ABCMdb

ABCA4 p.Lys1978Met

Predicted by SNAP2:	A: D (71%), C: D (71%), D: D (75%), E: D (71%), F: D (75%), G: D (75%), H: D (66%), I: D (66%), L: D (71%), M: D (95%), N: D (63%), P: D (75%), Q: D (63%), R: N (53%), S: D (66%), T: D (63%), V: D (71%), W: D (85%), Y: D (71%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] ABCA4 is an N-retinylidene-phosphatidylethanolamin... Nat Commun. 2012 Jun 26;3:925. doi: 10.1038/ncomms1927. Quazi F, Lenevich S, Molday RS
ABCA4 is an N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine importer.
Nat Commun. 2012 Jun 26;3:925. doi: 10.1038/ncomms1927., [PMID:22735453]

Abstract [show]
ATP-binding cassette (ABC) transporters comprise a superfamily of proteins, which actively transport a variety of compounds across cell membranes. Mammalian and most eukaryotic ABC transporters function as exporters, flipping or extruding substrates from the cytoplasmic to the extracellular or lumen side of cell membranes. Prokaryotic ABC transporters function either as exporters or importers. Here we show that ABCA4, an ABC transporter found in retinal photoreceptor cells and associated with Stargardt macular degeneration, is a novel importer that actively flips N-retinylidene-phosphatidylethanolamine from the lumen to the cytoplasmic leaflet of disc membranes, thereby facilitating the removal of potentially toxic retinoid compounds from photoreceptors. ABCA4 also actively transports phosphatidylethanolamine in the same direction. Mutations known to cause Stargardt disease decrease N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine transport activity of ABCA4. These studies provide the first direct evidence for a mammalian ABC transporter that functions as an importer and provide insight into mechanisms underlying substrate transport and the molecular basis of Stargardt disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 This was examined using donor proteoliposomes reconstituted with wild-type (WT) ABCA4 or the ATPase deficient K969M/K1978M double mutant (ABCA4-MM) (Fig. 2d). Login to comment
93 (d) Effect of ATP, ADP and AMP-PNP on [3H] ATR transfer from donor proteoliposomes reconstituted with WT ABCA4 or the ATPase-impaired K969M/K1978M double mutant (ABCA4-MM) purified from transfected HEK293 cells. Login to comment
145 To gain further insight into the molecular mechanisms underlying ABCA4-mediated transport activity and Stargardt disease, we examined the functional properties of ABCA4-containing G863A and N965S mutations associated with Stargardt disease and Walker A mutations, K969M in NBD1, K1978M in NBD2 and the double mutant K969M/1978M. Login to comment
146 The K1978M mutant expressed at the same level as WT ABCA4, whereas the G863A, N965S, K969M and K969M/ K1978M mutants expressed within 50% that of WT ABCA4. Login to comment
172 Addition of ATP resulted in release of the substrate from the G863A, N965S and K1978M mutants, but impaired release from the K969M mutant and no significant release from the K969M/K1978M double mutant. Login to comment
189 However, retinal readily reacts with PE, I a E ABCA4 W i l d - t y p e G 8 6 3 A N 9 6 5 S K 9 6 9 M K 9 6 9 M / K 1 9 7 8 M K 1 9 7 8 M ABCA4 kDa 250 250 I E I E I E I E I E 150 100 75 50 37 25 e % N-retinylidene PE binding 120 - ATP + ATP 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T b G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M 120 % Retinal transfer * * 100 80 60 40 20 0 W T c G863A N965S Retinal (µM) 250 % Basal ATPase activity 200 150 100 WT 50 0 0 10 20 30 40 50 60 d MM Retinal (µM) K969M K1978M % Basal ATPase activity 250 WT 200 150 100 50 0 0 10 20 30 40 50 60 f % NBD-PE flippase activity * * 120 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T Figure 6 | Effect of Walker A and Stargardt mutations on ATR transfer activity. Login to comment

[hide] Defective lipid transport and biosynthesis in rece... Prog Lipid Res. 2010 Oct;49(4):476-92. Epub 2010 Jul 13. Molday RS, Zhang K
Defective lipid transport and biosynthesis in recessive and dominant Stargardt macular degeneration.
Prog Lipid Res. 2010 Oct;49(4):476-92. Epub 2010 Jul 13., [PMID:20633576]

Abstract [show]
Stargardt disease is a common inherited macular degeneration characterized by a significant loss in central vision in the first or second decade of life, bilateral atrophic changes in the central retina associated with degeneration of photoreceptors and underlying retinal pigment epithelial cells, and the presence of yellow flecks extending from the macula. Autosomal recessive Stargardt disease, the most common macular dystrophy, is caused by mutations in the gene encoding ABCA4, a photoreceptor ATP binding cassette (ABC) transporter. Biochemical studies together with analysis of abca4 knockout mice and Stargardt patients have implicated ABCA4 as a lipid transporter that facilitates the removal of potentially toxic retinal compounds from photoreceptors following photoexcitation. An autosomal dominant form of Stargardt disease also known as Stargardt-like dystrophy is caused by mutations in a gene encoding ELOVL4, an enzyme that catalyzes the elongation of very long-chain fatty acids in photoreceptors and other tissues. This review focuses on the molecular characterization of ABCA4 and ELOVL4 and their role in photoreceptor cell biology and the pathogenesis of Stargardt disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2042 Heterologous expression of ABCA4 has been used to study the effect of mutations in the Walker A motifs (K969M in NBD1 and K1978M in NBD2) on the basal and retinal activated activities of purified and reconstituted ABCA4 [114]. Login to comment
2044 However, the K969M/K1978M double mutant and the K969M single mutant showed little or no basal or retinal-stimulated ATPase activity. Login to comment
2045 The K1978M single mutant exhibited basal ATPase activity but no retinal-stimulated activity. Login to comment

[hide] The role of the photoreceptor ABC transporter ABCA... Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20. Molday RS, Zhong M, Quazi F
The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration.
Biochim Biophys Acta. 2009 Jul;1791(7):573-83. Epub 2009 Feb 20., [PMID:19230850]

Abstract [show]
ABCA4 is a member of the ABCA subfamily of ATP binding cassette (ABC) transporters that is expressed in rod and cone photoreceptors of the vertebrate retina. ABCA4, also known as the Rim protein and ABCR, is a large 2,273 amino acid glycoprotein organized as two tandem halves, each containing a single membrane spanning segment followed sequentially by a large exocytoplasmic domain, a multispanning membrane domain and a nucleotide binding domain. Over 500 mutations in the gene encoding ABCA4 are associated with a spectrum of related autosomal recessive retinal degenerative diseases including Stargardt macular degeneration, cone-rod dystrophy and a subset of retinitis pigmentosa. Biochemical studies on the purified ABCA4 together with analysis of abca4 knockout mice and patients with Stargardt disease have implicated ABCA4 as a retinylidene-phosphatidylethanolamine transporter that facilitates the removal of potentially reactive retinal derivatives from photoreceptors following photoexcitation. Knowledge of the genetic and molecular basis for ABCA4 related retinal degenerative diseases is being used to develop rationale therapeutic treatments for this set of disorders.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
142 The basal and retinal activated activities of both NBDs were also investigated by expressing and analyzing ABCA4 containing Walker A mutations (K969M for NBD1) and K1978M for NBD2) known to inhibit ATP hydrolysis [35,37]. Login to comment
145 The double K969M/ K1978M double mutant and the K969M single mutant showed no basal or retinal stimulated ATPase activity, whereas the K1978M mutant in NBD2 exhibited basal ATPase activity but not retinal stimulated activity. Login to comment
257 Some mutations affect only the retinal activated ATPase activity such as the G1975D and K1978M mutations in NBD2, whereas a large number of mutants affect both the basal and retinal stimulated ATPase activity of ABCA4 as exemplified by the L541P mutation in ECD1, T971N in NBD1 and E2096K in NBD2 [35]. Login to comment

[hide] Functional interaction between the two halves of t... J Biol Chem. 2003 Oct 10;278(41):39600-8. Epub 2003 Jul 29. Ahn J, Beharry S, Molday LL, Molday RS
Functional interaction between the two halves of the photoreceptor-specific ATP binding cassette protein ABCR (ABCA4). Evidence for a non-exchangeable ADP in the first nucleotide binding domain.
J Biol Chem. 2003 Oct 10;278(41):39600-8. Epub 2003 Jul 29., [PMID:12888572]

Abstract [show]
ABCR, also known as ABCA4, is a member of the superfamily of ATP binding cassette transporters that is believed to transport retinal or retinylidene-phosphatidylethanolamine across photoreceptor disk membranes. Mutations in the ABCR gene are responsible for Stargardt macular dystrophy and related retinal dystrophies that cause severe loss in vision. ABCR consists of two tandemly arranged halves each containing a membrane spanning segment followed by a large extracellular/lumen domain, a multi-spanning membrane domain, and a nucleotide binding domain (NBD). To define the role of each NBD, we examined the nucleotide binding and ATPase activities of the N and C halves of ABCR individually and co-expressed in COS-1 cells and derived from trypsin-cleaved ABCR in disk membranes. When disk membranes or membranes from co-transfected cells were photoaffinity labeled with 8-azido-ATP and 8-azido-ADP, only the NBD2 in the C-half bound and trapped the nucleotide. Co-expressed half-molecules displayed basal and retinal-stimulated ATPase activity similar to full-length ABCR. The individually expressed N-half displayed weak 8-azido-ATP labeling and low basal ATPase activity that was not stimulated by retinal, whereas the C-half did not bind ATP and exhibited little if any ATPase activity. Purified ABCR contained one tightly bound ADP, presumably in NBD1. Our results indicate that only NBD2 of ABCR binds and hydrolyzes ATP in the presence or absence of retinal. NBD1, containing a bound ADP, associates with NBD2 to play a crucial, non-catalytic role in ABCR function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 K969M and K1978M mutations were inserted by QuikChange site-directed mutagenesis (Stratagene) using PfuTurbo DNA polymerase and the following mutagenic primers (introduced mutations in bold): K969M, CCACAATGGAGCTGGGATGACCACCACCTTGTCC and GGACAAG- GTGGTGGTCATCCCAGCTCCATTGTGG; K1978M, GAATGGTGCC- GGCATGACAACCACATTCAAGATGC and GCATCTTGAATGTGGT- TGTCATGCCGGCACCATTC. Login to comment
55 The AflII-ClaI (1.9 kb) and the Eco72I (0.26 kb) fragments of the resulting PCR products containing the K969M and K1978M mutations, respectively, were cloned into the original pcABCR. Login to comment
56 For the K969M/K1978M double mutant, the AflII-FseI restriction fragment of pcABCR[K1978M] was replaced with that of pcABCR[K969M]. Login to comment
57 To create the C-half[K1978M] mutant, the HindIII/- BspE1 digested PCR product from above (for constructing the C-half) was used to replace the 4-kb HindIII/BspE1 fragment of pcABCR[K1978M]. Login to comment
158 With ABCR, the lysine to methionine substitution in the NBD1 (K969M) and NBD2 (K1978M) or in both (K969M/ K1978M) significantly reduced the basal ATPase activity of ABCR and abolished retinal activation (Fig. 4A). Login to comment
177 The data are averages from at least three experiments Ϯ S.D. co-expressed with the K1978M C-half mutant (amino acid number represents that of the full-length ABCR). Login to comment
179 The photoaffinity labeling intensities of the single mutants (K969M and K1978M) were similar to wild-type ABCR relative to the amount of purified ABCR stained with Coomassie Blue (Fig. 4B). Login to comment
180 A small reduction in labeling, however, was observed for the K969M/K1978M double mutant. Login to comment
210 WT, wild-type; K969M, in NBD1; K1978M, in NBD2; MM, K969M/K1978M double mutant; NCM, N-half co-expressed with C-half containing a K1978M mutation. Login to comment
211 B, ATP photoaffinity labeling was carried out by irradiating membranes from COS-1 cells expressing wild-type (WT), K969M, K1978M, or K969M/K1978M double mutant (MM) with 3 ␮M 8-azido-[␣-32 P]ATP. Login to comment
209 WT, wild-type; K969M, in NBD1; K1978M, in NBD2; MM, K969M/K1978M double mutant; NCM, N-half co-expressed with C-half containing a K1978M mutation. Login to comment

[hide] Mechanistic studies of ABCR, the ABC transporter i... J Bioenerg Biomembr. 2001 Dec;33(6):523-30. Sun H, Nathans J
Mechanistic studies of ABCR, the ABC transporter in photoreceptor outer segments responsible for autosomal recessive Stargardt disease.
J Bioenerg Biomembr. 2001 Dec;33(6):523-30., [PMID:11804194]

Abstract [show]
ABCR is an ABC transporter that is found exclusively in vertebrate photoreceptor outer segments. Mutations in the human ABCR gene are responsible for autosomal recessive Stargardt disease, the most common cause of early onset macular degeneration. In this paper we review our recent work with purified and reconstituted ABCR derived from bovine retina and from cultured cells expressing wild type or site-directed mutants of human ABCR. These experiments implicate all-trans-retinal (or Schiff base adducts between all-trans-retinal and phosphatidylethanolamine) as the transport substrate, and they reveal asymmetric roles for the two nucleotide binding domains in the transport reaction. A model for the retinal transport reaction is presented which accounts for these experimental observations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 (D) Synthetic substitutions of a conserved lysine in the Walker A motif of NBD-1 (K969M), NBD-2 (K1978M), or both (K969M/K1978M). Login to comment
114 When purified, reconstituted, and tested for ATPase activity, the synthetic mutations show (1) that mutations in NBD-1 (G966D or K969M), either alone or in combination with mutations in NBD-2 (G966D/G1975D or K969M/K1978M), abolish both basal and retinal-stimulated ATP hydrolysis and (2) that mutations in NBD-2 (G1975D or K1978M) do not alter the basal ATPase activity but lead to inhibition rather than stimulation of ATP hydrolysis by retinal (Fig. 4(C) and (D)), a pattern noted above for the naturally occurring NBD-2 mutations G1961E, G1977S, and E2096K. Login to comment

[hide] Expression, purification and structural properties... Protein Expr Purif. 2014 May;97:50-60. doi: 10.1016/j.pep.2014.02.010. Epub 2014 Feb 28. Tsybovsky Y, Palczewski K
Expression, purification and structural properties of ABC transporter ABCA4 and its individual domains.
Protein Expr Purif. 2014 May;97:50-60. doi: 10.1016/j.pep.2014.02.010. Epub 2014 Feb 28., [PMID:24583180]

Abstract [show]
ABCA4 is a member of the A subfamily of ATP-binding cassette transporters that consists of large integral membrane proteins implicated in inherited human diseases. ABCA4 assists in the clearance of N-retinylidene-phosphatidylethanolamine, a potentially toxic by-product of the visual cycle formed in photoreceptor cells during light perception. Structural and functional studies of this protein have been hindered by its large size, membrane association, and domain complexity. Although mammalian, insect and bacterial systems have been used for expression of ABCA4 and its individual domains, the structural relevance of resulting proteins to the native transporter has yet to be established. We produced soluble domains of ABCA4 in Escherichia coli and Saccharomyces cerevisiae and the full-length transporter in HEK293 cells. Electron microscopy and size exclusion chromatography were used to assess the conformational homogeneity and structure of these proteins. We found that isolated ABCA4 domains formed large, heterogeneous oligomers cross-linked with non-specific disulphide bonds. Incomplete folding of cytoplasmic domain 2 was proposed based on fluorescence spectroscopy results. In contrast, full-length human ABCA4 produced in mammalian cells was found structurally equivalent to the native protein obtained from bovine photoreceptors. These findings offer recombinantly expressed full-length ABCA4 as an appropriate object for future detailed structural and functional characterization.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
218 To evaluate the contribution of these contaminants, we generated an inactive K1978M mutant [17] of his-CD2-strep and purified it by using exactly the same protocol, which resulted in similar protein yield and purity (data not shown). Login to comment