ABCMdb

ABCB3 p.Thr665Ala

ClinVar:	c.1993G>A , p.Ala665Thr N , Benign
Predicted by SNAP2:	A: D (53%), C: D (71%), D: D (80%), E: D (80%), F: D (80%), G: D (71%), H: D (75%), I: D (75%), K: D (85%), L: D (75%), M: N (61%), N: D (75%), P: D (80%), Q: D (80%), R: D (85%), S: N (57%), V: D (71%), W: D (85%), Y: D (80%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Three hundred twenty-six genetic variations in gen... J Hum Genet. 2002;47(1):38-50. Saito S, Iida A, Sekine A, Miura Y, Ogawa C, Kawauchi S, Higuchi S, Nakamura Y
Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population.
J Hum Genet. 2002;47(1):38-50., [PMID:11829140]

Abstract [show]
We screened DNAs from 48 Japanese individuals for single-nucleotide polymorphisms (SNPs) in nine genes encoding components of ATP-binding cassette subfamily B (ABCB/MDR/TAP) by directly sequencing the entire applicable genomic regions except for repetitive elements. This approach identified 297 SNPs and 29 insertion/deletion polymorphisms among the nine genes. Of the 297 SNPs, 50 were identified in the ABCB1 gene, 14 in TAP], 35 in TAP2, 48 in ABCB4, 13 in ABCB7, 21 in ABCB8, 21 in ABCB9, 13 in ABCB10, and 82 in ABCB11. Thirteen were located in 5' flanking regions, 237 in introns, 37 in exons, and 10 in 3' flanking regions. These variants may contribute to investigations of possible correlations between genotypes and disease-susceptibility phenotypes or responsiveness to drug therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Among the 37 SNPs detected in exons, 23 were present in coding regions; 10 of those would cause amino acid substitutions: Ala893Ser/Thr in the ABCB1 gene, (rs2032582); Ile393Val in TAP1 (rs1057141); Val379Ile (rs1800454), Cys651Arg, Thr665Ala (rs241447), and stop687Gln (rs241448) in TAP2; Val135Ile in ABCB8; Val121Met in ABCB9; Ala150Ser in ABCB10; and Val444Ala in ABCB11. Login to comment
34 Table 1A. Summary of genetic variations detected in the ABCB1 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5Ј Flanking -196 T/C 2 5Ј Flanking -16 T/C 3 Intron 1 71660 A/C 4 Intron 1 80091 A/C 5 Intron 1 103126 T/C 6 Intron 1 103148 C/T 7 Intron 1 108428 A/G 8 Intron 1 112042 A/Gd 9 Exon 2 202 T/C(5ЈUTR)b,d 10 Intron 2 491 G/del 11 Intron 4 36 C/T 12 Intron 5 1596 T/C 13 Intron 7 139 T/Cb,c rs1202168 14 Intron 7 251 G/A rs1202169 15 Intron 8 1789 C/T 16 Intron 9 7225 A/G rs1922240 17 Exon 13 12 T/C(Gly412Gly)b,c,d rs2032588 18 Intron 14 24 T/C 19 Intron 14 81 C/T 20 Intron 15 38 A/G 21 Intron 17 73 A/G 22 Intron 17 472 T/Ab,c 23 Intron 18 564 G/A 24 Intron 18 2062 C/T 25 Intron 18 2293 A/G 26 Intron 20 557 G/A 27 Intron 21 24 G/A 28 Intron 21 2725 A/G 29 Intron 21 4725 A/G 30 Exon 22 196 G/T/A(893Ala/Ser/Thr)c,d rs2032582 31 Intron 22 49 T/C rs2032583 32 Intron 22 8507 T/C 33 Intron 22 8537 T/A 34 Intron 22 8565 T/C 35 Intron 22 8952 G/A 36 Intron 22 9520 A/G 37 Intron 22 9836 C/T 38 Intron 24 377 C/A 39 Intron 24 1493 A/del 40 Intron 24 1495 A/T 41 Intron 25 342 C/T 42 Intron 26 134 C/G 43 Intron 26 1043 G/A rs1922243 44 Intron 26 1272 A/G 45 Intron 26 1394 A/G 46 Intron 26 1987-1988 AAAG/ins 47 Exon 27 153 C/T(Ile1145Ile)b,c,d rs1045642 48 Intron 27 59 G/T 49 Intron 27 80 T/C 50 Intron 28 1220 A/G rs1186746 51 Intron 28 1266 G/T rs1186745 52 Exon 29 400 A/G(3ЈUTR)d rs3842 53 3Ј Flanking 264 G/A rs1055302 ABCB1, ATP-binding cassette, subfamily B, member 1; NCBI, National Center for Biotechnology Information; SNP, single-nucleotide polymorphism; UTR, untranslated region; del, deletion; ins, insertion a For SNPs in the 5Јflanking region, intron region, or 3Јflanking region, nucleotide positions are counted from the first intronic nucleotide at the exon/intron junction (for SNPs in the exon region, nucleotide positions are counted from the first exonic nucleotide at the exon/intron junction) b SNPs previously reported by Hoffmeyer et al. (2000) c SNPs previously reported by Cascorbi et al. (2001) d SNPs previously reported by Tanabe et al. (2001) Table 1B. Summary of SNPs detected in the TAP1 gene No. Location Positiona SNP NCBI SNP ID 1 5Ј Flanking -673 G/C rs1351382 2 5Ј Flanking -646 T/G rs1351383 3 5Ј Flanking -563 A/C 4 5Ј Flanking -236 G/T 5 Intron 3 408 C/T 6 Exon 4 153 A/G(Ile393Val)b,c rs1057141 7 Intron 4 289 G/T 8 Intron 4 291 C/G rs2071539 9 Intron 5 1139 C/T 10 Intron 7 375 C/T rs735883 11 Exon 11 284 G/T(3ЈUTR)b rs1057373 12 3Ј Flanking 71 G/A rs2071540 13 3Ј Flanking 129 T/C rs2071541 14 3Ј Flanking 459 G/A rs2071463 TAP1, transporter associated with antigen processing 1 b SNPs previously reported by Colonna et al. (1992) c SNP previously reported by Jackson and Capra (1993) Table 1C. Summary of genetic variations detected in the TAP2 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5Ј Flanking -63 C/Tb 2 5Ј Flanking -55 G/Ab 3 Exon 1 61 T/C(5ЈUTR)b 4 Intron 1 39 G/Ab 5 Intron 1 311 A/Gb 6 Intron 2 48 G/Cb 7 Intron 3 7 G/Ab 8 Intron 3 8 G/A 9 Intron 3 265 A/Gb 10 Intron 3 1474 T/Cb rs241429 11 Intron 4 104 C/T 12 Intron 5 111 G/Ab rs241430 13 Intron 5 124 G/Ab 14 Exon 6 190 G/A(Val379Ile)b,c rs1800454 15 Exon 7 15 G/T(Gly386Gly)b 16 Intron 7 1379 G/A rs1015166 17 Intron 7 1399 G/A rs117821 18 Intron 9 168 C/T rs241436 19 Intron 10 23 C/T rs241437 20 Intron 10 87 G/A rs241438 21 Intron 10 170 A/C rs241439 22 Intron 10 219 A/G 23 Intron 10 346 G/A rs241440 24 Exon 11 17 G/A(Gly604Gly) rs241441 25 Intron 11 9 C/T rs241442 26 Intron 11 62 C/A rs241443 27 Intron 11 68 C/T rs241444 28 Intron 11 105 G/A rs241445 29 Intron 11 210 C/T rs241446 30 Intron 11 317-319 GTG/del 31 Exon 12 19 T/C(Cys651Arg) 32 Exon 12 61 A/G(Thr665Ala)c,d rs241447 33 Exon 12 127 T/C(stop687Gln)c,d rs241448 34 Exon 12 159 G/T(3ЈUTR)c,d rs241449 35 Exon 12 291 G/A(3ЈUTR) rs1871666 36 Exon 12 332 A/G(3ЈUTR) rs241451 37 Exon 12 356-357 GG/TGGTGGGGTGGA(3ЈUTR) TAP2, transporter associated with antigen processing 2 b SNPs previously reported by Jeffreys et al. (2000) c SNPs previously reported by Colonna et al. (1992) d SNPs previously reported by Powis et al. (1992) Materials and methods Exon-intron boundaries of the ABCB1, TAP1, TAP2, ABCB4, ABCB7, ABCB8, ABCB9, ABCB10, and ABCB11 genes were defined by comparing genomic sequences with mRNA sequences. Login to comment

[hide] Variation in the ATP-binding cassette transporter ... Genes Immun. 2009 Jun;10(4):350-5. Epub 2009 Apr 23. Ramos PS, Langefeld CD, Bera LA, Gaffney PM, Noble JA, Moser KL
Variation in the ATP-binding cassette transporter 2 gene is a separate risk factor for systemic lupus erythematosus within the MHC.
Genes Immun. 2009 Jun;10(4):350-5. Epub 2009 Apr 23., [PMID:19387463]

Abstract [show]
The ATP-binding cassette transporter (TAP) proteins are functionally relevant candidates for predisposition to systemic lupus erythematosus (SLE) by virtue of their role in autoantigen presentation and location in the major histocompatibility complex (MHC). We tested if variation in the TAP genes (TAP1 and TAP2) is associated with SLE. We genotyped tag single nucleotide polymorphisms (SNPs) and performed family-based association analysis on 390 Caucasian pedigrees. We found significant evidence of association between TAP2 and SLE (rs241453, P=1.33 x 10(-6)). Conditional logistic regression analysis suggests that this TAP2 effect is separate from the HLA-DRB1 alleles. Our analyses show that both rs241453 (P=1.6 x 10(-4)) and HLA-DRB1*03xx (P=2.3 x 10(-4)) have significant autonomous effects not due to linkage disequilibrium. Moreover, these loci exhibit a significant statistical interaction (P<1.0 x 10(-6)), demonstrated by an increase in the odds ratio for the TAP2 association from OR=2.00 (95% confidence interval (CI)=1.17-3.42) in HLA-DRB1*03xx-negative subjects to OR=4.29 (CI=1.88-9.76) in the subjects with at least one HLA-DRB1*03xx allele group. We report the largest association study of the TAP genes with SLE to date, and the first to test for its separate effect and interaction with the HLA alleles consistently associated with SLE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Past studies of TAP2 association with SLE have focused on three specific amino acids (V379I (rs1800454), A565 T (rs2228396) and T665A (rs241447)), had modest sample sizes (B100-200 cases) in ethnically diverse populations and were collectively inconclusive.7-11 Of these three SNPs, only rs241447 was included in our analyses, and it yielded a modest association. Login to comment

[hide] MHC loci affecting cervical cancer risk: distingui... Genes Immun. 2008 Oct;9(7):613-23. Epub 2008 Jul 24. Ivansson EL, Magnusson JJ, Magnusson PK, Erlich HA, Gyllensten UB
MHC loci affecting cervical cancer risk: distinguishing the effects of HLA-DQB1 and non-HLA genes TNF, LTA, TAP1 and TAP2.
Genes Immun. 2008 Oct;9(7):613-23. Epub 2008 Jul 24., [PMID:18650831]

Abstract [show]
Cervical cancer has been associated with specific human leukocyte antigen (HLA) haplotypes/alleles and with polymorphisms at the nearby non-HLA loci TNF, LTA, TAP1 and TAP2. Distinguishing effects of individual loci in the major histocompatibility complex (MHC) region are difficult due to the complex linkage disequilibrium (LD) pattern characterized by high LD, punctuated by recombination hot spots. We have evaluated the association of polymorphism at HLA class II DQB1 and the TNF, LTA, TAP1 and TAP2 genes with cervical cancer risk, using 1306 familial cases and 288 controls. DQB1 was strongly associated; alleles *0301, *0402 and (*)0602 increased cancer susceptibility, whereas *0501 and *0603 decreased susceptibility. Among the non-HLA loci, association was only detected for the TAP2 665 polymorphism, and interallelic disequilibrium analysis indicated that this could be due to LD with DQB1. As the TAP2 665 association was seen predominantly in non-carriers of DQB1 susceptibility alleles, we hypothesized that TAP2 665 may have an effect not attributable to LD with DQB1. However, a logistic regression analysis suggested that TAP2 665 was strongly influenced by LD with DQB1. Our results emphasize the importance of large sample sizes and underscore the necessity of examining both HLA and non-HLA loci in the MHC to assign association to the correct locus.

Comments [show]

The TAP2 A565T, which is homologous to position 507 in CFTR, does not significantly affect cervical cancer risk (see Table 2).
hegedus on 2013-03-20 18:59:52

Sentences [show]
No. Sentence Comment
138 Genomic location on chr6 Minor allele frequency in controls Genotyping method LTA IntronA A/G rs909253 31648292 0.376 Inflastripa TNF À857 C/T rs1799724 31650461 0.067 TaqMan TNF À572 A/C rs4248161 31650746 0.014 TaqMan TNF À308 G/A rs1800629 31651010 0.167 Inflastripa TNF À238 G/A rs361525 31651080 0.047 Inflastripa TAP2 T665A T/C rs241447 32904729 0.244 TaqMan TAP2 R651C G/A rs4148876 32904771 0.070 TaqMan TAP2 A565T C/T rs2228396 32905787 0.112 TaqMan TAP2 V379I C/T rs1800454 32908390 0.164 TaqMan TAP1 D697G T/C rs1135216 32922953 0.167 TaqMan TAP1 I393V T/C rs1057141 32926752 0.190 TaqMan Abbreviations: HLA, human leukocyte antigen; LTA, lymphotoxin-alpha; TAP, transporter associated with antigen processing; TNF, tumor necrosis factor. Login to comment

[hide] Strong associations of psoriasis with antigen proc... Genes Immun. 2007 Sep;8(6):513-7. Epub 2007 Jun 21. Kramer U, Illig T, Grune T, Krutmann J, Esser C
Strong associations of psoriasis with antigen processing LMP and transport genes TAP differ by gender and phenotype.
Genes Immun. 2007 Sep;8(6):513-7. Epub 2007 Jun 21., [PMID:17581627]

Abstract [show]
Psoriasis, a skin disease with autoimmune features, can be triggered and exacerbated by genetic and environmental factors. Chemicals can break tolerance to self-antigens by interfering with antigen processing and presentation; therefore, proteins involved in antigen processing may affect susceptibility. We test here whether variants of immunoproteasome subunits LMP2 and LMP7, or antigen peptide transport proteins TAP1 (transporters associated with antigen presentation) and TAP2 are associated with psoriasis. We analyzed 7 single-nucleotide polymorphisms in 321 Caucasian (German) psoriasis patients and 235 unrelated controls by time-of-flight mass spectrometry, using the Sequenom platform. We found strong associations of psoriasis with variant alleles of LMP and TAP (OR(TAP_687): 3.3, 95% CI: 1.9-5.7). Genotype effects were generally stronger for males and LMP effects were mainly seen for psoriasis arthropathica. Our results will help define behavioral or drug treatment suggestions to patients and contribute to a better understanding of the role of low molecular weight chemicals in genetic susceptibility to autoimmune diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Owing to a recombination hot spot, a second independent Table 1 Genotype frequencies in cases and controls of psoriasis patients2 ordered by frequency Locus/effect Genotype Genotype frequencies Odds ratio (95% confidence limits) w2 P-value P-value after Bonferroni correction (six independent tests) Cases Control LMP2_60/Arg60His G/G 0.64 0.52 2.50 (1.41-4.45) 9.73 0.0018 0.0108 A/G 0.33 0.41 A/A 0.04 0.07 TAP1_637/Asp637Gly A/A 0.71 0.79 2.50 (1.25-5.02) 6.64 0.0100 0.0600 A/G 0.26 0.19 G/G 0.03 0.02 LMP7_49/Lys49Gln C/C 0.66 0.74 1.93 (0.98-3.80) 3.66 0.0556 0.3336 A/C 0.31 0.24 A/A 0.03 0.02 TAP2_565/Thr565Ala C/C 0.88 0.86 1.25 (0.52-2.99) 0.24 0.6215 - C/T 0.12 0.13 T/T 0.01 0.01 TAP2_651/Arg651Cys C/C 0.89 0.87 1.40 (0.50-3.90) 0.40 0.5621 - C/T 0.11 0.13 T/T 0.00 0.00 TAP2_665/Thr665Ala A/A 0.37 0.53 3.18 (1.84-5.48) 17.23 0.00002 0.00012 A/G 0.49 0.41 G/G 0.14 0.06 TAP2_687/À687Gln T/T 0.37 0.53 3.27 (1.90-5.63) 18-27 0.00002 0.00012 C/T 0.49 0.41 C/C 0.14 0.06 Genotyping analyses were carried out by using the MassARRAY system (Sequenom, San Diego, CA, USA). Login to comment

[hide] Genes of the LMP/TAP cluster are associated with t... Genes Immun. 2003 Oct;4(7):492-9. Casp CB, She JX, McCormack WT
Genes of the LMP/TAP cluster are associated with the human autoimmune disease vitiligo.
Genes Immun. 2003 Oct;4(7):492-9., [PMID:14551602]

Abstract [show]
Genes within the class II region of the major histocompatibility complex (MHC), including genes involved in antigen processing and presentation, have been reported to be associated with several autoimmune diseases. We report here that the LMP/TAP gene region is significantly associated with vitiligo, a disorder in which biochemical defects and/or autoimmune destruction cause melanocyte loss and resulting skin depigmentation. Case/control analyses revealed genetic association of vitiligo in Caucasian patients with an early age of onset with the transporter associated with antigen processing-1 (TAP1) gene. A family-based association method revealed biased transmission of specific alleles from heterozygous parents to affected offspring for the TAP1 gene, as well as for the closely linked LMP2 and LMP7 genes encoding subunits of the immunoproteasome. No association with vitiligo was found for the MECL1 gene, which encodes a third immunoproteasome subunit and is unlinked to the MHC class II region. These results suggest a possible role for the MHC class I antigen processing and/or presentation pathway in the antimelanocyte autoimmune response involved in vitiligo pathogenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Restriction enzyme Fragment sizes (bp) Gene Polymorphism Name Sequences (50 to 30 ) Uncut Cut SNP ID LMP2 G/A exon 3 (R60H) LMP2-2 GTGAACCGAGTGTTTGACAAGC 581C HhaI 252 212,40 rs17587 LMP2-1 GCCAGCAAGAGCCGAAACAAG TAP1 C/T intron 7 TAP1-15 GTGCTCTCACGTTCCAAGGA 551C MspI 183 161,22 rs735883 TAP1-16 AGGAGTAGAGATAGAAGAACCa TAP1 G/A exon 10 (D637G) TAP1-10 CTCATCTTGGCCCTTTGCTC 601C AccI 165 136,29 rs1800453 TAP1-11 CACCTGTAACTGGCTGTTTG LMP7 A/C exon 2 (Q49K) LMP7-Z TCGCTTTACCCCGGGGACTGb 631C PstI 212 194,18 rs2071543 LMP7-BR AACTTGCACTTCCTCCTCTCAGG LMP7 G/T intron 6 LMP7-7 TTGATTGGCTTCCCGGTACTG 581C HhaI 583,180 428,180,155 Ref. 1 LMP7-4 TCTACTACGTGGATGAACATGG TAP2 G/A exon 5 (V379I) TAP2-3 GAACGTGCCTTGTACCTGCGCc 571C BstUI 212 192,20 rs1800454 TAP2-4 ACCCCCAAGTGCAGCAC TAP2 A/G exon 11 (T665A) TAP2-5 GGTGATTGCTCACAGGCTGCCGd 611C MspI 225 205,20 rs241447 TAP2-6 CACAGCTCTAGGGAAACTC MECL1 T/C exon 4 (L107L) MECL1-1 TCGACTTGGGTTGCAGGCTTAC 651C MluI 973,131 535,438,131 rs20549 MECL1-2 ATCTGAAGTAACCGCTGCGAC a Underlined nucleotide in primer TAP1-16 was changed from the germline G to a C to create the MspI RFLP. Login to comment
43 Table 3 Allele frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo patients (age of onset 0-29 years) and control subjects Vitiligo patients Controls Gene Polymorphism Allele Count Percentage Count Percentage P-value LMP2 G/A exon 3 (R60H) G 62 32.6 95 26.2 0.11 A 128 67.4 267 73.8 TAP1 C/T intron 7 C 80 44.4 121 38.8 0.22 T 100 55.6 191 61.2 TAP1 G/A exon 10 (D637G) A 29 14.8 89 25.6 0.0034 G 167 85.2 259 74.4 LMP7 A/C exon 2 (Q49K) A 165 87.8 296 88.1 0.91 C 23 12.2 40 11.9 LMP7 G/T intron 6 G 95 52.2 142 42.8 0.040 T 87 47.8 190 57.2 TAP2 A/G exon 5 (V379I) A 40 21.7 74 21.0 0.85 G 144 78.3 278 79.0 TAP2 A/G exon 11 (T665A) A 139 71.6 257 69.8 0.65 G 55 28.4 111 30.2 MECL1 T/C exon 4 (L107L) T 146 80.2 259 80.9 0.84 C 36 19.8 61 19.1 Family-based association Further evidence for genetic association between LMP/ TAP genes and vitiligo susceptibility was sought using the transmission disequilibrium test (TDT), a family-based (intrafamilial) study design that considers heterozygous parents and evaluates the frequency with which alleles are transmitted to affected offspring.27 A w2 test was used to evaluate the deviation of the rates of transmission and nontransmission from the random expectation (Table 5). Login to comment
54 Using a whole genome scan of a large family cluster with both vitiligo and Hashimoto thyroiditis, a general autoimmune susceptibility locus (AIS1) was mapped to human chromosome 1, and evidence was reported for a Hashimoto disease susceptibility locus within a chromosome 6 region spanning both the MHC and AIDT1, a non-MHC locus associated with susceptibility to both Hashimoto thyroiditis and Graves` disease.24 A linkage disequilibrium analysis of 56 multigeneration Columbian families with vitiligo using microsatellite markers spanning the entire human MHC region revealed a major genetic factor within the MHC at 6p21.3-21.4, with a dominant mode of inheritance in vitiligo patients with an early age of onset and a recessive mode of inheritance influenced by environmental effects in vitiligo patients with an age of onset after 30 years of age.10 Comparisons of a variety of inheritance models suggested that the most parsimonious genetic model was that of a major Table 4 Genotype frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo patients and (age of onset 0-29 years) control subjects Vitiligo patients Controls Gene Polymorphism Genotype Count Percentage Count Percentage P-value LMP2 G/A exon 3 (R60H) GG 6 6.3 12 6.6 0.095 GA 50 52.6 71 39.2 AA 39 41.1 98 54.1 TAP1 C/T intron 7 CC 21 23.3 27 17.3 0.47 CT 38 42.2 67 43.0 TT 31 34.5 62 39.7 TAP1 G/A exon 10 (D637G) AA 1 1.0 8 4.6 0.0094 AG 27 27.6 73 42.0 GG 70 71.4 93 53.4 LMP7 A/C exon 2 (Q49K) AA 73 77.7 131 78.0 0.98 CA 19 20.2 34 20.2 CC 2 2.1 3 1.8 LMP7 G/T intron 6 GG 26 28.6 28 16.9 0.077 GT 43 47.3 86 51.8 TT 22 24.2 52 31.3 TAP2 A/G exon 5 (V379I) AA 9 9.8 14 8.0 0.84 AG 22 23.9 46 26.1 GG 61 66.3 116 65.9 TAP2 A/G exon 11 (T665A) AA 51 52.6 90 48.9 0.83 AG 37 38.1 77 41.9 GG 9 9.3 17 9.2 MECL1 T/C exon4(L107L) TT 60 65.9 107 66.9 0.98 TC 26 28.6 45 28.1 CC 5 5.5 8 5.0 dominant gene plus environmental effects, although multifactorial models could not be rejected.10 Many other HLA associations have been reported between specific alleles of complement, class I and class II MHC genes with vitiligo in various ethnic and racial subpopulations (reviewed in Friedmann9 ), but no common HLA association is observed. Login to comment
66 TAP1 amino-acid polymorphisms, including D637G (in this report) and I333V, have been reported to influence the permissiveness of transport of specific peptides across the endoplasmic reticulum in some models,40 and the TAP2 polymorphism T665A (in this report) has been suggested to influence the antibody response to measles virus vaccine.41 Two functional studies of human TAP polymorphisms, however, revealed no significant influence of human TAP1 or TAP2 alleles on peptide binding and translocation.42,43 Fewer functional studies have been performed on LMP polymorphisms; however, it has been reported that the LMP2 R60H and LMP7 Q49K polymorphisms (in this report) affect age-dependent TNF-a apoptosis and response to interferon in patients with chronic hepatitis C, respectively.44,45 Immunoproteasomes might also play an integral role in maintaining peripheral tolerance. Login to comment
67 Immunoproteasomes are constitutively expressed in the thymus and Table 5 Family-based association (transmission disequilibrium test) results for LMP/TAP and MECL1 candidate genes and vitiligo susceptibility Gene Marker Number of informative parents Transmitted Not transmitted % Transmitted P-value LMP2 G/A exon 3 (R60H) 38 26 12 68 0.023 TAP1 C/T intron 7 50 34 16 68 0.011 TAP1 G/A exon 10 (D637G) 35 24 11 69 0.028 LMP7 A/C exon 2 (Q49K) 26 16 10 62 0.24 LMP7 G/T intron 6 45 36 9 80 0.000057 TAP2 A/G exon 5 (V379I) 22 12 10 55 0.67 TAP2 A/G exon 11 (T665A) 56 31 25 55 0.42 MECL1 T/C exon 4 (L107L) 47 24 23 51 0.88 by mature dendritic cells under conditions in which most T-cell activation occurs, whereas elsewhere in the periphery constitutive proteasomes are expressed in the absence of inflammation. Login to comment
94 The second TAP2 polymorphism genotyped in this was an A/G substitution resulting in an amino-acid change in exon 11 (T665A). Login to comment

[hide] Analysis of MHC encoded antigen-processing genes T... Am J Respir Crit Care Med. 1999 Sep;160(3):1009-14. Foley PJ, Lympany PA, Puscinska E, Zielinski J, Welsh KI, du Bois RM
Analysis of MHC encoded antigen-processing genes TAP1 and TAP2 polymorphisms in sarcoidosis.
Am J Respir Crit Care Med. 1999 Sep;160(3):1009-14., [PMID:10471632]

Abstract [show]
Sarcoidosis is a chronic granulomatous disease of unknown etiology. Several studies have suggested involvement of human leukocyte antigen (HLA) genes in sarcoidosis susceptibility. HLA associations described have not been consistent, possibly because of additional susceptibility genes adjacent to or within the major histocompatibility complex (MHC) such as genes for the transporter associated with antigen processing (TAP). The aim of this study was to analyze TAP gene polymorphisms in patients with sarcoidosis using the amplificatory refraction mutation system (ARMS) PCR. To determine whether any association between TAP gene variation and sarcoidosis was ethnic-independent we examined two European populations: 117 unrelated UK Caucasoid patients with sarcoidosis and 290 healthy UK control subjects, and 87 unrelated Polish Slavonic patients with sarcoidosis and 158 healthy Polish control subjects. We detected significant differences in TAP2 between the UK control and patient groups, and in TAP2 between the Polish control and patient groups. Comparing the UK and Polish control groups, we observed a difference in TAP1. Examination of HLA-DPB1 in our UK population showed no associations with disease or between variants at the TAP gene loci and HLA-DPB1 variants. These results suggest associations at the TAP loci occur independently of HLA-DPB1 associations, that TAP associations seen may be involved in determining sarcoidosis susceptibility, and that such susceptibilities differ between UK and Polish populations. This first study of TAP genes in UK and Polish sarcoid populations has demonstrated the importance of using multiple defined ethnic populations in defining the role genetic factors play in sarcoidosis susceptibility and the importance of candidate gene studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Statistical Analysis Statistical analysis was performed on the individual polymorphism results for the two populations studied using chi-square contingency ta- TABLE 2 COMPARISON OF TAP1 AND TAP2 POLYMORPHISM IN UK PATIENTS WITH SARCOIDOSIS AND CONTROL SUBJECTS STUDIED TAP Polymorphism Frequencies UK Control Subjects (%) (n ϭ 290) UK Patients with Sarcoidosis (%) (n ϭ 117) ␹2 * p Value Odds Ratio (95% CI)† TAP1 P333 Phenotypes Ile-333 97.9 97.4 NS NS - Val-333 33.4 35.0 NS NS - Genotypes Ile-333/Ile-333 66.6 65.0 Ile-333/Val-333 31.4 32.5 NS NS - Val-333/Val-333 2.1 2.5 TAP1 position 637 Phenotypes Asp-637 99.3 100 NS NS - Gly-637 31.4 27.4 NS NS - Genotypes Asp-637/Asp-637 68.6 72.6 Asp-637/Gly-637 30.7 27.4 NS NS - Gly-637/Gly-637 0.7 0 TAP2 position 379 Phenotypes Val-379 99.7 99.1 NS NS - Ile-379 25.2 25.6 NS NS - Genotypes Val-379/Val-379 74.8 74.4 Val-379/Ile-379 24.8 24.8 NS NS - Ile-379/Ile-379 0.3 0.9 TAP2 position 565 Phenotypes Ala-565 99.7 100 NS NS - Thr-565 19.0 8.5 6.74 0.009 0.4 (0.18-0.85) Genotypes Ala-565/Ala-565 81.0 91.5 2.5 (1.18-5.45) Ala-565/Thr-565 18.6 8.5 6.86 0.03 0.41 (0.19-0.87) Thr-565/Thr-565 0.3 0 TAP2 position 665 Phenotypes Thr-665 95.5 97.4 NS NS - Ala-665 51.4 35.0 8.93 0.003 0.51 (0.32-0.81) Genotypes Thr-665/Thr-665 48.6 65.0 1.96 (1.23-3.13) Thr-665/Ala-665 46.9 32.5 9.01 0.01 0.54 (0.34-0.87) Ala-665/Ala-665 4.5 2.6 0.56 (0.12-2.16) * The chi-square test with 1 df was performed for the comparison of overall phenotype frequencies. Login to comment
91 When we examined the HLA-DPB1 allele and phenotype frequencies in the UK control and patient groups, no difference was seen in the frequency of participants carrying HLA- TABLE 3 COMPARISON OF TAP1 AND TAP2 POLYMORPHISM IN THE POLISH PATIENTS WITH SARCOIDOSIS AND THE CONTROL SUBJECTS STUDIED TAP Polymorphism Frequencies Polish Control Subjects (%) (n ϭ 158) Polish Patients with Sarcoidosis (%) (n ϭ 87) ␹2 p Value TAP1 position 333 Phenotypes Ile-333 98.7 96.6 NS NS Val-333 31.0 29.5 NS NS Genotypes Ile-333/Ile-333 69.0 70.1 Ile-333/Val-333 29.7 26.4 NS NS Val-333/Val-333 1.3 3.4 TAP1 position 637 Phenotypes Asp-637 98.7 95.4 NS NS Gly-637 22.5 32.2 NS NS Genotypes Asp-637/Asp-637 77.5 67.8 Asp-637/Gly-637 21.2 27.6 NS NS Gly-637/Gly-637 1.3 5 TAP2 position 379 Phenotypes Val-379* 97.5 93.1 5.63 0.02 Ile-379 25.0 31.0 NS NS Genotypes Val-379/Val-379 75.0 69.0 Val-379/Ile-379 22.5 24.1 NS NS Ile-379/Ile-379 2.5 6.9 TAP2 position 565 Phenotypes Ala-565 100 100 NS NS Thr-565 23.1 20.5 NS NS Genotypes Ala-565/Ala-565 76.9 79.3 Ala-565/Thr-565 23.1 20.7 NS NS Thr-565/Thr-565 0.0 0 TAP2 position 665 Phenotypes Thr-665 96.2 97.7 NS NS Ala-665 46.9 38.6 NS NS Genotypes Thr-665/Thr-665 53.1 62.1 Thr-665/Ala-665 43.1 35.6 NS NS Ala-665/Ala-665 3.8 2.3 * Odds ratio ϭ 0.17; 95% CI ϭ 0.02-1.0. Login to comment

[hide] TAP polymorphism in patients with Behcet's disease... Ann Rheum Dis. 1995 May;54(5):386-8. Gonzalez-Escribano MF, Morales J, Garcia-Lozano JR, Castillo MJ, Sanchez-Roman J, Nunez-Roldan A, Sanchez B
TAP polymorphism in patients with Behcet's disease.
Ann Rheum Dis. 1995 May;54(5):386-8., [PMID:7794046]

Abstract [show]
OBJECTIVE: To determine if susceptibility to Behcet's disease (BD) is associated with polymorphism of HLA-DRB1, HLA-DQB1, DQB1, and TAP1 and TAP2 genes. METHODS: Fifty eight Spanish BD patients and 116 ethnically matched unrelated healthy subjects were typed at the HLA-DRB1 and HLA-DQB1 loci using polymerase chain reaction/sequence specific oligotyping (PCR/SSO). TAP1 and TAP2 alleles were assigned using amplification refractory mutation system-PCR. RESULTS: TAP1C was absent in BD patients, but was found in 12.1% of control subjects (pcorr < 0.05; relative risk = 0.06). Additionally, a linkage disequilibrium between HLA-DQB1*0501 and TAP2B was observed in BD patients (delta = 0.095, pcorr < 0.02), but not in the control group (delta = -0.0031, p > 0.05). CONCLUSIONS: The complete absence of TAP1C alleles in BD patients may indicate that TAP1 polymorphism is not without some significance in the development of BD. Furthermore, the existence of a linkage disequilibrium between HLA-DQB1*0501 and TAP2B in our patients suggests that the gene conferring susceptibility for BD is inherited as an extended haplotype in the population studied.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 The same is true for TAP2 when Val-379/1le-379 and Thr-665/Ala-665 are present: two interpretations are possible if Ala-565 is found (we were not able to find Thr-565 in any subject)-TAP2B/TAP2C or TAP2AfTAP2H; as TAP2H is an extremely unusual allele, the former possibility is much more likely. Login to comment

[hide] Alleles and haplotypes of the MHC-encoded ABC tran... Immunogenetics. 1993;37(5):373-80. Powis SH, Tonks S, Mockridge I, Kelly AP, Bodmer JG, Trowsdale J
Alleles and haplotypes of the MHC-encoded ABC transporters TAP1 and TAP2.
Immunogenetics. 1993;37(5):373-80., [PMID:8428770]

Abstract [show]
TAP1 and TAP2 are two major histocompatibility complex (MHC) genes, located between HLA-DP and -DQ, whose products form a transporter molecule involved in endogenous antigen processing. Polymorphic residues have been described in both genes and, in this study, we have identified another polymorphic site within the adenosine triphosphate (ATP)-binding domain of TAP2. We have used the amplification refractory mutation system (ARMS) polymerase chain reaction (PCR) to characterize TAP1 and TAP2 alleles and haplotypes in a reference panel of 115 homozygous typing cell lines. Of four possible TAP1 alleles, we observed three, and of eight possible TAP2 alleles, we observed five. Among 88 (homozygous typing cells) (HTCs) homozygous at HLA-DR, -DQ and -DP, 80 were also homozygous at TAP1 and TAP2. Of 27 HTCs homozygous at HLA-DR and -DQ, but heterozygous at -DP, 14 were homozygous at TAP1 or TAP2 and 13 heterozygous, consistent with recombination taking place either side of the TAP loci. Of the fifteen possible combinations of TAP1 and TAP2 alleles, we observed eleven, each at a frequency similar to that predicted by individual allele frequencies. In this ethnically heterogenous panel there is no indication that particular combinations of TAP1 and TAP2 have been maintained together.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Previously, we reported sequences of TAP2 which differed by two amino acid substitutions: Glu for Stop at position 687 and Ala for Thr at position 665, and a silent nucleotide substitution, T for G at position 2091 (Powis et al. 1992b). Login to comment

[hide] TAP1 and TAP2 polymorphism in coeliac disease. Immunogenetics. 1993;38(5):345-50. Powis SH, Rosenberg WM, Hall M, Mockridge I, Tonks S, Ivinson A, Ciclitira PJ, Jewell DP, Lanchbury JS, Bell JI, et al.
TAP1 and TAP2 polymorphism in coeliac disease.
Immunogenetics. 1993;38(5):345-50., [PMID:8344720]

Abstract [show]
Coeliac disease is strongly associated with HLA-DQ2, but it is possible that additional major histocompatibility complex genes also confer disease susceptibility. Encoded close to HLA-DQ are two genes, TAP1 and TAP2, whose products are believed to transport antigenic peptides from the cytoplasm into the endoplasmic reticulum. Comparison of 81 coeliac disease patients with caucasoid controls revealed an increased frequency of the alleles TAP1A and TAP2A in the patient population. However, no significant difference was found when patients were compared with HLA-DR and -DQ matched controls, indicating linkage disequilibrium between TAP1A, TAP2A, and HLA-DQ2. The TAP gene products do not have a major influence on susceptibility or resistance to coeliac disease in a Northern European Caucasoid population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 TAP polymorphism Controls CD (n = 69) (n = 81) n % n % TAP2 position 379: Phenotype frequencies Val-379/Val-379 43 62.3 Val-379/Ile-379 25 36.2 Ile-379/Ile-379 1 1.4 Val-379 68 98.6 Ile-379 26 37.7 Gene frequencies Val-379 111 80.4 Ile-379 27 19.6 TAP2 position 565: Phenotype frequencies Ala-565/Ala-565 49 71 Ala-565/Thr-565 20 29 Thr-565/Thr-565 0 0 Ala-565 69 100 Thr-565 20 29 Gene frequencies Ala-565 118 85.5 Thr-565 20 14.5 TAP2 position 665: Phenotype frequencies Thr-665/Thr-665 39 56.5 Thr-665/Ala-665 27 39.1 Ala-665/Ala-665 3 4.3 Thr-665 66 95.7 Ala-665 30 43.5 Gene frequencies Thr-665 105 76.1 Ala-665 33 23.9 TAP1 position 333: Phenotype frequencies Ile-333/Ile-333 51 73.9 Ile-333/Val-333 16 23.2 Val-333/Val-333 2 2.9 Iie-333 67 97.1 Val-333 18 26.1 Gene frequencies Ile-333 118 85.5 Val-333 20 14.5 TAP1 position 637: Phenotype frequencies Asp-637/Asp-637 54 78.3 Asp-637/Gly-637 13 18.8 Gly-637/Gly-637 2 2.9 Asp-637 67 97.1 Gly-637 15 21.7 Gene frequencies Asp-637 121 87.7 Gly-637 17 12.3 74 91.4 * 7 8.6 * 0 0 81 100 7 8.6 * 155 95.7 * 7 4.3 * 75 92.6 * 6 7.4 * 0 0 81 100 6 7.4 * 156 96.3 * 6 3.7 * 69 85.2 * 10 12.3 * 2 2.5 79 97.5 12 14.8 * 148 91.4 * 14 8.6 * 68 84 12 14.8 1 1.2 80 98.8 13 16 148 91.4 14 8.6 71 87.7 9 11.1 1 1.2 80 98.8 10 12.3 151 93.2 11 6.8 Chi-square or Fisher's exact test: *p <0.001. Login to comment

[hide] New transporter associated with antigen processing... Hum Immunol. 2003 Jul;64(7):733-40. Lajoie J, Zijenah LS, Faucher MC, Ward BJ, Roger M
New transporter associated with antigen processing (TAP-2) polymorphisms in the Shona people of Zimbabwe.
Hum Immunol. 2003 Jul;64(7):733-40., [PMID:12826376]

Abstract [show]
Most studies, to date, on transporter associated with antigen processing (TAP2) polymorphism have been conducted in Caucasians or Asians from industrialized countries. Because of the essential role of this molecule in antigen processing, the implication that polymorphism could be a major factor in human disease and the possible genetic variation at this locus among ethnically diverse populations, we undertook a study to analyze the full extent of TAP2 polymorphism in an indigenous Zimbabwean population (Shona ethnic group). Using single-stranded conformation polymorphism and DNA direct sequencing procedures, we detected the presence of 17 nucleotide sequence variations in the entire coding region of TAP2. Of these variants, 11 are nonconservative substitutions with respect to amino acid composition and are located in a region of the protein that could modulate its function. Six new polymorphic sites were identified in exon 1 (codons 15 Val-->Ala, 53 Leu-->Val), exon 3 (codon 220 Arg-->Arg), exon 4 (codons 257 Thr-->Ile, 313 Arg-->His), and exon10 (codon 609 Ala-->Val). Significant differences were seen in the distribution of the known 374Thr, 565Thr and 651Cys variants between African and non-African populations. These differences may reflect evolutionary pressures generated by environmental factors, such as prevalent pathogens in these geographically distinct regions. Further studies are needed to elucidate the net impact of TAP2 polymorphism on the protein's function and it's role in disease pathogenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 It is interesting to note that 565Thr and 651Cys variants in Rwandans do not follow TABLE 4 Allelic frequencies of TAP 2 single nucleotide polymorphisms in different populations Population Number of alleles T257I R313H A374T V379I A565T A609V R651C T665A Zimbabwean 384 3.4% 4.7% 9.1% 19.3% 13.5% 3.9% 0% 20.3% Caucasiansa 152 - - 0% 18.4% 0.7% - 5.3% 15.1% Braziliansa 296 - - 2.0% 13.2% 10.1% - 4.0% 32.4% Rwandansa 570 - - 6.7% 11.8% 0% - 10.0% 30.2% Zambiansa 234 - - 6.8% 10.2% 18.3% - 0% 23.5% a From [41]. Login to comment

[hide] Significant association between TAP2 polymorphisms... Diagn Pathol. 2014 Jun 27;9:129. doi: 10.1186/1746-1596-9-129. Dai D, Chen Y, Ru P, Zhou X, Tao J, Ye H, Hong Q, Tang L, Pan G, Lin D, Gong Q, Lv Y, Xu L, Duan S
Significant association between TAP2 polymorphisms and rheumatoid arthritis: a meta-analysis.
Diagn Pathol. 2014 Jun 27;9:129. doi: 10.1186/1746-1596-9-129., [PMID:24972609]

Abstract [show]
BACKGROUND: Rheumatoid arthritis (RA) is a severe chronic immune mediated inflammatory disease that has been shown to be associated with human leukocyte antigen (HLA) loci. The transporter associated with antigen processing 2 (TAP2) has been identified to play an important role in the HLA-associated diseases and immune response. The goal of our meta-analysis was to summarize the contribution of TAP2 polymorphisms to the risk of RA. METHODS: Meta-analyses were performed between RA and 3 TAP2 coding polymorphisms that comprised TAP2-379Ile > Val (rs1800454), TAP2-565Ala > Thr (rs2228396) and TAP2-665Thr > Ala (rs241447). The meta-analyses were involved with 9 studies (24 individual studies) among 973 cases and 965 controls. RESULTS: Meta-analyses showed that TAP2-379Ile allele was significantly associated with an increased risk of RA (p = 0.0002, odds ratio (OR) = 1.44, 95% confidence interval (CI) = 1.18-1.74). This association was further shown only in the dominant model (p = 0.006, OR = 1.59, 95% CI = 1.14-2.22). Subgroup analyses by ethnicity revealed that the association of TAP2-379Ile was significant in Asians (p = 0.03, OR = 1.38, 95% CI = 1.04-1.83). In addition, another significant association of TAP2-565Thr allele with RA was observed in Europeans (p = 0.002, OR = 1.62, 95% CI = 1.20-2.20). CONCLUSIONS: Our meta-analyses suggested that TAP2-379Ile allele was significantly associated with a 59% increased risk in the dominant effect model. Subgroup analyses by ethnicity showed that TAP2-379-Ile increased the risk of RA by 38% in Asians and TAP2-565Thr increased the risk of RA by 38% in Europeans. VIRTUAL SLIDES: The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/2097080313124700.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Among them, Ile379Val, Ala565Thr and Thr665Ala are * Correspondence: duanshiwei@nbu.edu.cn ߤ Equal contributors 1 Zhejiang Provincial Key Laboratory of Pathophysiology, School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, China Full list of author information is available at the end of the article (c) 2014 Dai et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. Login to comment