PMID: 14551602

Casp CB, She JX, McCormack WT
Genes of the LMP/TAP cluster are associated with the human autoimmune disease vitiligo.
Genes Immun. 2003 Oct;4(7):492-9., [PubMed]
Sentences
No. Mutations Sentence Comment
27 ABCB3 p.Val379Ile
X
ABCB3 p.Val379Ile 14551602:27:680
status: NEW
view ABCB3 p.Val379Ile details
ABCB3 p.Thr665Ala
X
ABCB3 p.Thr665Ala 14551602:27:792
status: NEW
view ABCB3 p.Thr665Ala details
Restriction enzyme Fragment sizes (bp) Gene Polymorphism Name Sequences (50 to 30 ) Uncut Cut SNP ID LMP2 G/A exon 3 (R60H) LMP2-2 GTGAACCGAGTGTTTGACAAGC 581C HhaI 252 212,40 rs17587 LMP2-1 GCCAGCAAGAGCCGAAACAAG TAP1 C/T intron 7 TAP1-15 GTGCTCTCACGTTCCAAGGA 551C MspI 183 161,22 rs735883 TAP1-16 AGGAGTAGAGATAGAAGAACCa TAP1 G/A exon 10 (D637G) TAP1-10 CTCATCTTGGCCCTTTGCTC 601C AccI 165 136,29 rs1800453 TAP1-11 CACCTGTAACTGGCTGTTTG LMP7 A/C exon 2 (Q49K) LMP7-Z TCGCTTTACCCCGGGGACTGb 631C PstI 212 194,18 rs2071543 LMP7-BR AACTTGCACTTCCTCCTCTCAGG LMP7 G/T intron 6 LMP7-7 TTGATTGGCTTCCCGGTACTG 581C HhaI 583,180 428,180,155 Ref. 1 LMP7-4 TCTACTACGTGGATGAACATGG TAP2 G/A exon 5 (V379I) TAP2-3 GAACGTGCCTTGTACCTGCGCc 571C BstUI 212 192,20 rs1800454 TAP2-4 ACCCCCAAGTGCAGCAC TAP2 A/G exon 11 (T665A) TAP2-5 GGTGATTGCTCACAGGCTGCCGd 611C MspI 225 205,20 rs241447 TAP2-6 CACAGCTCTAGGGAAACTC MECL1 T/C exon 4 (L107L) MECL1-1 TCGACTTGGGTTGCAGGCTTAC 651C MluI 973,131 535,438,131 rs20549 MECL1-2 ATCTGAAGTAACCGCTGCGAC a Underlined nucleotide in primer TAP1-16 was changed from the germline G to a C to create the MspI RFLP. Login to comment
43 ABCB3 p.Val379Ile
X
ABCB3 p.Val379Ile 14551602:43:579
status: NEW
view ABCB3 p.Val379Ile details
ABCB3 p.Thr665Ala
X
ABCB3 p.Thr665Ala 14551602:43:647
status: NEW
view ABCB3 p.Thr665Ala details
Table 3 Allele frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo patients (age of onset 0-29 years) and control subjects Vitiligo patients Controls Gene Polymorphism Allele Count Percentage Count Percentage P-value LMP2 G/A exon 3 (R60H) G 62 32.6 95 26.2 0.11 A 128 67.4 267 73.8 TAP1 C/T intron 7 C 80 44.4 121 38.8 0.22 T 100 55.6 191 61.2 TAP1 G/A exon 10 (D637G) A 29 14.8 89 25.6 0.0034 G 167 85.2 259 74.4 LMP7 A/C exon 2 (Q49K) A 165 87.8 296 88.1 0.91 C 23 12.2 40 11.9 LMP7 G/T intron 6 G 95 52.2 142 42.8 0.040 T 87 47.8 190 57.2 TAP2 A/G exon 5 (V379I) A 40 21.7 74 21.0 0.85 G 144 78.3 278 79.0 TAP2 A/G exon 11 (T665A) A 139 71.6 257 69.8 0.65 G 55 28.4 111 30.2 MECL1 T/C exon 4 (L107L) T 146 80.2 259 80.9 0.84 C 36 19.8 61 19.1 Family-based association Further evidence for genetic association between LMP/ TAP genes and vitiligo susceptibility was sought using the transmission disequilibrium test (TDT), a family-based (intrafamilial) study design that considers heterozygous parents and evaluates the frequency with which alleles are transmitted to affected offspring.27 A w2 test was used to evaluate the deviation of the rates of transmission and nontransmission from the random expectation (Table 5). Login to comment
54 ABCB3 p.Val379Ile
X
ABCB3 p.Val379Ile 14551602:54:1641
status: NEW
view ABCB3 p.Val379Ile details
ABCB3 p.Thr665Ala
X
ABCB3 p.Thr665Ala 14551602:54:1726
status: NEW
view ABCB3 p.Thr665Ala details
Using a whole genome scan of a large family cluster with both vitiligo and Hashimoto thyroiditis, a general autoimmune susceptibility locus (AIS1) was mapped to human chromosome 1, and evidence was reported for a Hashimoto disease susceptibility locus within a chromosome 6 region spanning both the MHC and AIDT1, a non-MHC locus associated with susceptibility to both Hashimoto thyroiditis and Graves` disease.24 A linkage disequilibrium analysis of 56 multigeneration Columbian families with vitiligo using microsatellite markers spanning the entire human MHC region revealed a major genetic factor within the MHC at 6p21.3-21.4, with a dominant mode of inheritance in vitiligo patients with an early age of onset and a recessive mode of inheritance influenced by environmental effects in vitiligo patients with an age of onset after 30 years of age.10 Comparisons of a variety of inheritance models suggested that the most parsimonious genetic model was that of a major Table 4 Genotype frequencies of LMP/TAP and MECL1 candidate genes in Caucasian vitiligo patients and (age of onset 0-29 years) control subjects Vitiligo patients Controls Gene Polymorphism Genotype Count Percentage Count Percentage P-value LMP2 G/A exon 3 (R60H) GG 6 6.3 12 6.6 0.095 GA 50 52.6 71 39.2 AA 39 41.1 98 54.1 TAP1 C/T intron 7 CC 21 23.3 27 17.3 0.47 CT 38 42.2 67 43.0 TT 31 34.5 62 39.7 TAP1 G/A exon 10 (D637G) AA 1 1.0 8 4.6 0.0094 AG 27 27.6 73 42.0 GG 70 71.4 93 53.4 LMP7 A/C exon 2 (Q49K) AA 73 77.7 131 78.0 0.98 CA 19 20.2 34 20.2 CC 2 2.1 3 1.8 LMP7 G/T intron 6 GG 26 28.6 28 16.9 0.077 GT 43 47.3 86 51.8 TT 22 24.2 52 31.3 TAP2 A/G exon 5 (V379I) AA 9 9.8 14 8.0 0.84 AG 22 23.9 46 26.1 GG 61 66.3 116 65.9 TAP2 A/G exon 11 (T665A) AA 51 52.6 90 48.9 0.83 AG 37 38.1 77 41.9 GG 9 9.3 17 9.2 MECL1 T/C exon4(L107L) TT 60 65.9 107 66.9 0.98 TC 26 28.6 45 28.1 CC 5 5.5 8 5.0 dominant gene plus environmental effects, although multifactorial models could not be rejected.10 Many other HLA associations have been reported between specific alleles of complement, class I and class II MHC genes with vitiligo in various ethnic and racial subpopulations (reviewed in Friedmann9 ), but no common HLA association is observed. Login to comment
66 ABCB3 p.Thr665Ala
X
ABCB3 p.Thr665Ala 14551602:66:237
status: NEW
view ABCB3 p.Thr665Ala details
TAP1 amino-acid polymorphisms, including D637G (in this report) and I333V, have been reported to influence the permissiveness of transport of specific peptides across the endoplasmic reticulum in some models,40 and the TAP2 polymorphism T665A (in this report) has been suggested to influence the antibody response to measles virus vaccine.41 Two functional studies of human TAP polymorphisms, however, revealed no significant influence of human TAP1 or TAP2 alleles on peptide binding and translocation.42,43 Fewer functional studies have been performed on LMP polymorphisms; however, it has been reported that the LMP2 R60H and LMP7 Q49K polymorphisms (in this report) affect age-dependent TNF-a apoptosis and response to interferon in patients with chronic hepatitis C, respectively.44,45 Immunoproteasomes might also play an integral role in maintaining peripheral tolerance. Login to comment
67 ABCB3 p.Val379Ile
X
ABCB3 p.Val379Ile 14551602:67:514
status: NEW
view ABCB3 p.Val379Ile details
ABCB3 p.Thr665Ala
X
ABCB3 p.Thr665Ala 14551602:67:556
status: NEW
view ABCB3 p.Thr665Ala details
Immunoproteasomes are constitutively expressed in the thymus and Table 5 Family-based association (transmission disequilibrium test) results for LMP/TAP and MECL1 candidate genes and vitiligo susceptibility Gene Marker Number of informative parents Transmitted Not transmitted % Transmitted P-value LMP2 G/A exon 3 (R60H) 38 26 12 68 0.023 TAP1 C/T intron 7 50 34 16 68 0.011 TAP1 G/A exon 10 (D637G) 35 24 11 69 0.028 LMP7 A/C exon 2 (Q49K) 26 16 10 62 0.24 LMP7 G/T intron 6 45 36 9 80 0.000057 TAP2 A/G exon 5 (V379I) 22 12 10 55 0.67 TAP2 A/G exon 11 (T665A) 56 31 25 55 0.42 MECL1 T/C exon 4 (L107L) 47 24 23 51 0.88 by mature dendritic cells under conditions in which most T-cell activation occurs, whereas elsewhere in the periphery constitutive proteasomes are expressed in the absence of inflammation. Login to comment
92 ABCB3 p.Val379Ile
X
ABCB3 p.Val379Ile 14551602:92:264
status: NEW
view ABCB3 p.Val379Ile details
This SNP marker was genotyped using a modified PCR primer to create a PstI RFLP, such that the C allele is cleaved, whereas the A allele remains uncut. The first of two TAP2 polymorphisms studied was a G/A substitution resulting in an amino-acid change in exon 5 (V379I). Login to comment
94 ABCB3 p.Thr665Ala
X
ABCB3 p.Thr665Ala 14551602:94:117
status: NEW
view ABCB3 p.Thr665Ala details
The second TAP2 polymorphism genotyped in this was an A/G substitution resulting in an amino-acid change in exon 11 (T665A). Login to comment