ABCMdb

ABCB2 p.Gln277Cys

Predicted by SNAP2:	A: N (78%), C: N (61%), D: N (72%), E: N (82%), F: N (53%), G: N (72%), H: N (78%), I: N (72%), K: N (82%), L: N (61%), M: N (66%), N: N (87%), P: N (61%), R: N (66%), S: N (87%), T: N (82%), V: N (72%), W: D (66%), Y: D (63%),
Predicted by PROVEAN:	A: N, C: D, D: N, E: N, F: D, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, R: N, S: N, T: N, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Transporters associated with antigen processing (T... Dev Comp Immunol. 2011 Nov;35(11):1173-81. Epub 2011 Apr 19. Pinto RD, Pereira PJ, dos Santos NM
Transporters associated with antigen processing (TAP) in sea bass (Dicentrarchus labrax, L.): molecular cloning and characterization of TAP1 and TAP2.
Dev Comp Immunol. 2011 Nov;35(11):1173-81. Epub 2011 Apr 19., [PMID:21540052]

Abstract [show]
The transporters associated with antigen processing (TAP), play an important role in the MHC class I antigen presentation pathway. In this work, sea bass (Dicentrarchus labrax) TAP1 and TAP2 genes and transcripts were isolated and characterized. Only the TAP2 gene is structurally similar to its human orthologue. As other TAP molecules, sea bass TAP1 and TAP2 are formed by one N-terminal accessory domain, one core membrane-spanning domain and one canonical C-terminal nucleotide-binding domain. Homology modelling of the sea bass TAP dimer predicts that its quaternary structure is in accordance with that of other ABC transporters. Phylogenetic analysis segregates sea bass TAP1 and TAP2 into each subfamily cluster of transporters, placing them in the fish class and suggesting that the basic structure of these transport-associated proteins is evolutionarily conserved. Furthermore, the present data provides information that will enable more studies on the class I antigen presentation pathway in this important fish species.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
161 Mutations on highly conserved residues of CH1/CL1 (except Q277C) and of sensor region (G282C, I284C, R287C) interfered with and drastically affected transport, respectively. Login to comment
162 Mutations on highly conserved residues of CH1/CL1 (except Q277C) and of sensor region (G282C, I284C, R287C) interfered with and drastically affected transport, respectively. Login to comment

[hide] Structural arrangement of the transmission interfa... Proc Natl Acad Sci U S A. 2009 Apr 7;106(14):5551-6. Epub 2009 Mar 18. Oancea G, O'Mara ML, Bennett WF, Tieleman DP, Abele R, Tampe R
Structural arrangement of the transmission interface in the antigen ABC transport complex TAP.
Proc Natl Acad Sci U S A. 2009 Apr 7;106(14):5551-6. Epub 2009 Mar 18., [PMID:19297616]

Abstract [show]
The transporter associated with antigen processing (TAP) represents a focal point in the immune recognition of virally or malignantly transformed cells by translocating proteasomal degradation products into the endoplasmic reticulum-lumen for loading of MHC class I molecules. Based on a number of experimental data and the homology to the bacterial ABC exporter Sav1866, we constructed a 3D structural model of the core TAP complex and used it to examine the interface between the transmembrane and nucleotide-binding domains (NBD) by cysteine-scanning and cross-linking approaches. Herein, we demonstrate the functional importance of the newly identified X-loop in the NBD in coupling substrate binding to downstream events in the transport cycle. We further verified domain swapping in a heterodimeric ABC half-transporter complex by cysteine cross-linking. Strikingly, either substrate binding or translocation can be blocked by cross-linking the X-loop to coupling helix 2 or 1, respectively. These results resolve the structural arrangement of the transmission interface and point to different functions of the cytosolic loops and coupling helices in substrate binding, signaling, and transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Remarkably, all mutations in coupling helix 1, except for Q277C, interfered with the transport activity. Login to comment
129 We chose 2 pairs of mutations, Q277C/E602C and A381C/E602C, containing a single cysteine in each coupling helix of TAP1. Login to comment
132 Surprisingly, cross-linking of Q277C/E602C arrested TAP in a translocation-incompetent state, in which peptide binding was unaffected (Fig. 5C). Login to comment
133 The transport activity of Cys-less/E602C is only slightly reduced due to irreversible oxidation. Login to comment
67 Remarkably, all mutations in coupling helix 1, except for Q277C, interfered with the transport activity. Login to comment
130 We chose 2 pairs of mutations, Q277C/E602C and A381C/E602C, containing a single cysteine in each coupling helix of TAP1. Login to comment
135 Surprisingly, cross-linking of Q277C/E602C arrested TAP in a translocation-incompetent state, in which peptide binding was unaffected (Fig. 5C). Login to comment

[hide] Mechanism of substrate sensing and signal transmis... J Biol Chem. 2007 Feb 9;282(6):3871-80. Epub 2006 Dec 12. Herget M, Oancea G, Schrodt S, Karas M, Tampe R, Abele R
Mechanism of substrate sensing and signal transmission within an ABC transporter: use of a Trojan horse strategy.
J Biol Chem. 2007 Feb 9;282(6):3871-80. Epub 2006 Dec 12., [PMID:17164240]

Abstract [show]
By translocating proteasomal degradation products into the endoplasmic reticulum for loading of major histocompatibility complex I molecules, the ABC transporter TAP plays a focal role in the adaptive immunity against infected or malignantly transformed cells. A key question regarding the transport mechanism is how the quality of the incoming peptide is detected and how this information is transmitted to the ATPase domains. To identify residues involved in this process, we evolved a Trojan horse strategy in which a small artificial protease is inserted into antigenic epitopes. After binding, the TAP backbone in contact is cleaved, allowing the peptide sensor site to be mapped by mass spectrometry. Within this sensor site, we identified residues that are essential for tight coupling of peptide binding and transport. This sensor and transmission interface is restructured during the ATP hydrolysis cycle, emphasizing its important function in the cross-talk between the transmembrane and the nucleotide-binding domains. This allocrite sensor may be similarly positioned in other members of the ABC exporter family.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Expression of Human TAP Mutants-The single cysteine TAP1 mutants, Q277C, G282C, N283C, I284C, M285C, S286C, R287C, V288C, and R659C, were generated by ligase chain reaction with the following primers using cysteine-less human TAP1 with a C-terminal His10 tag as template (16): Q277C, CCGAATTCTTCCAGTGCAACCAGACCGC; G282C, GCA- GAACCAGACCTGCAACATCATGTCC; N283C, CAGAAC- CAGACCGGCTGCATCATGTCCAGAG; I284C, GACCGG- CAACTGCATGTCCAGAG; M285C, GACCGGCAACAT- CTGCTCCAGAGTCACCGAAG; S286C, GGCAACATCAT- GTGTAGAGTCACCGAAGA; R287C, GCAACATCATGTC- CTGCGTCACCGAAGATAC; V288C, CGGCAACATCAT- GTCCAGATGCACCGAAGATACG; and R659C, CAAGC- CTCTGCCTCAGTACG. Login to comment
40 Expression of Human TAP Mutants-The single cysteine TAP1 mutants, Q277C, G282C, N283C, I284C, M285C, S286C, R287C, V288C, and R659C, were generated by ligase chain reaction with the following primers using cysteine-less human TAP1 with a C-terminal His10 tag as template (16): Q277C, CCGAATTCTTCCAGTGCAACCAGACCGC; G282C, GCA- GAACCAGACCTGCAACATCATGTCC; N283C, CAGAAC- CAGACCGGCTGCATCATGTCCAGAG; I284C, GACCGG- CAACTGCATGTCCAGAG; M285C, GACCGGCAACAT- CTGCTCCAGAGTCACCGAAG; S286C, GGCAACATCAT- GTGTAGAGTCACCGAAGA; R287C, GCAACATCATGTC- CTGCGTCACCGAAGATAC; V288C, CGGCAACATCAT- GTCCAGATGCACCGAAGATACG; and R659C, CAAGC- CTCTGCCTCAGTACG. Login to comment