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Interestingly, two missense mutations, R768W and Q1382R, of the nucleotide-binding domains (NBDs) behaved differently. Login to comment
88 Pulse-chase analysis revealed that the precursor forms of the wild type and Q1382R ABCC2 fully matured, as they were resistant to endoglycosidase H (Endo H). Login to comment

[hide] The apical conjugate efflux pump ABCC2 (MRP2). Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18. Nies AT, Keppler D
The apical conjugate efflux pump ABCC2 (MRP2).
Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18., [PMID:16847695]

Abstract [show]
ABCC2 is a member of the multidrug resistance protein subfamily localized exclusively to the apical membrane domain of polarized cells, such as hepatocytes, renal proximal tubule epithelia, and intestinal epithelia. This localization supports the function of ABCC2 in the terminal excretion and detoxification of endogenous and xenobiotic organic anions, particularly in the unidirectional efflux of substances conjugated with glutathione, glucuronate, or sulfate, as exemplified by leukotriene C(4), bilirubin glucuronosides, and some steroid sulfates. The hepatic ABCC2 pump contributes to the driving forces of bile flow. Acquired or hereditary deficiency of ABCC2, the latter known as Dubin-Johnson syndrome in humans, causes an increased concentration of bilirubin glucuronosides in blood because of their efflux from hepatocytes via the basolateral ABCC3, which compensates for the deficiency in ABCC2-mediated apical efflux. In this article we provide an overview on the molecular characteristics of ABCC2 and its expression in various tissues and species. We discuss the transcriptional and posttranscriptional regulation of ABCC2 and review approaches to the functional analysis providing information on its substrate specificity. A comprehensive list of sequence variants in the human ABCC2 gene summarizes predicted and proven functional consequences, including variants leading to Dubin-Johnson syndrome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment

[hide] Identification of a novel 974C-->G nonsense mutati... Am J Gastroenterol. 2006 Oct;101(10):2427-32. Epub 2006 Sep 4. Corpechot C, Ping C, Wendum D, Matsuda F, Barbu V, Poupon R
Identification of a novel 974C-->G nonsense mutation of the MRP2/ABCC2 gene in a patient with Dubin-Johnson syndrome and analysis of the effects of rifampicin and ursodeoxycholic acid on serum bilirubin and bile acids.
Am J Gastroenterol. 2006 Oct;101(10):2427-32. Epub 2006 Sep 4., [PMID:16952291]

Abstract [show]
Rifampicin (RIF) and ursodeoxycholic acid (UDCA) therapies have beneficial effects in chronic cholestatic diseases. These may result in part from the induction of multidrug-resistance protein 2 (MRP2/ABCC2) expression in the liver and kidney. However, the precise mechanisms by which RIF and UDCA act in cholestasis remain unclear. In the present study, we report the effects of chronic administration of both drugs in a patient with Dubin-Johnson syndrome (DJS), an inherited autosomal recessive disorder characterized by the absence of functional MRP2 protein at the canalicular hepatocyte membrane. A novel 974C-->G nonsense mutation was identified in the MRP2 gene sequence from this patient. RIF induced further increase in conjugated bilirubinemia, whereas concomitant administration of RIF and UDCA led to a dramatic rise in serum bile acid concentrations. These biochemical effects, which are in marked contrast to those observed in cholestatic settings, were concomitant with an increased MRP3, but not MRP4, expression on basolateral hepatocyte membrane. Such findings highlight the key role of MRP2 in the pharmacological properties of RIF and UDCA and suggest that both drugs should be used with caution in pathologic settings in which MRP2 expression may be downregulated, as in advanced stage of cholestatic diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Mutations in the MRP2/ABCC2 Gene Associated with DJS Nucleotide Mutation Exon Predicted Effect Reference 298C→T 3 R100X 27 974C→G 8 S325X This article IVS8 + 4A→G Intron 8 Aberrant splicing 28 1177C→T 9 R393W 29 1256insCT/ delAAACAG TGAACCT- GATG 10 Frameshift 30 1271A→G 10 R412G 31 1815 + 2T→A 13 Skipped exon 32, 33 1967 + 2T→C 15 Skipped exon 34, 35 2026G→C 16 G676R 35 2125T→C 17 W709R 36 2302C→T 18 R768W 32, 37, 38 2439 + 2T→C 18 Skipped exon 32, 35, 37 3196C→T 23 R1066X 39, 40 3449G→A 25 R1150H 41 3517A→T 25 I1173F 41 3928C→T 28 R1310X 27, 33 4145A→G 29 Q1382R 37 4175delGGATGA 30 R1392 + M1393 deletion 40 4292delCA 30 Frameshift 30 DISCUSSION Identification of a Novel Nonsense Mutation of the MRP2/ABCC2 Gene Up to now, 18 mutations in the sequence of the MRP2/ABCC2 gene have been reported in DJS, including nonsense mutations, deletions, splicing junction mutations, and missense mutations (Table 1). Login to comment

[hide] Single nucleotide polymorphisms in ABCC2 and ABCB1... Cancer Lett. 2006 Mar 8;234(1):40-50. Epub 2005 Dec 27. Wada M
Single nucleotide polymorphisms in ABCC2 and ABCB1 genes and their clinical impact in physiology and drug response.
Cancer Lett. 2006 Mar 8;234(1):40-50. Epub 2005 Dec 27., [PMID:16377077]

Abstract [show]
Among the ABC proteins, some members including ABCB1, ABCC1, ABCC2 and ABCG2 are believed to contribute to multidrug resistance of cancer chemotherapy. In addition, the broad substrate-specificity and apical localization of the ABCB1 and ABCC2 in mucosal epithelium of intestine and hepatocyte give them a protective role against xenobiotics. The inter-individual variations in activity and expression levels of ABCB1 and ABCC2, thus, might affect on drug response and response to toxic substrates. In this review, I focus on (1) physiological and toxicological relevance of ABCB1 and ABCC2, and on (2) genetic variations of ABCB1 and ABCC2 genes and their association with biochemical function, expression level and tumor incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 In Japan, the expected number of Table 1 Summary of mutations identified in Dubin-Johnson syndrome (DJS) Mutation Exon IVS Amino acid alteration Reference 298COT 3 R100X a,b 1815C 2TOA 13 Exon13 skip [38] 1967C 2TOC 15 Exon15 skip [62] 2026GOC 16 G676R [92] 2302COT 18 R768W [49,91]c 2439C 2TOC 18 Exon18 skip [38]a,c 3196COT 23 R1066X [47] 3449GOA 25 R1150H [52] 3517AOT 25 I1173F [52] 3928COT 28 R1310X [50] 4145AOG 29 Q1382R [38] 4175- 4180del 30 RM1392-1393del [48] a Adachi and Wada, unpublished data. b Houkibara and Wada, unpublished data. Login to comment
60 [42] 29 4145AOG Q1382R NBD2 DJS (ATP hydrilysis) Not reported 0.1? Login to comment
73 Another missense mutation Q1382R in NBD2 was found in one DJS patient with compound heterozygous mutations (Table 2) [38]. Login to comment
74 The precursor form of the ABCC2 (Q1382R) was rapidly converted to the mature form, and sorted to the apical membrane of the LLC-PK1 cells as the wild type ABCC2. Login to comment
75 These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of ABCC2. Login to comment
76 However, efflux of glutathione conjugate of mono- chlorobimane (GS-MCLB) and ATP-dependent LTC4 uptake into plasma membrane vesicles derived from HEK293 cells expressing ABCC2 (Q1382R) was markedly reduced compared to that from cells expressing wild type ABCC2. Login to comment
77 This indicated that ABCC2 (Q1382R), although localized on the apical membrane, was nonfunctional. Login to comment
80 Vanadate-induced nucleotide trapping in the wild type ABCC2 was stimulated by the transporter substrate estradiol-glucuronide (E217bG), but that in ABCC2 (Q1382R) was not. Login to comment
83 These results suggest that 8-azido-[a-32 P]ATP is trapped together with vanadate after hydrolysis, and that the Q1382R mutation impaired substrate-induced ATP hydrolysis (Table 2). Login to comment
90 In our study, the lack of substrate-induced vanadate trapping in the ABCC2 (Q1382R) may suggest that Q1382 is directly involved in ATP hydrolysis [53]. Login to comment

[hide] Apical/basolateral surface expression of drug tran... Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22. Ito K, Suzuki H, Horie T, Sugiyama Y
Apical/basolateral surface expression of drug transporters and its role in vectorial drug transport.
Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22., [PMID:16180115]

Abstract [show]
It is well known that transporter proteins play a key role in governing drug absorption, distribution, and elimination in the body, and, accordingly, they are now considered as causes of drug-drug interactions and interindividual differences in pharmacokinetic profiles. Polarized tissues directly involved in drug disposition (intestine, kidney, and liver) and restricted distribution to naive sanctuaries (blood-tissue barriers) asymmetrically express a variety of drug transporters on the apical and basolateral sides, resulting in vectorial drug transport. For example, the organic anion transporting polypeptide (OATP) family on the sinusoidal (basolateral) membrane and multidrug resistance-associated protein 2 (MRP2/ABCC2) on the apical bile canalicular membrane of hepatocytes take up and excrete organic anionic compounds from blood to bile. Such vectorial transcellular transport is fundamentally attributable to the asymmetrical distribution of transporter molecules in polarized cells. Besides the apical/basolateral sorting direction, distribution of the transporter protein between the membrane surface (active site) and the intracellular fraction (inactive site) is of practical importance for the quantitative evaluation of drug transport processes. The most characterized drug transporter associated with this issue is MRP2 on the hepatocyte canalicular (apical) membrane, and it is linked to a genetic disease. Dubin-Johnson syndrome is sometimes caused by impaired canalicular surface expression of MRP2 by a single amino acid substitution. Moreover, single nucleotide polymorphisms in OATP-C/SLC21A6 (SLCO1B1) also affect membrane surface expression, and actually lead to the altered pharmacokinetic profile of pravastatin in healthy subjects. In this review article, the asymmetrical transporter distribution and altered surface expression in polarized tissues are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
237 Q1382R MRP2 was mainly localized on the apical membrane of transfected LLC-PK1 cells as wild-type MRP2. Login to comment
238 However, efflux of glutathione monochlorobimane and ATP-dependent leukotriene C4 uptake into plasma membrane vesicles from cells expressing Q1382R MRP2 were markedly reduced, suggesting that the Q1382R MRP2 on the apical membrane was nonfunctional (125). Login to comment

[hide] Dual hereditary jaundice: simultaneous occurrence ... Gastroenterology. 2005 Jul;129(1):315-20. Cebecauerova D, Jirasek T, Budisova L, Mandys V, Volf V, Novotna Z, Subhanova I, Hrebicek M, Elleder M, Jirsa M
Dual hereditary jaundice: simultaneous occurrence of mutations causing Gilbert's and Dubin-Johnson syndrome.
Gastroenterology. 2005 Jul;129(1):315-20., [PMID:16012956]

Abstract [show]
BACKGROUND & AIMS: Dubin-Johnson syndrome is recessively inherited, conjugated hyperbilirubinemia induced by mutations in the ABCC2/MRP2 gene encoding the canalicular transporter for conjugated bilirubin. Gilbert's syndrome is recessively inherited, unconjugated hyperbilirubinemia caused by decreased conjugation rate of bilirubin associated mostly with homozygous A(TA) 7 TAA variant of the TATAA-box in the UGT1A1 gene promoter. Our aim was to establish the molecular diagnosis in a 3-year-old male with atypical, intermittent, predominantly unconjugated, hyperbilirubinemia. METHODS: 99m Tc-HIDA cholescintigraphy was used for imaging the biliary tree. Expression of ABCC2/MRP2 protein in hepatocytes was investigated immunohistochemically. UGT1A1 and ABCC2/MRP2 genes were sequenced from genomic DNA, and the mutations were verified by fragment analysis, sequencing the cloned exons, and restriction fragment length polymorphism. RESULTS: Cholescintigraphy revealed delayed visualization of the gallbladder. A brown granular lipopigment differing from melanin-like pigment reported in Dubin-Johnson syndrome was present in hepatocytes, but, otherwise, liver histology was normal. ABCC2/MRP2 protein was not detected on the canalicular membrane of hepatocytes, and 2 novel mutations were found in the ABCC2/MRP2 gene: a heterozygous in-frame insertion-deletion mutation 1256insCT/delAAACAGTGAACCTGATG in exon 10 inherited from the father and a heterozygous deletion 4292delCA in exon 30 inherited from the mother. In addition, the patient was homozygous for -3279T>G and A(TA) 7 TAA mutations in the UGT1A1 gene promoter. CONCLUSIONS: Our patient represents a case of digenic mixed hyperbilirubinemia-a distinct type of constitutive jaundice resulting from coinherited defects in ABCC2/MRP2 and UGT1A1 genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 4145AϾG 29 Q1382R Toh S et al, Am J Hum Genet 1999;64:739-746. Login to comment

[hide] Identification of a novel 2026G-->C mutation of th... J Hum Genet. 2003;48(8):425-9. Epub 2003 Jul 22. Wakusawa S, Machida I, Suzuki S, Hayashi H, Yano M, Yoshioka K
Identification of a novel 2026G-->C mutation of the MRP2 gene in a Japanese patient with Dubin-Johnson syndrome.
J Hum Genet. 2003;48(8):425-9. Epub 2003 Jul 22., [PMID:12884082]

Abstract [show]
Dubin-Johnson syndrome is a recessive inherited disorder with conjugated hyperbilirubinemia caused by a dysfunction of multidrug resistance protein 2 (MRP2) on the canalicular membrane of hepatocytes. A mutational analysis of the MRP2 gene was carried out in three Japanese patients and their family members. In two patients, the homozygous mutations c.1901del67 and c,2272del168 were found. In the third patient, a -24C-->T polymorphism and the two mutations c.1901del67 and 2026G-->C were detected. The 2026G-->C mutation was a novel mutation in exon 16 affecting the conversion of Gly(676) to Arg(676) (G676R) in the MRP2 protein, and was not detected in fifty healthy volunteers. The G676R mutation was located in the Walker A motif of the first nucleotide binding domain in the MRP2 protein, and it was suggested that the mutation induced the dysfunction of the MRP2 protein. It was concluded that the compound heterozygosity of the two mutations of the MRP2 gene in the third patient contributed to the induction of hyperbilirubinemia in this case.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 With respect to the polymorphism )24C fi T, we also employed a restriction enzyme assay with BbsI; the results showed that his spouse and one daughter were heterozygous for this SNP, but other Table 1 Mutations of MRP2 in Dubin-Johnson syndrome (DJS) Nucleotide mutation Predicted effects References Splice site mutation 1815+2T fi A 1669del147 (exon13 skipping) Wada et al. 1998 1967+2T fi C 1901del67 (exon15 skipping) Kajihara et al. 1998 2439+2T fi C 2272del168 (exon18 skipping) Toh et al. 1999 Deletion mutation Del4170-5 Del R1392 , M1393 Tsujii et al. 1999 Missense mutation 2302C fi T R768 W Wada et al. 1998 3449G fi A R1150H Mor-Cohen et al. 2001 3517A fi T I1173F Mor-Cohen et al. 2001 4145A fi G Q1382R Toh et al. 1999 Nonesense mutation 3196C fi T R1066X Paulusma et al. 1997 3928C fi T R1310X Tate et al. 2002 family members did not possess it (Fig. 4). Login to comment
51 One of these mutations (R768 W) is located within the first Walker C motif, and the other (Q1382R) lies within the second ABC (Toh Table 2 Mutations of the MRP2 gene in DJS patients and family members (wild wild-type, nd not determined) a C child, S siblings Patients and family Bilirubin (mg/dl) Alteration in MRP2 gene Predicted effects membersa Total Conjugated 1 DJ1 2.7 1.8 2439+2T fi C/2439+2T fi C 2272del168/2272del168 DJ1/C1 0.6 0.2 2439+2T fi C/wild 2272del168/wild DJ1/C2 0.6 0.2 2439+2T fi C/wild 2272del168/wild 2 DJ2 3.0 2.4 1967+2T fi C/1967+2T fi C 1901del67/1901del67 DJ2/S1 0.4 0.1 1967+2T fi C/wild 1901del67/wild DJ2/S2 0.5 0.2 Wild/wild ) DJ2/C1 0.8 0.2 1967+2T fi C/wild 1901del67/wild 3 DJ3 3.4 2.8 1967+2T fi C/2026G fi C 1901del67/G676R DJ3/S1 0.8 0.3 Wild/wild ) DJ3/S2 0.9 0.3 Wild/wild ) DJ3/S3 0.9 0.3 Wild/wild ) DJ3/S4 0.9 0.3 1967+2T fi C/wild 1901del67/wild DJ3/S5 0.3 0.1 Wild/wild ) DJ3/S6 1.3 0.6 1967+2T fi C/wild 1901del67/wild DJ3/C1 nd nd 1967+2T fi C/wild 1901del67/wild DJ3/C2 0.7 0.3 1967+2T fi C/wild 1901del67/wild Fig. 2 Sequencing analysis of exon 16 in the MRP2 gene from DJ3 (arrow site of the heterozygous missense mutation 2026G fi C). Login to comment

[hide] Trafficking and functional defects by mutations of... Hepatology. 2002 Nov;36(5):1236-45. Hashimoto K, Uchiumi T, Konno T, Ebihara T, Nakamura T, Wada M, Sakisaka S, Maniwa F, Amachi T, Ueda K, Kuwano M
Trafficking and functional defects by mutations of the ATP-binding domains in MRP2 in patients with Dubin-Johnson syndrome.
Hepatology. 2002 Nov;36(5):1236-45., [PMID:12395335]

Abstract [show]
Dubin-Johnson syndrome (DJS) is a hereditary disease characterized by hyperbilirubinemia. We investigated the consequences of 2 missense mutations, R768W and Q1382R, of nucleotide-binding domains (NBDs) of the multidrug resistance protein 2 (MRP2; ABCC2) that were previously identified in patients with DJS. Pulse chase analysis revealed that the precursor form of the wild-type and Q1382R MRP2 were converted to the mature form, which is resistant to endoglycosidase H (Endo H) in about 60 minutes. However, the precursor form of the R768W MRP2, which is sensitive to endoglycosidase H, was degraded within 120 minutes and did not mature to the fully glycosylated form. Proteasome inhibitors inhibited the degradation of the precursor form of the R768W MRP2. Unlike the R768W MRP2, the Q1382R MRP2 was mainly localized on the apical membrane in the wild-type form. However, efflux of glutathione monochlorobimane (GS-MCLB) and ATP-dependent leukotriene C(4) (LTC(4)) uptake into plasma membrane vesicles from cells expressing the Q1382R MRP2 were markedly reduced, suggesting that the Q1382R MRP2 on the apical membrane was nonfunctional. Vanadate-induced nucleotide trapping with 8-azido-[alpha-32P]ATP in the wild-type MRP2 was stimulated by estradiol glucuronide (E(2)17betaG) in a concentration-dependent manner but that in the Q1382R MRP2 was not. In conclusion, the R768W mutation causes deficient maturation and impaired sorting, and the Q1382R mutation does not affect maturation or sorting but impairs the substrate-induced ATP hydrolysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 We investigated the consequences of 2 missense mutations, R768W and Q1382R, of nucleotide-binding domains (NBDs) of the multidrug resistance protein 2 (MRP2; ABCC2) that were previously identified in patients with DJS. Login to comment
2 Pulse chase analysis revealed that the precursor form of the wild-type and Q1382R MRP2 were converted to the mature form, which is resistant to endoglycosidase H (Endo H) in about 60 minutes. Login to comment
5 Unlike the R768W MRP2, the Q1382R MRP2 was mainly localized on the apical membrane in the wild-type form. Login to comment
6 However, efflux of glutathione monochlorobimane (GS-MCLB) and ATP-dependent leukotriene C4 (LTC4) uptake into plasma membrane vesicles from cells expressing the Q1382R MRP2 were markedly reduced, suggesting that the Q1382R MRP2 on the apical membrane was nonfunctional. Login to comment
7 Vanadate-induced nucleotide trapping with 8-azido-[␣-32P]ATP in the wild-type MRP2 was stimulated by estradiol glucuronide (E217betaG) in a concentration-dependent manner but that in the Q1382R MRP2 was not. Login to comment
8 In conclusion, the R768W mutation causes deficient maturation and impaired sorting, and the Q1382R mutation does not affect maturation or sorting but impairs the substrate-induced ATP hydrolysis. Login to comment
28 The mutants R768W, Q1382R, and K677R were generated from pBS-MRP2.20 To generate these mutant MRPs, site-directed mutagenesis was carried out using a PCR-based method.21 The following primers were used to generate specific mutations: for R768W, the 5Ј-oligonucleotides MRP2-2,302 (5Ј-CAGAAGCAGCGGAT- CAGC; corresponding to the native MRP2 sequence) and R768W-MRP2 (5Ј- CAGAAGCAGTGGAT- CAGCCTG); for Q1382R, the 5Ј-oligonucleotides MRP2-4,555 (5Ј-CATCCCCCAGGACCCCATC; corresponding to the native MRP2 sequence) and Q1382R- MRP2 (5Ј- CATCCCCCGGGACCCCATC); and, for K677R, the 5Ј-oligonucleotides MRP2-2,030 (5Ј- GGCTCTGGGAAATCCTCCTTG; corresponding to the native MRP2 sequence) and K677R-MRP2 (5Ј- GGCTCTGGGAGATCCTCCTTG). Login to comment
39 In brief, 20, 20, 200, and 200 ␮g total protein from LLC-PK1 cells expressing the wild-type, Q1382R, K677R, and R768W MRP2 were treated with 1,000 units of each enzyme for 1 hour at 37°C, respectively. Login to comment
56 Plasma membrane vesicles were prepared from HEK293 cells expressing the wild-type and Q1382R MRP2 according to the method of Cornwell et al.30 with some modifications as described previously.22 ATP-dependent uptake of [3H] LTC4 into the inside-out membrane vesicles was measured by a rapid filtration technique22,30 with some modifications. Login to comment
60 Vanadate trapping of 8-azido-ATP and subsequent photoaffinity labeling were performed as described previously.31 Membrane proteins (2 ␮g) from the stable transfectants of wild-type MRP2, Q1382R MRP2, and empty vector in HEK293 cells were suspended with the assay solution including 1 mmol/L vanadate and estradiol glucuronide (E217betaG) at each concentration. Login to comment
63 We recently identified a missense mutation 2,302 (C3T) R768W in NBD1 in 3 DJS families and another missense mutation 4,145 (A3G) Q1382R in NBD2 in one DJS family (Fig. 1).12,13 Paraffin-embedded liver sections from a patient with R768W mutation were examined for the presence of the MRP2 and P-glycoprotein using monoclonal antibodies. Login to comment
66 Location of the DJS-associated mutations, R768W and Q1382R, in a MRP2. Login to comment
77 We were unable to examine whether the Q1382R MRP2 was expressed in the canalicular membrane of hepatocytes because no bioptic sample was available. Login to comment
79 To investigate the effect of these DJS-associated mutations on the processing, localization, and function of MRP2, we introduced the 2 DJS-associated mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R into the MRP2 cDNA. Login to comment
81 LLC-PK1 and HEK293 cell lines that stably express the wild-type MRP2 or each mutant MRP2 (R768W, Q1382R, and K677R) were established. Login to comment
83 The antibody M2I-4 detected a 190 to 210 kd diffused band, probably mature and glycosylated protein (designated as M) of the wild-type and Q1382R MRP2 (Fig. 3A). Login to comment
84 The antibody M2III-6, raised against the C-terminal region, recognized the wild-type MRP2 efficiently but the Q1382R MRP2 only weakly (Fig. 3B). Login to comment
85 The Q1382R mutation changed the epitope to reduce the reactivity to the antibody, although it did not affect the maturation process. Login to comment
95 LLC-PK1 cells stably expressing the wild-type human MRP2 and the mutant MRP (Q1382R, R768W, or K677R) were solubilized and analyzed by Western blot analysis with monoclonal antibodies M2I-4 (A) and M2III-6 (B). Login to comment
98 The cell lysates from LLC-PK1 cells expressing the wild-type and Q1382R MRP2 (20 ␮g) or from cells expressing the R768W and K677R MRP2 (200 ␮g) were treated with Endo H or PNGaseF and analyzed by Western blot analysis with monoclonal antibodies M2I-4. Login to comment
100 wild-type and Q1382R MRP2 (band M) were resistant to Endo H, suggesting that they did not contain high mannose oligosaccharides but complex oligosaccharides and reached the trans-Golgi complex. Login to comment
104 The 175-kd form (band P) of the wild-type and Q1382R MRP2 were converted to the 190-kd form (band M) time dependently, and the conversion was almost completed in 60 minutes. Login to comment
115 On the other hand, the Q1382R MRP2 protein, which is modified with complex oligosaccharides, predominantly localized to the cell surface, especially to the apical membrane, with a distribution similar to that of the wild-type MRP2 (Fig. 6B). Login to comment
116 Q1382R Mutation Impairs Transport of GS-MCLB. Login to comment
117 Because Q1382R caused no apparent deficiency in the protein maturation process or apical sorting pro- Fig. 4. Login to comment
131 In stable HEK293 transfectants, as in stable LLC-PK1 transfectants (Fig. 3A), the Q1382R mutation did not affect the expression and maturation of MRP2, whereas the R768W and K677R MRP2 did not mature properly, and their expression levels were low (Fig. 7A). Login to comment
134 Interestingly, the GS-MCLB efflux from HEK293 cells expressing the Q1382R MRP2 was even lower than that from control cells, although the Q1382R MRP2 localized on the apical membrane as the wild-type MRP2 (Fig. 7B). Login to comment
136 However, no decrease of fluorescence of intracellular GS-MCLB was observed in cells expressing the Q1382R MRP2 compared with the level in control cells (Fig. 7C). Login to comment
138 Taken together, these results suggest that Q1382R MRP2 localized on the apical membrane did not efflux GS-MCLB. Login to comment
139 Q1382R Mutation Impairs ATP-Dependent LTC4 Uptake Into Plasma Membrane Vesicles. Login to comment
140 Because GS-MCLB efflux could be affected by the velocity of conjugation in each transfectant, we also measured ATP-dependent LTC4 uptake into plasma membrane vesicles to examine transporter activity of the wild-type and Q1382R MRP2. Login to comment
141 Similar expression of MRP2 proteins was detected by Western blotting in plasma membrane vesicles from transfectants expressing wild-type and Q1382R MRP2 (Fig. 8A). Login to comment
144 Although the ATP-dependent uptake into membrane vesicles prepared from transfectants expressing the Q1382R MRP2 was also observed, it was as low as that into vesicles from the cells transfected by the empty vector, probably because of the activity of an endogenous ATP-dependent transport system. Login to comment
145 These results suggest that Q1382R MRP2 is deficient in ATP-dependent transport of LTC4. Login to comment
146 Q1382R Mutation Impairs Substrate Stimulation of Vanadate-Induced Nucleotide Trapping. Login to comment
147 It has been reported that MRP1 traps nucleotides and can be specifically photoaffinity labeled when crude membrane containing MRP1 is incubated with 8-azido-[␣-32P]ATP in the presence of excess vanadate.33,34 We examined whether human MRP2 also shows vanadate-induced nucleotide trapping (Fig. 9A) and, if so, whether the Q1382R mutation affects it (Fig. 9B). Login to comment
149 Crude membrane from HEK293 stable transfectants, which express similar levels of the wild-type and the Q1382R MRP2 (data not shown), was used for this experiment. Login to comment
153 (B) LLC-PK1 cells expressing the wild-type and Q1382R MRP2 were stained with the MRP2 antibody M2I-4. Login to comment
154 Vertical sections of LLC-PK1 cells expressing the wild-type and Q1382R MRP2 are shown in the lower panels. Login to comment
158 The Q1382R MRP2 was weakly photoaffinity labeled (Fig. 4™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™ Fig. 7. Login to comment
163 The symbols shown are as follows: wild type (F), empty vector (Œ), R768W (ϫ), K677R (ϩ), Q1382R (I). Login to comment
166 LTC4 uptake into plasma membrane vesicles prepared from HEK293 cells expressing the wild-type and Q1382R MRP2. Login to comment
169 The symbols shown are as follows: wild type (F, E), empty vector (Œ, ‚), Q1382R (I, ᮀ), in the presence of ATP (F, Œ, I) and AMP (E, ‚, ᮀ). Login to comment
173 Discussion We previously reported 2 missense mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R, and 2 splice donor site mutations, 2,439 ϩ 2 (T3C) and 1,815 ϩ 2 (T3A), in the MRP2 gene in patients with DJS.12,13 In the present study, we examined the molecular consequences and biochemical basis for the defect caused by the missense mutations, R768W and Q1382R, in NBDs. Login to comment
175 Interestingly, the other missense mutation Q1382R, located in NBD2, impaired substrate-induced ATP hydrolysis. Login to comment
176 We introduced 2 DJS-associated MRP2 mutations, R768W and Q1382R, and an artificial mutation, K677R, to the Walker A motif (Fig. 1). Login to comment
185 Vanadate-induced trapping of 8-azido-[␣-32P]ATP in the wild-type and Q1382R MRP2. Login to comment
186 Membrane proteins (2 ␮g) from HEK293 cells expressing the wild type (A), Q1382R MRP2 (B), and mock transfectant (C) were reacted with 10 ␮mol/L 8-azido-[␣-32P]ATP in the absence (lane 1) or presence of 1 mmol/L vanadate (lanes 2-5) and 10 ␮mol/L E217betaG (lane 3), 50 ␮mol/L E217betaG (lane 4), and 100 ␮mol/L E217betaG (lane 5) for 10 minutes at 37°C. Login to comment
190 The symbols shown are as follows: wild type (F), empty vector (Œ), and Q1382R (I). Login to comment
193 Another missense mutation, 4,145 (A3G) Q1382R, in NBD2 was found in one DJS patient with compound heterozygous mutants.13 The precursor form of the Q1382R MRP2 was rapidly converted to the mature form (Fig. 4), which was resistant to Endo H (Fig. 3C), and sorted to the apical membrane of the LLC-PK1 cells as the wild-type MRP2 (Fig. 6B). Login to comment
194 These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of MRP2. Login to comment
195 However, efflux of GS-MCLB and ATP-dependent LTC4 uptake into plasma membrane vesicles from HEK293 cells expressing the Q1382R MRP2 were markedly reduced compared with that from cells expressing the wild-type MRP2 (Figs. Login to comment
197 This indicated that the Q1382R MRP2 localized on the apical membrane was nonfunctional. Login to comment
198 To assess the functional integrity of the Q1382R MRP2, we examined vanadate-induced nucleotide trapping by using 8-azido-[␣-32P]ATP. Login to comment
200 Vanadate-induced nucleotide trapping in the wild-type MRP2 was stimulated by E217betaG in a concentration-dependent manner but that in Q1382R MRP2 was not (Fig. 9). Login to comment
203 These results suggest that 8-azido-[␣-32P]ATP is trapped with vanadate after hydrolysis and that the Q1382R mutation impaired substrate-induced ATP hydrolysis. Login to comment
207 However, the role of the glutamine in the Q-loop has been controversial because the correspondent glutamine residue in the malK molecule was suggested to be placed too far away from the nucleotide to coordinate Mg2ϩ and the water molecule that attacks the ␥-phosphate bond.40 In the present study, the lack of substrate-induced vanadate trapping in the Q1382R MRP2 may suggest that Q1382 is directly involved in ATP hydrolysis. Login to comment
208 In conclusion, introduction of a DJS mutation R768W as well as the Walker A lysine mutation K677R resulted in abortive maturation and sorting of MRP2, whereas another DJS mutation, Q1382R, did not affect maturation or sorting but impaired the substrate-induced ATP hydrolysis. Login to comment

[hide] Identification and functional analysis of two nove... J Biol Chem. 2001 Oct 5;276(40):36923-30. Epub 2001 Jul 26. Mor-Cohen R, Zivelin A, Rosenberg N, Shani M, Muallem S, Seligsohn U
Identification and functional analysis of two novel mutations in the multidrug resistance protein 2 gene in Israeli patients with Dubin-Johnson syndrome.
J Biol Chem. 2001 Oct 5;276(40):36923-30. Epub 2001 Jul 26., [PMID:11477083]

Abstract [show]
Dubin-Johnson syndrome (DJS) is an inherited disorder characterized by conjugated hyperbilirubinemia and is caused by a deficiency of the multidrug resistance protein 2 (MRP2) located in the apical membrane of hepatocytes. The aim of this study was to identify the mutations in two previously characterized clusters of patients with Dubin-Johnson syndrome among Iranian and Moroccan Jews and determine the consequence of the mutations on MRP2 expression and function by expression studies. All 32 exons and adjacent regions of the MRP2 gene were screened by polymerase chain reaction and DNA sequencing. Two novel mutations were identified in exon 25. One mutation, 3517A-->T, predicting a I1173F substitution, was found in 22 homozygous Iranian Jewish DJS patients from 13 unrelated families and a second mutation, 3449G-->A, predicting a R1150H substitution, was found in 5 homozygous Moroccan Jewish DJS patients from 4 unrelated families. Use of four intragenic dimorphisms and haplotype analyses disclosed a specific founder effect for each mutation. The mutations were introduced into an MRP2 expression vector by site-directed mutagenesis, transfected into HEK-293 cells, and analyzed by a fluorescence transport assay, immunoblot, and immunocytochemistry. Continuous measurement of probenecid-sensitive carboxyfluorescein efflux revealed that both mutations impaired the transport activity of MRP2. Immunoblot analysis and immunocytochemistry showed that MRP2 (R1150H) matured properly and localized at the plasma membrane of transfected cells. In contrast, expression of MRP2 (I1173F) was low and mislocated to the endoplasmic reticulum of the transfected cells. These findings provide an explanation for the DJS phenotype in these two patient groups. Furthermore, the close localization of the two mutations identify this region of MRP2 as important for both activity and processing of the protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
223 These mutations include two missense mutations (R768Y, Q1382R), a nonsense mutation (R1066stop), three splice site mutations (1815ϩ2, T3A; 1967ϩ2, T3C; 2439ϩ2, T3C) and a deletion mutation (4175del6). Login to comment

[hide] Genomic structure of the canalicular multispecific... Am J Hum Genet. 1999 Mar;64(3):739-46. Toh S, Wada M, Uchiumi T, Inokuchi A, Makino Y, Horie Y, Adachi Y, Sakisaka S, Kuwano M
Genomic structure of the canalicular multispecific organic anion-transporter gene (MRP2/cMOAT) and mutations in the ATP-binding-cassette region in Dubin-Johnson syndrome.
Am J Hum Genet. 1999 Mar;64(3):739-46., [PMID:10053008]

Abstract [show]
Dubin-Johnson syndrome (DJS) is an autosomal recessive disease characterized by conjugated hyperbilirubinemia. Previous studies of the defects in the human canalicular multispecific organic anion transporter gene (MRP2/cMOAT) in patients with DJS have suggested that the gene defects are responsible for DJS. In this study, we determined the exon/intron structure of the human MRP2/cMOAT gene and further characterized mutations in patients with DJS. The human MRP2/cMOAT gene contains 32 exons, and it has a structure that is highly conserved with that of another ATP-binding-cassette gene, that for a multidrug resistance-associated protein. We then identified three mutations, including two novel ones. All mutations identified to date are in the cytoplasmic domain, which includes the two ATP-binding cassettes and the linker region, or adjacent putative transmembrane domain. Our results confirm that MRP2/cMOAT is the gene responsible for DJS. The finding that mutations are concentrated in the first ATP-binding-cassette domain strongly suggests that a disruption of this region is a critical route to loss of function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 We previously had isolated the human MRP2/cMOAT gene as the candidate transporter for the glucuronide- Table 1 Mutations in MRP2/cMOAT and Serum Total- and Direct-Bilirubin and Urinary Coproporphyrine Isomer I Fractions, in Patients with DJS and in Their Families PEDIGREE AND PATIENT/ FAMILY MEMBER ALTERATION IN cMAOT EXON PUTATIVE CONSEQUENCE CONCENTRATION [NORMAL RANGE]a T-bilirubin [.3-1.0] (mg/dl) D-bilirubin [.1-.6] (mg/dl) Urinary Coproporphyrin I Fraction [!27]b (%) 1: DJ1 2302(CrT)/2302(CrT) 18 R768W/R768W 5.0 3.8 NT 2: DJ2 2302(CrT)/wild type 18 R768W/wild type NT NT 42.1 DJ3 2439ϩ2(TrC)/wild type 18 Splice donor/wild type NT NT 43.5 DJ4 2302(CrT)/2439ϩ2(TrC) 18 R768W/splice donor 1.3 .8 94.5 DJ5 2302(CrT)/2439ϩ2(TrC) 18 R768W/splice donor 1.3 .8 93.6 DJ6 Wild type/wild type ) Wild type/wild type NT NT NT 3: DJ7 1815ϩ2(TrA)/1815ϩ2(TrA) 13 Splice donor/splice donor 5.2 3.8 NT 4: DJ8 2302(CrT)/2302(CrT) 18 R768W/R768W 4.8 3.2 NT 5: DJ9 2439ϩ2(TrC)/4145(ArG) 18/29 Splice donor/Q1382R 2.5 1.6 80.0 6: DJ10 2439ϩ2(TrC)/2439ϩ2(TrC) 18 Splice donor/splice donor 2.1 1.6 85.7 DJ11 2439ϩ2(TrC)/wild type 18 Splice donor/wild type .9 .4 48.0 DJ12 2439ϩ2(TrC)/wild type 18 Splice donor/wild type .5 .2 36.9 a NT ϭ not tested. Login to comment
84 The third alteration resulted in amino acid substitution Q1382R in the position at the ABC region. Login to comment
104 The third mutation is 4145(ArG), which predicts amino acid change Gln1382 rArg (Q1382R) within the ABC at the carboxyl-terminal end. Login to comment

[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]

Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Mutations in the ATP-binding site also disrupt function, such as G1302R in the Pseudoxanthoma elasticum- associated ABCC6 gene.15 Finally, mutations such as the Dubin-Johnson syndrome-associated Q1382R in ABCC2 are in a mobile region of the NBD (the ''Q-loop``) that is hypothesized to transmit a conformational change between the NBDs and TMDs of an ABC transporter.16 While it is preferable to experimentally characterize the effects of each of the thousands of reported variants in ABC transporters, this approach is not feasible given the large number of variants. Login to comment

[hide] Structure, function, expression, genomic organizat... Int J Toxicol. 2006 Jul-Aug;25(4):231-59. Choudhuri S, Klaassen CD
Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters.
Int J Toxicol. 2006 Jul-Aug;25(4):231-59., [PMID:16815813]

Abstract [show]
The ATP-binding cassette (ABC) transporters constitute a large family of membrane proteins, which transport a variety of compounds through the membrane against a concentration gradient at the cost of ATP hydrolysis. Substrates of the ABC transporters include lipids, bile acids, xenobiotics, and peptides for antigen presentation. As they transport exogenous and endogenous compounds, they reduce the body load of potentially harmful substances. One by-product of such protective function is that they also eliminate various useful drugs from the body, causing drug resistance. This review is a brief summary of the structure, function, and expression of the important drug resistance-conferring members belonging to three subfamilies of the human ABC family; these are ABCB1 (MDR1/P-glycoprotein of subfamily ABCB), subfamily ABCC (MRPs), and ABCG2 (BCRP of subfamily ABCG), which are expressed in various organs. In the text, the transporter symbol that carries the subfamily name (such as ABCB1, ABCC1, etc.) is used interchangeably with the corresponding original names, such as MDR1P-glycoprotein, MRP1, etc., respectively. Both nomenclatures are maintained in the text because both are still used in the transporter literature. This helps readers relate various names that they encounter in the literature. It now appears that P-glycoprotein, MRP1, MRP2, and BCRP can explain the phenomenon of multidrug resistance in all cell lines analyzed thus far. Also discussed are the gene structure, regulation of expression, and various polymorphisms in these genes. Because genetic polymorphism is thought to underlie interindividual differences, including their response to drugs and other xenobiotics, the importance of polymorphism in these genes is also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
331 The two missence mutations were C2302T transition in exon 18, resulting in amino acid replacement Arg768Trp in the active transport family signature motif; and A4145G transition in exon 29, resulting in amino acid substitution Gln1382Arg in the position within the ABC signature motif at the C-terminal end. Login to comment