ABCMdb

PMID: 12888572

Ahn J, Beharry S, Molday LL, Molday RS
Functional interaction between the two halves of the photoreceptor-specific ATP binding cassette protein ABCR (ABCA4). Evidence for a non-exchangeable ADP in the first nucleotide binding domain.
J Biol Chem. 2003 Oct 10;278(41):39600-8. Epub 2003 Jul 29., [PubMed]

Sentences

No. Mutations Sentence Comment

54 ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys969Met ABCA4 p.Lys969Met K969M and K1978M mutations were inserted by QuikChange site-directed mutagenesis (Stratagene) using PfuTurbo DNA polymerase and the following mutagenic primers (introduced mutations in bold): K969M, CCACAATGGAGCTGGGATGACCACCACCTTGTCC and GGACAAG- GTGGTGGTCATCCCAGCTCCATTGTGG; K1978M, GAATGGTGCC- GGCATGACAACCACATTCAAGATGC and GCATCTTGAATGTGGT- TGTCATGCCGGCACCATTC. Login to comment 55 ABCA4 p.Lys1978Met ABCA4 p.Lys969Met The AflII-ClaI (1.9 kb) and the Eco72I (0.26 kb) fragments of the resulting PCR products containing the K969M and K1978M mutations, respectively, were cloned into the original pcABCR. Login to comment 56 ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys969Met ABCA4 p.Lys969Met For the K969M/K1978M double mutant, the AflII-FseI restriction fragment of pcABCR[K1978M] was replaced with that of pcABCR[K969M]. Login to comment 57 ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met To create the C-half[K1978M] mutant, the HindIII/- BspE1 digested PCR product from above (for constructing the C-half) was used to replace the 4-kb HindIII/BspE1 fragment of pcABCR[K1978M]. Login to comment 135 ABCA4 p.Asp846His These intensely labeled vesicles do not appear to be artifacts, because mutating a single amino acid in ABCR (D846H) changed the distribution from vesicular to perinuclear (ER/Golgi),2 a pattern typically observed for misfolded proteins. Login to comment 158 ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys969Met ABCA4 p.Lys969Met With ABCR, the lysine to methionine substitution in the NBD1 (K969M) and NBD2 (K1978M) or in both (K969M/ K1978M) significantly reduced the basal ATPase activity of ABCR and abolished retinal activation (Fig. 4A). Login to comment 177 ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met The data are averages from at least three experiments Ϯ S.D. co-expressed with the K1978M C-half mutant (amino acid number represents that of the full-length ABCR). Login to comment 179 ABCA4 p.Lys1978Met ABCA4 p.Lys969Met The photoaffinity labeling intensities of the single mutants (K969M and K1978M) were similar to wild-type ABCR relative to the amount of purified ABCR stained with Coomassie Blue (Fig. 4B). Login to comment 180 ABCA4 p.Lys1978Met ABCA4 p.Lys969Met A small reduction in labeling, however, was observed for the K969M/K1978M double mutant. Login to comment 209 ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys969Met ABCA4 p.Lys969Met WT, wild-type; K969M, in NBD1; K1978M, in NBD2; MM, K969M/K1978M double mutant; NCM, N-half co-expressed with C-half containing a K1978M mutation. Login to comment 210 ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys969Met ABCA4 p.Lys969Met ABCA4 p.Lys969Met ABCA4 p.Lys969Met WT, wild-type; K969M, in NBD1; K1978M, in NBD2; MM, K969M/K1978M double mutant; NCM, N-half co-expressed with C-half containing a K1978M mutation. Login to comment 211 ABCA4 p.Lys1978Met ABCA4 p.Lys1978Met ABCA4 p.Lys969Met ABCA4 p.Lys969Met B, ATP photoaffinity labeling was carried out by irradiating membranes from COS-1 cells expressing wild-type (WT), K969M, K1978M, or K969M/K1978M double mutant (MM) with 3 ␮M 8-azido-[␣-32 P]ATP. Login to comment