ABCC7 p.Arg766Lys
| ClinVar: |
c.2297G>T
,
p.Arg766Met
?
, not provided
|
| CF databases: |
c.2297G>T
,
p.Arg766Met
(CFTR1)
D
, R766M was identified by non-radioactive SSCP and direct sequencing; it creates a FokI restriction site.
|
| Predicted by SNAP2: | A: D (85%), C: D (91%), D: D (95%), E: D (91%), F: D (91%), G: D (91%), H: D (91%), I: D (91%), K: D (75%), L: D (91%), M: D (66%), N: D (91%), P: D (91%), Q: D (85%), S: D (85%), T: D (85%), V: D (85%), W: D (95%), Y: D (91%), |
| Predicted by PROVEAN: | A: N, C: D, D: D, E: N, F: D, G: D, H: N, I: D, K: N, L: D, M: D, N: N, P: D, Q: N, S: N, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Processing of CFTR: traversing the cellular maze--... Pediatr Pulmonol. 2005 Jun;39(6):479-91. Amaral MD
Processing of CFTR: traversing the cellular maze--how much CFTR needs to go through to avoid cystic fibrosis?
Pediatr Pulmonol. 2005 Jun;39(6):479-91., [PMID:15765539]
Abstract [show]
Biosynthesis of the cystic fibrosis transmembrane conductance regulator (CFTR), like other proteins aimed at the cell surface, involves transport through a series of membranous compartments, the first of which is the endoplasmic reticulum (ER), where CFTR encounters the appropriate environment for folding, oligomerization, maturation, and export from the ER. After exiting the ER, CFTR has to traffic through complex pathways until it reaches the cell surface. Although not yet fully understood, the fine details of these pathways are starting to emerge, partially through identification of an increasing number of CFTR-interacting proteins (CIPs) and the clarification of their roles in CFTR trafficking and function. These aspects of CFTR biogenesis/degradation and by membrane traffic and CIPs are discussed in this review. Following this description of complex pathways and multiple checkpoints to which CFTR is subjected in the cell, the basic question remains of how much CFTR has to overcome these barriers and be functionally expressed at the plasma membrane to avoid CF. This question is also discussed here.
Comments [show]
None has been submitted yet.
No. Sentence Comment
50 Although the simultaneous substitution of all four arginines by lysine (K) residues (4RK: R29K þ R516K þ R555K þ R766K) causes F508del-CFTR to function about one-third as efficiently as wt-CFTR, individual R/K substitutions at some of these positions, i.e., R29K30 and R555K,31 were also described as restoring F508del-CFTR function.
X
ABCC7 p.Arg766Lys 15765539:50:128
status: NEW[hide] Revertant mutants G550E and 4RK rescue cystic fibr... Proc Natl Acad Sci U S A. 2006 Nov 21;103(47):17891-6. Epub 2006 Nov 10. Roxo-Rosa M, Xu Z, Schmidt A, Neto M, Cai Z, Soares CM, Sheppard DN, Amaral MD
Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms.
Proc Natl Acad Sci U S A. 2006 Nov 21;103(47):17891-6. Epub 2006 Nov 10., 2006-11-21 [PMID:17098864]
Abstract [show]
The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation. Here, we investigate their mechanism of action by using biochemical and functional assays to examine their effects on F508del and three CF mutations (R560T, A561E, and V562I) located within a conserved region of the first nucleotide-binding domain (NBD1) of CFTR. Like F508del, R560T and A561E disrupt CFTR trafficking. G550E rescued the trafficking defect of A561E but not that of R560T. Of note, the processing and function of V562I were equivalent to that of wild-type (wt)-CFTR, suggesting that V562I is not a disease-causing mutation. Biochemical studies revealed that 4RK generates higher steady-state levels of mature CFTR (band C) for wt- and V562I-CFTR than does G550E. Moreover, functional studies showed that the revertants rescue the gating defect of F508del-CFTR with different efficacies. 4RK modestly increased F508del-CFTR activity by prolonging channel openings, whereas G550E restored F508del-CFTR activity to wt levels by altering the duration of channel openings and closings. Thus, our data suggest that the revertants G550E and 4RK might rescue F508del-CFTR by distinct mechanisms. G550E likely alters the conformation of NBD1, whereas 4RK allows F508del-CFTR to escape endoplasmic reticulum retention/retrieval mediated by AFTs. We propose that AFTs might constitute a checkpoint for endoplasmic reticulum quality control.
Comments [show]
None has been submitted yet.
No. Sentence Comment
0 Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms Mo´ nica Roxo-Rosa*† , Zhe Xu‡ , Andre´ Schmidt*† , Ma´rio Neto*, Zhiwei Cai‡ , Cla´udio M. Soares§ , David N. Sheppard‡ , and Margarida D. Amaral*†¶ *Department of Chemistry and Biochemistry, Faculty of Sciences, University of Lisbon, Campo Grande, 1749-016 Lisbon, Portugal; †Centre of Human Genetics, National Institute of Health Dr. Ricardo Jorge, Avenida Padre Cruz, 1649-016 Lisbon, Portugal; ‡Department of Physiology, School of Medical Sciences, University of Bristol, Bristol BS8 1TD, United Kingdom; and §Institute of Chemistry and Biological Technology, New University of Lisbon, 2781-901 Oeiras, Portugal Communicated by Michael J. Welsh, University of Iowa College of Medicine, Iowa City, IA, September 22, 2006 (received for review June 9, 2006) The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation.
X
ABCC7 p.Arg766Lys 17098864:0:1118
status: NEW22 Moreover, Chang et al. (25) rescued the trafficking and function of F508del-CFTR with the simultaneous mutation of the four arginine-framed tripeptides (AFTs) (R29QR31, R516YR518, R553AR555, and R764RR766) present in CFTR termed 4RK (R29K, R516K, R555K, and R766K).
X
ABCC7 p.Arg766Lys 17098864:22:258
status: NEW[hide] The W232R suppressor mutation promotes maturation ... Biochemistry. 2011 Feb 8;50(5):672-85. Epub 2011 Jan 11. Loo TW, Bartlett MC, Clarke DM
The W232R suppressor mutation promotes maturation of a truncation mutant lacking both nucleotide-binding domains and restores interdomain assembly and activity of P-glycoprotein processing mutants.
Biochemistry. 2011 Feb 8;50(5):672-85. Epub 2011 Jan 11., 2011-02-08 [PMID:21182301]
Abstract [show]
ATP-binding cassette (ABC) proteins contain two nucleotide-binding domains (NBDs) and two transmembrane (TM) domains (TMDs). Interdomain interactions and packing of the TM segments are critical for function, and disruption by genetic mutations contributes to disease. P-glycoprotein (P-gp) is a useful model to identify mechanisms that repair processing defects because numerous arginine suppressor mutations have been identified in the TM segments. Here, we tested the prediction that a mechanism of arginine rescue was to promote intradomain interactions between TM segments and restore interdomain assembly. We found that suppressor W232R(TM4/TMD1) rescued mutants with processing mutations in any domain and restored defective NBD1-NBD2, NBD1-TMD2, and TMD1-TMD2 interactions. W232R also promoted packing of the TM segments because it rescued a truncation mutant lacking both NBDs. The mechanism of W232R rescue likely involved intradomain hydrogen bond interactions with Asn296(TM5) since only N296A abolished rescue by W232R and rescue was only observed when Trp232 was replaced with hydrogen-bonding residues. In TMD2, suppressor T945R(TM11) also promoted packing of the TM segments because it rescued the truncation mutant lacking the NBDs and suppressed formation of alternative topologies. We propose that T945R rescue was mediated by interactions with Glu875(TM10) since T945E/E875R promoted maturation while T945R/E875A did not.
Comments [show]
None has been submitted yet.
No. Sentence Comment
121 Suppressor mutations can rescueΔF508-CFTRbya variety ofmechanisms.Examplesinclude removal of the ER retention signals (arginine-framed trafficking motif mutations; R29K, R516K, R555K, and R766K) (61, 62), introduction of a combination of CFTR suppressor mutations (F949/Q637R or F29S/F494N/Q637R) that increase solubility of NBD1(63),orintroductionofsuppressormutationssuchasV510D (TMD1) (64) and R1070W(TMD2) (65) that restore NBD1-TMD2 interactions.
X
ABCC7 p.Arg766Lys 21182301:121:194
status: NEW[hide] Solubilizing mutations used to crystallize one CFT... Chem Biol. 2008 Jan;15(1):62-9. Pissarra LS, Farinha CM, Xu Z, Schmidt A, Thibodeau PH, Cai Z, Thomas PJ, Sheppard DN, Amaral MD
Solubilizing mutations used to crystallize one CFTR domain attenuate the trafficking and channel defects caused by the major cystic fibrosis mutation.
Chem Biol. 2008 Jan;15(1):62-9., [PMID:18215773]
Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) Cl(-) channel. F508del, the most frequent CF-causing mutation, disrupts both the processing and function of CFTR. Recently, the crystal structure of the first nucleotide-binding domain of CFTR bearing F508del (F508del-NBD1) was elucidated. Although F508del-NBD1 shows only minor conformational changes relative to that of wild-type NBD1, additional mutations (F494N/Q637R or F429S/F494N/Q637R) were required for domain solubility and crystallization. Here we show that these solubilizing mutations in cis with F508del partially rescue the trafficking defect of full-length F508del-CFTR and attenuate its gating defect. We interpret these data to suggest that the solubilizing mutations utilized to facilitate F508del-NBD1 production also assist folding of full-length F508del-CFTR protein. Thus, the available crystal structure of F508del-NBD1 might correspond to a partially corrected conformation of this domain.
Comments [show]
None has been submitted yet.
No. Sentence Comment
155 Comparison with Other Revertants Using the same cellular system employed to investigate the solubilizing mutations, we recently examined the mechanism of action of two other F508del-CFTR revertants, G550E and 4RK, the simultaneous mutation of four arginine-framed tripeptides (AFTs), R29K, R516K, R555K, and R766K (Roxo-Rosa et al., 2006).
X
ABCC7 p.Arg766Lys 18215773:155:308
status: NEW[hide] Removal of multiple arginine-framed trafficking si... Mol Cell. 1999 Jul;4(1):137-42. Chang XB, Cui L, Hou YX, Jensen TJ, Aleksandrov AA, Mengos A, Riordan JR
Removal of multiple arginine-framed trafficking signals overcomes misprocessing of delta F508 CFTR present in most patients with cystic fibrosis.
Mol Cell. 1999 Jul;4(1):137-42., [PMID:10445036]
Abstract [show]
Many cystic fibrosis transmembrane conductance regulator (CFTR) mutants are recognized as aberrant by the quality control apparatus at the endoplasmic reticulum (ER) and are targeted for degradation. The mechanism whereby nascent chains are distinguished as either competent or incompetent for ER export has not been elucidated. Here we show that export-incompetent chains display multiple arginine-framed tripeptide sequences like the one recently identified in ATP-sensitive K+ channels. Replacement of arginine residues at positions R29, R516, R555, and R766 with lysine residues to inactivate four of these motifs simultaneously causes delta F508 CFTR, present in approximately 90% of CF patients, to escape ER quality control and function at the cell surface. Interference with recognition of these signals may be helpful in the management of CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
40 This band remains prominent in 3 of the 4 R→K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12).
X
ABCC7 p.Arg766Lys 10445036:40:81
status: NEW81 There was no detectable in- is enabled by the release from ER retention when thecrease in efflux rate from cells expressing ⌬F508 CFTR AFTs are inactivated.alone or with the R516K, R555K, or R766K mutation.
X
ABCC7 p.Arg766Lys 10445036:81:198
status: NEW127 The following oligonu-peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA.
X
ABCC7 p.Arg766Lys 10445036:127:132
status: NEW129 Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAGinteractions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K,forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAGassociations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG.
X
ABCC7 p.Arg766Lys 10445036:129:408
status: NEW41 This band remains prominent in 3 of the 4 RK variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12).
X
ABCC7 p.Arg766Lys 10445036:41:80
status: NEW84 alone or with the R516K, R555K, or R766K mutation.
X
ABCC7 p.Arg766Lys 10445036:84:35
status: NEW130 The following oligonu- peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA.
X
ABCC7 p.Arg766Lys 10445036:130:133
status: NEW132 Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAG interactions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K, forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAG associations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG.
X
ABCC7 p.Arg766Lys 10445036:132:409
status: NEW