ABCC2 p.Lys677Arg
| Predicted by SNAP2: | A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Pharmacogenetics of intestinal absorption. Curr Drug Deliv. 2008 Jul;5(3):153-69. Nakamura T, Yamamori M, Sakaeda T
Pharmacogenetics of intestinal absorption.
Curr Drug Deliv. 2008 Jul;5(3):153-69., [PMID:18673259]
Abstract [show]
The small intestine is the primary site of absorption for many drugs administered orally and so is the target tissue for pharmacotherapeutic strategies to control the oral absorption of drugs. Drug transporters, including the ATP-binding cassette (ABC) superfamily and the solute carrier (SLC) superfamily, have been considered to play a physiological role in regulating the absorption of xenobiotics, and variations in their expression level and function in the small intestine cause intra- and inter-individual variation in the oral absorption of drugs. Recent advances in molecular biology have suggested that genetic polymorphisms are associated with the expression level and function, and thereby inter-individual variation. In this review, the pharmacogenetics of these transporters is summarized, and their future significance in the clinical setting is discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
35 An artificial mutation, Lys677Arg (2030A>G), introduced into the Walker A motif of nucleotide-binding domain (NBD) 1, which has not been found in DJS patients, also resulted in deficient maturation and impaired sorting.
X
ABCC2 p.Lys677Arg 18673259:35:24
status: NEW[hide] Identification of a novel 2026G-->C mutation of th... J Hum Genet. 2003;48(8):425-9. Epub 2003 Jul 22. Wakusawa S, Machida I, Suzuki S, Hayashi H, Yano M, Yoshioka K
Identification of a novel 2026G-->C mutation of the MRP2 gene in a Japanese patient with Dubin-Johnson syndrome.
J Hum Genet. 2003;48(8):425-9. Epub 2003 Jul 22., [PMID:12884082]
Abstract [show]
Dubin-Johnson syndrome is a recessive inherited disorder with conjugated hyperbilirubinemia caused by a dysfunction of multidrug resistance protein 2 (MRP2) on the canalicular membrane of hepatocytes. A mutational analysis of the MRP2 gene was carried out in three Japanese patients and their family members. In two patients, the homozygous mutations c.1901del67 and c,2272del168 were found. In the third patient, a -24C-->T polymorphism and the two mutations c.1901del67 and 2026G-->C were detected. The 2026G-->C mutation was a novel mutation in exon 16 affecting the conversion of Gly(676) to Arg(676) (G676R) in the MRP2 protein, and was not detected in fifty healthy volunteers. The G676R mutation was located in the Walker A motif of the first nucleotide binding domain in the MRP2 protein, and it was suggested that the mutation induced the dysfunction of the MRP2 protein. It was concluded that the compound heterozygosity of the two mutations of the MRP2 gene in the third patient contributed to the induction of hyperbilirubinemia in this case.
Comments [show]
None has been submitted yet.
No. Sentence Comment
62 Hashimoto et al. (2002) have reported that the artificial mutation K677R of the MRP2 gene and the missense mutation R768 W cause deficient maturation and impaired sorting.
X
ABCC2 p.Lys677Arg 12884082:62:67
status: NEW[hide] Trafficking and functional defects by mutations of... Hepatology. 2002 Nov;36(5):1236-45. Hashimoto K, Uchiumi T, Konno T, Ebihara T, Nakamura T, Wada M, Sakisaka S, Maniwa F, Amachi T, Ueda K, Kuwano M
Trafficking and functional defects by mutations of the ATP-binding domains in MRP2 in patients with Dubin-Johnson syndrome.
Hepatology. 2002 Nov;36(5):1236-45., [PMID:12395335]
Abstract [show]
Dubin-Johnson syndrome (DJS) is a hereditary disease characterized by hyperbilirubinemia. We investigated the consequences of 2 missense mutations, R768W and Q1382R, of nucleotide-binding domains (NBDs) of the multidrug resistance protein 2 (MRP2; ABCC2) that were previously identified in patients with DJS. Pulse chase analysis revealed that the precursor form of the wild-type and Q1382R MRP2 were converted to the mature form, which is resistant to endoglycosidase H (Endo H) in about 60 minutes. However, the precursor form of the R768W MRP2, which is sensitive to endoglycosidase H, was degraded within 120 minutes and did not mature to the fully glycosylated form. Proteasome inhibitors inhibited the degradation of the precursor form of the R768W MRP2. Unlike the R768W MRP2, the Q1382R MRP2 was mainly localized on the apical membrane in the wild-type form. However, efflux of glutathione monochlorobimane (GS-MCLB) and ATP-dependent leukotriene C(4) (LTC(4)) uptake into plasma membrane vesicles from cells expressing the Q1382R MRP2 were markedly reduced, suggesting that the Q1382R MRP2 on the apical membrane was nonfunctional. Vanadate-induced nucleotide trapping with 8-azido-[alpha-32P]ATP in the wild-type MRP2 was stimulated by estradiol glucuronide (E(2)17betaG) in a concentration-dependent manner but that in the Q1382R MRP2 was not. In conclusion, the R768W mutation causes deficient maturation and impaired sorting, and the Q1382R mutation does not affect maturation or sorting but impairs the substrate-induced ATP hydrolysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 The mutants R768W, Q1382R, and K677R were generated from pBS-MRP2.20 To generate these mutant MRPs, site-directed mutagenesis was carried out using a PCR-based method.21 The following primers were used to generate specific mutations: for R768W, the 5Ј-oligonucleotides MRP2-2,302 (5Ј-CAGAAGCAGCGGAT- CAGC; corresponding to the native MRP2 sequence) and R768W-MRP2 (5Ј- CAGAAGCAGTGGAT- CAGCCTG); for Q1382R, the 5Ј-oligonucleotides MRP2-4,555 (5Ј-CATCCCCCAGGACCCCATC; corresponding to the native MRP2 sequence) and Q1382R- MRP2 (5Ј- CATCCCCCGGGACCCCATC); and, for K677R, the 5Ј-oligonucleotides MRP2-2,030 (5Ј- GGCTCTGGGAAATCCTCCTTG; corresponding to the native MRP2 sequence) and K677R-MRP2 (5Ј- GGCTCTGGGAGATCCTCCTTG).
X
ABCC2 p.Lys677Arg 12395335:28:31
status: NEWX
ABCC2 p.Lys677Arg 12395335:28:599
status: NEWX
ABCC2 p.Lys677Arg 12395335:28:728
status: NEW39 In brief, 20, 20, 200, and 200 g total protein from LLC-PK1 cells expressing the wild-type, Q1382R, K677R, and R768W MRP2 were treated with 1,000 units of each enzyme for 1 hour at 37°C, respectively.
X
ABCC2 p.Lys677Arg 12395335:39:108
status: NEW69 The Walker A lysine mutation K677R is also shown.
X
ABCC2 p.Lys677Arg 12395335:69:29
status: NEW80 Another artificial mutation, 2,030 (A3G) K677R, was also introduced into the Walker A motif of NBD1.
X
ABCC2 p.Lys677Arg 12395335:80:41
status: NEW81 LLC-PK1 and HEK293 cell lines that stably express the wild-type MRP2 or each mutant MRP2 (R768W, Q1382R, and K677R) were established.
X
ABCC2 p.Lys677Arg 12395335:81:109
status: NEW86 On the other hand, the R768W and K677R MRP2 were detected as 175-kd weak bands (designated as P) by both antibodies (Fig. 3A and B).
X
ABCC2 p.Lys677Arg 12395335:86:33
status: NEW87 These results suggested that the R768W and K677R MRP2 did not mature properly and that their expression levels were low.
X
ABCC2 p.Lys677Arg 12395335:87:43
status: NEW92 The deglycosylated form of MRP2 was also produced from the 175-kd K677R and R768W MRP2 (band P) by the treatment with Endo H, indicating that they did not contain complex oligosaccharides and might be located in the endoplasmic reticulum (ER) or the cis-Golgi complex.
X
ABCC2 p.Lys677Arg 12395335:92:66
status: NEW95 LLC-PK1 cells stably expressing the wild-type human MRP2 and the mutant MRP (Q1382R, R768W, or K677R) were solubilized and analyzed by Western blot analysis with monoclonal antibodies M2I-4 (A) and M2III-6 (B).
X
ABCC2 p.Lys677Arg 12395335:95:95
status: NEW98 The cell lysates from LLC-PK1 cells expressing the wild-type and Q1382R MRP2 (20 g) or from cells expressing the R768W and K677R MRP2 (200 g) were treated with Endo H or PNGaseF and analyzed by Western blot analysis with monoclonal antibodies M2I-4.
X
ABCC2 p.Lys677Arg 12395335:98:131
status: NEW106 In contrast, the 175-kd form (band P) of R768W and K677R MRP2 was scarcely converted to the 190-kd form (band M) and was degraded with a half-life of approximately 60 minutes.
X
ABCC2 p.Lys677Arg 12395335:106:51
status: NEW114 Consistent with our previous report,20 the wild-type MRP2 predominantly localized to the cell surface, especially to the apical membrane (Fig. 6A), but the R768W and K677R MRP2 localized in the cytoplasm, with ER-like distribution (Fig. 6A), consistent with the immature glycosylation of these mutants.
X
ABCC2 p.Lys677Arg 12395335:114:166
status: NEW131 In stable HEK293 transfectants, as in stable LLC-PK1 transfectants (Fig. 3A), the Q1382R mutation did not affect the expression and maturation of MRP2, whereas the R768W and K677R MRP2 did not mature properly, and their expression levels were low (Fig. 7A).
X
ABCC2 p.Lys677Arg 12395335:131:174
status: NEW133 GS-MCLB efflux from HEK293 cells expressing the R768W and K677R MRP2 was as low as that from control cells, consistent with their low expression of these proteins on the plasma membrane.
X
ABCC2 p.Lys677Arg 12395335:133:58
status: NEW152 (A) LLC-PK1 cells expressing the wild-type, R768W, and K677R MRP2 were stained with the MRP2 antibody M2III-6.
X
ABCC2 p.Lys677Arg 12395335:152:55
status: NEW163 The symbols shown are as follows: wild type (F), empty vector (Œ), R768W (ϫ), K677R (ϩ), Q1382R (I).
X
ABCC2 p.Lys677Arg 12395335:163:90
status: NEW176 We introduced 2 DJS-associated MRP2 mutations, R768W and Q1382R, and an artificial mutation, K677R, to the Walker A motif (Fig. 1).
X
ABCC2 p.Lys677Arg 12395335:176:93
status: NEW178 A confocal microscopic analysis revealed that MRP2 with the missense mutation R768W, in the signature C motif of NBD1, and K677R, in the Walker A motif of NBD1, were localized in the cytoplasm with an ER-like distribution, whereas the wild-type MRP2 was predominantly localized on the apical membrane (Fig. 6A).
X
ABCC2 p.Lys677Arg 12395335:178:123
status: NEW180 R768W and K677R transfectants produced precursor forms of MRP2 protein that were sensitive to Endo H (Fig. 3C) and rapidly degraded with a half-life of less than 60 minutes (Fig. 4).
X
ABCC2 p.Lys677Arg 12395335:180:10
status: NEW208 In conclusion, introduction of a DJS mutation R768W as well as the Walker A lysine mutation K677R resulted in abortive maturation and sorting of MRP2, whereas another DJS mutation, Q1382R, did not affect maturation or sorting but impaired the substrate-induced ATP hydrolysis.
X
ABCC2 p.Lys677Arg 12395335:208:92
status: NEW