ABCMdb

ABCC7 p.Arg29Lys

Predicted by SNAP2:	A: D (75%), C: D (75%), D: D (95%), E: D (85%), F: D (85%), G: D (91%), H: D (71%), I: D (80%), K: N (93%), L: D (80%), M: D (80%), N: D (53%), P: D (91%), Q: D (75%), S: D (80%), T: D (80%), V: D (80%), W: D (91%), Y: D (85%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: N, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: D, P: D, Q: N, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Processing of CFTR: traversing the cellular maze--... Pediatr Pulmonol. 2005 Jun;39(6):479-91. Amaral MD
Processing of CFTR: traversing the cellular maze--how much CFTR needs to go through to avoid cystic fibrosis?
Pediatr Pulmonol. 2005 Jun;39(6):479-91., [PMID:15765539]

Abstract [show]
Biosynthesis of the cystic fibrosis transmembrane conductance regulator (CFTR), like other proteins aimed at the cell surface, involves transport through a series of membranous compartments, the first of which is the endoplasmic reticulum (ER), where CFTR encounters the appropriate environment for folding, oligomerization, maturation, and export from the ER. After exiting the ER, CFTR has to traffic through complex pathways until it reaches the cell surface. Although not yet fully understood, the fine details of these pathways are starting to emerge, partially through identification of an increasing number of CFTR-interacting proteins (CIPs) and the clarification of their roles in CFTR trafficking and function. These aspects of CFTR biogenesis/degradation and by membrane traffic and CIPs are discussed in this review. Following this description of complex pathways and multiple checkpoints to which CFTR is subjected in the cell, the basic question remains of how much CFTR has to overcome these barriers and be functionally expressed at the plasma membrane to avoid CF. This question is also discussed here.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Although the simultaneous substitution of all four arginines by lysine (K) residues (4RK: R29K þ R516K þ R555K þ R766K) causes F508del-CFTR to function about one-third as efficiently as wt-CFTR, individual R/K substitutions at some of these positions, i.e., R29K30 and R555K,31 were also described as restoring F508del-CFTR function. Login to comment

[hide] Revertant mutants G550E and 4RK rescue cystic fibr... Proc Natl Acad Sci U S A. 2006 Nov 21;103(47):17891-6. Epub 2006 Nov 10. Roxo-Rosa M, Xu Z, Schmidt A, Neto M, Cai Z, Soares CM, Sheppard DN, Amaral MD
Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms.
Proc Natl Acad Sci U S A. 2006 Nov 21;103(47):17891-6. Epub 2006 Nov 10., 2006-11-21 [PMID:17098864]

Abstract [show]
The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation. Here, we investigate their mechanism of action by using biochemical and functional assays to examine their effects on F508del and three CF mutations (R560T, A561E, and V562I) located within a conserved region of the first nucleotide-binding domain (NBD1) of CFTR. Like F508del, R560T and A561E disrupt CFTR trafficking. G550E rescued the trafficking defect of A561E but not that of R560T. Of note, the processing and function of V562I were equivalent to that of wild-type (wt)-CFTR, suggesting that V562I is not a disease-causing mutation. Biochemical studies revealed that 4RK generates higher steady-state levels of mature CFTR (band C) for wt- and V562I-CFTR than does G550E. Moreover, functional studies showed that the revertants rescue the gating defect of F508del-CFTR with different efficacies. 4RK modestly increased F508del-CFTR activity by prolonging channel openings, whereas G550E restored F508del-CFTR activity to wt levels by altering the duration of channel openings and closings. Thus, our data suggest that the revertants G550E and 4RK might rescue F508del-CFTR by distinct mechanisms. G550E likely alters the conformation of NBD1, whereas 4RK allows F508del-CFTR to escape endoplasmic reticulum retention/retrieval mediated by AFTs. We propose that AFTs might constitute a checkpoint for endoplasmic reticulum quality control.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms Mo´ nica Roxo-Rosa*† , Zhe Xu‡ , Andre´ Schmidt*† , Ma´rio Neto*, Zhiwei Cai‡ , Cla´udio M. Soares§ , David N. Sheppard‡ , and Margarida D. Amaral*†¶ *Department of Chemistry and Biochemistry, Faculty of Sciences, University of Lisbon, Campo Grande, 1749-016 Lisbon, Portugal; †Centre of Human Genetics, National Institute of Health Dr. Ricardo Jorge, Avenida Padre Cruz, 1649-016 Lisbon, Portugal; ‡Department of Physiology, School of Medical Sciences, University of Bristol, Bristol BS8 1TD, United Kingdom; and §Institute of Chemistry and Biological Technology, New University of Lisbon, 2781-901 Oeiras, Portugal Communicated by Michael J. Welsh, University of Iowa College of Medicine, Iowa City, IA, September 22, 2006 (received for review June 9, 2006) The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation. Login to comment
22 Moreover, Chang et al. (25) rescued the trafficking and function of F508del-CFTR with the simultaneous mutation of the four arginine-framed tripeptides (AFTs) (R29QR31, R516YR518, R553AR555, and R764RR766) present in CFTR termed 4RK (R29K, R516K, R555K, and R766K). Login to comment
190 Of note, the work of Hegedus et al. (40), who studied F508del-CFTR in cis with R29K and R555K (called 2RK), suggests that the stability of F508del-2RK-CFTR is temperature-dependent. Login to comment

[hide] Interplay between ER exit code and domain conforma... Mol Biol Cell. 2010 Feb 15;21(4):597-609. Epub 2009 Dec 23. Roy G, Chalfin EM, Saxena A, Wang X
Interplay between ER exit code and domain conformation in CFTR misprocessing and rescue.
Mol Biol Cell. 2010 Feb 15;21(4):597-609. Epub 2009 Dec 23., 2010-02-15 [PMID:20032308]

Abstract [show]
Multiple mutations in cystic fibrosis transmembrane conductance regulator (CFTR) impair its exit from the endoplasmic reticulum (ER). We compared two processing mutants: DeltaF508 and the ER exit code mutant DAA. Although both have severe kinetic processing defect, DAA but not DeltaF508 has substantial accumulation in its mature form, leading to higher level of processing at the steady state. DAA has much less profound conformational abnormalities. It has lower Hsp70 association and higher post-ER stability than DeltaF508. The ER exit code is necessary for DeltaF508 residual export and rescue. R555K, a mutation that rescues DeltaF508 misprocessing, improves Sec24 association and enhances its post-ER stability. Using in situ limited proteolysis, we demonstrated a clear change in trypsin sensitivity in DeltaF508 NBD1, which is reversed, together with that of other domains, by low temperature, R555K or both. We observed a conversion of the proteolytic pattern of DAA from the one resembling DeltaF508 to the one similar to wild-type CFTR during its maturation. Low temperature and R555K are additive in improving DeltaF508 conformational maturation and processing. Our data reveal a dual contribution of ER exit code and domain conformation to CFTR misprocessing and underscore the importance of conformational repair in effective rescue of DeltaF508.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 To construct pcDNA3.1(ϩ)-CFTR-⌬F508/R29K, an NdeI-BspeI fragment including the 5Ј untranslated region, the amino terminal tail (NT) and MSD1 of CFTR was used as a cassette, and R29K substitution was introduced into pcDNA3.1(ϩ)-CFTR-⌬F508 using this cassette. Login to comment
53 Finally, the pcDNA3.1(ϩ)- CFTR-⌬F508/R29K/R555K was constructed by replacing the BspeI-HpaI fragment of pcDNA3.1(ϩ)-CFTR-⌬F508/R29K with the corresponding fragment from pcDNA3.1(ϩ)-CFTR-⌬F508/R555K. Login to comment
207 R555K Rescues ⌬F508 CFTR by Improving Both Export and Post-ER Stability R555K, alone (Teem et al., 1996) or in combination with R29K (Hegedus et al., 2006) rescues ⌬F508 CFTR. Login to comment
208 We found that R29K does not improve ⌬F508 processing, nor does it contribute to ⌬F508 rescue when combined with R555K (2RK) in HEK293 cells and this is true at both 37 and 30°C (Figure 7A). Login to comment
209 In BHK cells, R29K alone inhibits ⌬F508 processing but only slightly enhances ⌬F508 processing when combined with R555K at 37°C (Supplemental Figure 2). Login to comment
285 (A) HEK293 cells were transiently transfected with ⌬F, ⌬F/ R29K, ⌬F/R555K and ⌬F/R29K/R555K (⌬F/ 2RK) and cultured at 37°C for 20 h (37°C), or further switched to 30°C and incubated for an additional 16 h (30°). Login to comment
337 We found that R29K does not contribute to ⌬F508 rescue in HEK 293 cells (Figure 7A) but slightly improves ⌬F508 rescue only in combination with R555K in BHK cells (Supplemental Figure 2). Login to comment

[hide] The W232R suppressor mutation promotes maturation ... Biochemistry. 2011 Feb 8;50(5):672-85. Epub 2011 Jan 11. Loo TW, Bartlett MC, Clarke DM
The W232R suppressor mutation promotes maturation of a truncation mutant lacking both nucleotide-binding domains and restores interdomain assembly and activity of P-glycoprotein processing mutants.
Biochemistry. 2011 Feb 8;50(5):672-85. Epub 2011 Jan 11., 2011-02-08 [PMID:21182301]

Abstract [show]
ATP-binding cassette (ABC) proteins contain two nucleotide-binding domains (NBDs) and two transmembrane (TM) domains (TMDs). Interdomain interactions and packing of the TM segments are critical for function, and disruption by genetic mutations contributes to disease. P-glycoprotein (P-gp) is a useful model to identify mechanisms that repair processing defects because numerous arginine suppressor mutations have been identified in the TM segments. Here, we tested the prediction that a mechanism of arginine rescue was to promote intradomain interactions between TM segments and restore interdomain assembly. We found that suppressor W232R(TM4/TMD1) rescued mutants with processing mutations in any domain and restored defective NBD1-NBD2, NBD1-TMD2, and TMD1-TMD2 interactions. W232R also promoted packing of the TM segments because it rescued a truncation mutant lacking both NBDs. The mechanism of W232R rescue likely involved intradomain hydrogen bond interactions with Asn296(TM5) since only N296A abolished rescue by W232R and rescue was only observed when Trp232 was replaced with hydrogen-bonding residues. In TMD2, suppressor T945R(TM11) also promoted packing of the TM segments because it rescued the truncation mutant lacking the NBDs and suppressed formation of alternative topologies. We propose that T945R rescue was mediated by interactions with Glu875(TM10) since T945E/E875R promoted maturation while T945R/E875A did not.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 Suppressor mutations can rescueΔF508-CFTRbya variety ofmechanisms.Examplesinclude removal of the ER retention signals (arginine-framed trafficking motif mutations; R29K, R516K, R555K, and R766K) (61, 62), introduction of a combination of CFTR suppressor mutations (F949/Q637R or F29S/F494N/Q637R) that increase solubility of NBD1(63),orintroductionofsuppressormutationssuchasV510D (TMD1) (64) and R1070W(TMD2) (65) that restore NBD1-TMD2 interactions. Login to comment

[hide] Thermally unstable gating of the most common cysti... J Biol Chem. 2011 Dec 9;286(49):41937-48. Epub 2011 Sep 30. Wang W, Okeyo GO, Tao B, Hong JS, Kirk KL
Thermally unstable gating of the most common cystic fibrosis mutant channel (DeltaF508): "rescue" by suppressor mutations in nucleotide binding domain 1 and by constitutive mutations in the cytosolic loops.
J Biol Chem. 2011 Dec 9;286(49):41937-48. Epub 2011 Sep 30., [PMID:21965669]

Abstract [show]
Most cystic fibrosis (CF) cases are caused by the DeltaF508 mutation in the CF transmembrane conductance regulator (CFTR), which disrupts both the processing and gating of this chloride channel. The cell surface expression of DeltaF508-CFTR can be "rescued" by culturing cells at 26-28 degrees C and treating cells with small molecule correctors or intragenic suppressor mutations. Here, we determined whether these various rescue protocols induce a DeltaF508-CFTR conformation that is thermally stable in excised membrane patches. We also tested the impact of constitutive cytosolic loop mutations that increase ATP-independent channel activity (K978C and K190C/K978C) on DeltaF508-CFTR function. Low temperature-rescued DeltaF508-CFTR channels irreversibly inactivated with a time constant of 5-6 min when excised patches were warmed from 22 degrees C to 36.5 degrees C. A panel of CFTR correctors and potentiators that increased DeltaF508-CFTR maturation or channel activity failed to prevent this inactivation. Conversely, three suppressor mutations in the first nucleotide binding domain rescued DeltaF508-CFTR maturation and stabilized channel activity at 36.5 degrees C. The constitutive loop mutations increased ATP-independent activity of low temperature-rescued DeltaF508-CFTR but did not enhance protein maturation. Importantly, the ATP-independent activities of these DeltaF508-CFTR constructs were stable at 36.5 degrees C, whereas their ATP-dependent activities were not. Single channel recordings of this thermally stable ATP-independent activity revealed dynamic gating and unitary currents of normal amplitudes. We conclude that: (i) DeltaF508-CFTR gating is highly unstable at physiologic temperature; (ii) most rescue protocols do not prevent this thermal instability; and (iii) ATP-independent gating and the pore are spared from DeltaF508-induced thermal instability, a finding that may inform alternative treatment strategies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 For example, Hegedus et al. have shown that eliminating two arginine-based motifs (RXR) from ⌬F508-CFTR (e.g. R29K and R555K) promotes maturation of ⌬F508, but channel activity in lipid bilayers is highly thermally unstable (i.e. inactivates at physiologic temperature) (42). Login to comment

[hide] Solubilizing mutations used to crystallize one CFT... Chem Biol. 2008 Jan;15(1):62-9. Pissarra LS, Farinha CM, Xu Z, Schmidt A, Thibodeau PH, Cai Z, Thomas PJ, Sheppard DN, Amaral MD
Solubilizing mutations used to crystallize one CFTR domain attenuate the trafficking and channel defects caused by the major cystic fibrosis mutation.
Chem Biol. 2008 Jan;15(1):62-9., [PMID:18215773]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) Cl(-) channel. F508del, the most frequent CF-causing mutation, disrupts both the processing and function of CFTR. Recently, the crystal structure of the first nucleotide-binding domain of CFTR bearing F508del (F508del-NBD1) was elucidated. Although F508del-NBD1 shows only minor conformational changes relative to that of wild-type NBD1, additional mutations (F494N/Q637R or F429S/F494N/Q637R) were required for domain solubility and crystallization. Here we show that these solubilizing mutations in cis with F508del partially rescue the trafficking defect of full-length F508del-CFTR and attenuate its gating defect. We interpret these data to suggest that the solubilizing mutations utilized to facilitate F508del-NBD1 production also assist folding of full-length F508del-CFTR protein. Thus, the available crystal structure of F508del-NBD1 might correspond to a partially corrected conformation of this domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 Comparison with Other Revertants Using the same cellular system employed to investigate the solubilizing mutations, we recently examined the mechanism of action of two other F508del-CFTR revertants, G550E and 4RK, the simultaneous mutation of four arginine-framed tripeptides (AFTs), R29K, R516K, R555K, and R766K (Roxo-Rosa et al., 2006). Login to comment

[hide] Removal of multiple arginine-framed trafficking si... Mol Cell. 1999 Jul;4(1):137-42. Chang XB, Cui L, Hou YX, Jensen TJ, Aleksandrov AA, Mengos A, Riordan JR
Removal of multiple arginine-framed trafficking signals overcomes misprocessing of delta F508 CFTR present in most patients with cystic fibrosis.
Mol Cell. 1999 Jul;4(1):137-42., [PMID:10445036]

Abstract [show]
Many cystic fibrosis transmembrane conductance regulator (CFTR) mutants are recognized as aberrant by the quality control apparatus at the endoplasmic reticulum (ER) and are targeted for degradation. The mechanism whereby nascent chains are distinguished as either competent or incompetent for ER export has not been elucidated. Here we show that export-incompetent chains display multiple arginine-framed tripeptide sequences like the one recently identified in ATP-sensitive K+ channels. Replacement of arginine residues at positions R29, R516, R555, and R766 with lysine residues to inactivate four of these motifs simultaneously causes delta F508 CFTR, present in approximately 90% of CF patients, to escape ER quality control and function at the cell surface. Interference with recognition of these signals may be helpful in the management of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 This band remains prominent in 3 of the 4 R→K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12). Login to comment
42 Arginine-Framed Tripeptide Trafficking Signals in CFTR significantly, however, bands of lower mobility are pro- (A) Schematic depiction of CFTR protein indicating approximate duced by the R29K and 4RK variants (lanes 8 and 12). Login to comment
82 With ⌬F508/R29K, low rates of 36 Cl- efflux occurred at considerably delayed times after stimulation. Login to comment
127 The following oligonu-peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA. Login to comment
128 R29K, CAATTTTGAGGAAAGGATACAAA shall et al., 1994; Zerhusen et al., 1999). Login to comment
41 This band remains prominent in 3 of the 4 R࢐K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12). Login to comment
43 Arginine-Framed Tripeptide Trafficking Signals in CFTR significantly, however, bands of lower mobility are pro- (A) Schematic depiction of CFTR protein indicating approximate duced by the R29K and 4RK variants (lanes 8 and 12). Login to comment
85 With DF508/R29K, low rates of 36 Cl2 efflux occurred at considerably delayed times after stimulation. Login to comment
130 The following oligonu- peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA. Login to comment
131 R29K, CAATTTTGAGGAAAGGATACAAA shall et al., 1994; Zerhusen et al., 1999). Login to comment

[hide] Rescue of functional DeltaF508-CFTR channels by co... FEBS Lett. 2003 Nov 6;554(1-2):173-8. Owsianik G, Cao L, Nilius B
Rescue of functional DeltaF508-CFTR channels by co-expression with truncated CFTR constructs in COS-1 cells.
FEBS Lett. 2003 Nov 6;554(1-2):173-8., [PMID:14596935]

Abstract [show]
The most frequent mutant variant of the cystic fibrosis transmembrane conductance regulator (CFTR), DeltaF508-CFTR, is misprocessed and subsequently degraded in the endoplasmic reticulum. Using the patch-clamp technique, we showed that co-expressions of DeltaF508-CFTR with the N-terminal CFTR truncates containing bi-arginine (RXR) retention/retrieval motifs result in a functional rescue of the DeltaF508-CFTR mutant channel in COS-1 cells. This DeltaF508-CFTR rescue process was strongly impaired when truncated CFTR constructs possessed either the DeltaF508 mutation or arginine-to-lysine mutations in RXRs. In conclusions, our data demonstrated that expression of truncated CFTR constructs could be a novel promising approach to improve maturation of DeltaF508-CFTR channels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 The base pair substitutions (underlined) were introduced using following oligonucleotides: for R29K mutation: 5P-GAAAGGATACAAACAGC- GCCTGGA (sense) and 5P-TCCAGGCGCTGTTTGTATCCTTTC (antisense); for R516K mutation: 5P-CTATGATGAATATAAATA- CAGAAGCGTC (sense) and 5P-GACGCTTCTGTATTTATATTC- ATCATAG (antisense); for R555K mutation: 5P-GGTCAACGAG- CAAAAATTTCTTTAGC (sense) and 5P-GCTAAAGAAATTTT- TGCTCGTTGACC (antisense). Login to comment
95 Surprisingly, the R29K mutation did not signi'cantly a&#a1;ect the rescuing properties of WF1 as well as WF2 (Table 1), suggesting the presence of another retention/retrieval motif in the N-terminal tail of CFTR. Login to comment

[hide] F508del CFTR with two altered RXR motifs escapes f... Biochim Biophys Acta. 2006 May;1758(5):565-72. Epub 2006 Mar 31. Hegedus T, Aleksandrov A, Cui L, Gentzsch M, Chang XB, Riordan JR
F508del CFTR with two altered RXR motifs escapes from ER quality control but its channel activity is thermally sensitive.
Biochim Biophys Acta. 2006 May;1758(5):565-72. Epub 2006 Mar 31., [PMID:16624253]

Abstract [show]
Most cystic fibrosis (CF) patients carry the F508del mutation in the CFTR chloride channel protein resulting in its misassembly, retention in the endoplasmic reticulum (ER), and proteasomal degradation. Therefore, characterization of the retention and attempts to rescue the mutant CFTR are a major focus of CF research. Earlier, we had shown that four arginine-framed tripeptide (AFT) signals in CFTR participate in the quality control. Now we have mutated these four AFTs in all possible combinations and found that simultaneous inactivation of two of them (R29K and R555K) is necessary and sufficient to overcome F508del CFTR retention. Immunofluorescence staining of BHK cells expressing this variant indicates that it matures and is routed to the plasma membrane. Acquisition of at least some wild-type structure was detected in the pattern of proteolytic digestion fragments. Functional activity at the cell surface was evident in chloride efflux assays. However, single channel activity of the rescued mutant measured in planar lipid bilayers diminished as temperature was increased from 30 to 37 degrees C. These findings support the idea that absence of Phe 508 causes not only a kinetic folding defect but also steady-state structural instability. Therefore effective molecular therapies developed to alleviate disease caused by F508del and probably other misprocessing mutants will require overcoming both their kinetic and steady-state impacts.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Now we have mutated these four AFTs in all possible combinations and found that simultaneous inactivation of two of them (R29K and R555K) is necessary and sufficient to overcome F508del CFTR retention. Login to comment
41 The PCR was performed according to standard Stratagene protocols using the same oligonucleotides employed to make the R29K and R555K substitutions previously [32]. Login to comment
85 We reported earlier that among the single mutants only the R29K substitution produced a very low level maturation and this is not visible on the exposure in Fig. 2A. Login to comment
177 However as shown we could not detect any maturation with this mutation alone despite a substantial amount when it was combined with R29K. Login to comment
178 We had originally detected a slight effect of R29K alone as well [32]. Login to comment

[hide] Revertants, low temperature, and correctors reveal... Chem Biol. 2013 Jul 25;20(7):943-55. doi: 10.1016/j.chembiol.2013.06.004. Farinha CM, King-Underwood J, Sousa M, Correia AR, Henriques BJ, Roxo-Rosa M, Da Paula AC, Williams J, Hirst S, Gomes CM, Amaral MD
Revertants, low temperature, and correctors reveal the mechanism of F508del-CFTR rescue by VX-809 and suggest multiple agents for full correction.
Chem Biol. 2013 Jul 25;20(7):943-55. doi: 10.1016/j.chembiol.2013.06.004., [PMID:23890012]

Abstract [show]
Cystic fibrosis is mostly caused by the F508del mutation, which impairs CFTR protein from exiting the endoplasmic reticulum due to misfolding. VX-809 is a small molecule that rescues F508del-CFTR localization, which recently went into clinical trial but with unknown mechanism of action (MoA). Herein, we assessed if VX-809 is additive or synergistic with genetic revertants of F508del-CFTR, other correctors, and low temperature to determine its MoA. We explored and integrated those various agents in combined treatments, showing how they add to each other to identify their complementary MoA upon correction of F508del-CFTR. Our experimental and modeling data, while compatible with putative binding of VX-809 to NBD1:ICL4 interface, also indicate scope for further synergistic F508del-CFTR correction by other compounds at distinct conformational sites/cellular checkpoints, thus suggesting requirement of combined therapies to fully rescue F508del-CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
231 EXPERIMENTAL PROCEDURES Cells and Culture Conditions BHK cell lines expressing F508del-4RK (R29K/R516K/R555K/R716K)-, F508del-G550E-, F508del-R1070W-, F508del-V510D-, F508del-R555K-, F508del-V510D/G550E-, F508del-G550E/R1070W-, DAA (D567A)-, 4RK- DAA-, DD/AA (D565A, D567A)-, 4RK-DD/AA-, and R560T-CFTR were produced and cultured as previously described (Roxo-Rosa et al., 2006). Login to comment