ABCA4 p.Lys1978Met
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 22735453
[PubMed]
Quazi F et al: "ABCA4 is an N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine importer."
No.
Sentence
Comment
66
This was examined using donor proteoliposomes reconstituted with wild-type (WT) ABCA4 or the ATPase deficient K969M/K1978M double mutant (ABCA4-MM) (Fig. 2d).
X
ABCA4 p.Lys1978Met 22735453:66:116
status: NEW93 (d) Effect of ATP, ADP and AMP-PNP on [3H] ATR transfer from donor proteoliposomes reconstituted with WT ABCA4 or the ATPase-impaired K969M/K1978M double mutant (ABCA4-MM) purified from transfected HEK293 cells.
X
ABCA4 p.Lys1978Met 22735453:93:140
status: NEW145 To gain further insight into the molecular mechanisms underlying ABCA4-mediated transport activity and Stargardt disease, we examined the functional properties of ABCA4-containing G863A and N965S mutations associated with Stargardt disease and Walker A mutations, K969M in NBD1, K1978M in NBD2 and the double mutant K969M/1978M.
X
ABCA4 p.Lys1978Met 22735453:145:279
status: NEW146 The K1978M mutant expressed at the same level as WT ABCA4, whereas the G863A, N965S, K969M and K969M/ K1978M mutants expressed within 50% that of WT ABCA4.
X
ABCA4 p.Lys1978Met 22735453:146:4
status: NEWX
ABCA4 p.Lys1978Met 22735453:146:102
status: NEW172 Addition of ATP resulted in release of the substrate from the G863A, N965S and K1978M mutants, but impaired release from the K969M mutant and no significant release from the K969M/K1978M double mutant.
X
ABCA4 p.Lys1978Met 22735453:172:79
status: NEWX
ABCA4 p.Lys1978Met 22735453:172:180
status: NEW189 However, retinal readily reacts with PE, I a E ABCA4 W i l d - t y p e G 8 6 3 A N 9 6 5 S K 9 6 9 M K 9 6 9 M / K 1 9 7 8 M K 1 9 7 8 M ABCA4 kDa 250 250 I E I E I E I E I E 150 100 75 50 37 25 e % N-retinylidene PE binding 120 - ATP + ATP 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T b G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M 120 % Retinal transfer * * 100 80 60 40 20 0 W T c G863A N965S Retinal (µM) 250 % Basal ATPase activity 200 150 100 WT 50 0 0 10 20 30 40 50 60 d MM Retinal (µM) K969M K1978M % Basal ATPase activity 250 WT 200 150 100 50 0 0 10 20 30 40 50 60 f % NBD-PE flippase activity * * 120 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T Figure 6 | Effect of Walker A and Stargardt mutations on ATR transfer activity.
X
ABCA4 p.Lys1978Met 22735453:189:533
status: NEW
PMID: 20633576
[PubMed]
Molday RS et al: "Defective lipid transport and biosynthesis in recessive and dominant Stargardt macular degeneration."
No.
Sentence
Comment
2042
Heterologous expression of ABCA4 has been used to study the effect of mutations in the Walker A motifs (K969M in NBD1 and K1978M in NBD2) on the basal and retinal activated activities of purified and reconstituted ABCA4 [114].
X
ABCA4 p.Lys1978Met 20633576:2042:122
status: NEW2044 However, the K969M/K1978M double mutant and the K969M single mutant showed little or no basal or retinal-stimulated ATPase activity.
X
ABCA4 p.Lys1978Met 20633576:2044:19
status: NEW2045 The K1978M single mutant exhibited basal ATPase activity but no retinal-stimulated activity.
X
ABCA4 p.Lys1978Met 20633576:2045:4
status: NEW
PMID: 19230850
[PubMed]
Molday RS et al: "The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration."
No.
Sentence
Comment
142
The basal and retinal activated activities of both NBDs were also investigated by expressing and analyzing ABCA4 containing Walker A mutations (K969M for NBD1) and K1978M for NBD2) known to inhibit ATP hydrolysis [35,37].
X
ABCA4 p.Lys1978Met 19230850:142:164
status: NEW145 The double K969M/ K1978M double mutant and the K969M single mutant showed no basal or retinal stimulated ATPase activity, whereas the K1978M mutant in NBD2 exhibited basal ATPase activity but not retinal stimulated activity.
X
ABCA4 p.Lys1978Met 19230850:145:18
status: NEWX
ABCA4 p.Lys1978Met 19230850:145:134
status: NEW257 Some mutations affect only the retinal activated ATPase activity such as the G1975D and K1978M mutations in NBD2, whereas a large number of mutants affect both the basal and retinal stimulated ATPase activity of ABCA4 as exemplified by the L541P mutation in ECD1, T971N in NBD1 and E2096K in NBD2 [35].
X
ABCA4 p.Lys1978Met 19230850:257:88
status: NEW
PMID: 12888572
[PubMed]
Ahn J et al: "Functional interaction between the two halves of the photoreceptor-specific ATP binding cassette protein ABCR (ABCA4). Evidence for a non-exchangeable ADP in the first nucleotide binding domain."
No.
Sentence
Comment
54
K969M and K1978M mutations were inserted by QuikChange site-directed mutagenesis (Stratagene) using PfuTurbo DNA polymerase and the following mutagenic primers (introduced mutations in bold): K969M, CCACAATGGAGCTGGGATGACCACCACCTTGTCC and GGACAAG- GTGGTGGTCATCCCAGCTCCATTGTGG; K1978M, GAATGGTGCC- GGCATGACAACCACATTCAAGATGC and GCATCTTGAATGTGGT- TGTCATGCCGGCACCATTC.
X
ABCA4 p.Lys1978Met 12888572:54:10
status: NEWX
ABCA4 p.Lys1978Met 12888572:54:276
status: NEW55 The AflII-ClaI (1.9 kb) and the Eco72I (0.26 kb) fragments of the resulting PCR products containing the K969M and K1978M mutations, respectively, were cloned into the original pcABCR.
X
ABCA4 p.Lys1978Met 12888572:55:114
status: NEW56 For the K969M/K1978M double mutant, the AflII-FseI restriction fragment of pcABCR[K1978M] was replaced with that of pcABCR[K969M].
X
ABCA4 p.Lys1978Met 12888572:56:14
status: NEWX
ABCA4 p.Lys1978Met 12888572:56:82
status: NEW57 To create the C-half[K1978M] mutant, the HindIII/- BspE1 digested PCR product from above (for constructing the C-half) was used to replace the 4-kb HindIII/BspE1 fragment of pcABCR[K1978M].
X
ABCA4 p.Lys1978Met 12888572:57:21
status: NEWX
ABCA4 p.Lys1978Met 12888572:57:181
status: NEW158 With ABCR, the lysine to methionine substitution in the NBD1 (K969M) and NBD2 (K1978M) or in both (K969M/ K1978M) significantly reduced the basal ATPase activity of ABCR and abolished retinal activation (Fig. 4A).
X
ABCA4 p.Lys1978Met 12888572:158:79
status: NEWX
ABCA4 p.Lys1978Met 12888572:158:106
status: NEW177 The data are averages from at least three experiments Ϯ S.D. co-expressed with the K1978M C-half mutant (amino acid number represents that of the full-length ABCR).
X
ABCA4 p.Lys1978Met 12888572:177:90
status: NEWX
ABCA4 p.Lys1978Met 12888572:177:126
status: NEW179 The photoaffinity labeling intensities of the single mutants (K969M and K1978M) were similar to wild-type ABCR relative to the amount of purified ABCR stained with Coomassie Blue (Fig. 4B).
X
ABCA4 p.Lys1978Met 12888572:179:72
status: NEW180 A small reduction in labeling, however, was observed for the K969M/K1978M double mutant.
X
ABCA4 p.Lys1978Met 12888572:180:67
status: NEW210 WT, wild-type; K969M, in NBD1; K1978M, in NBD2; MM, K969M/K1978M double mutant; NCM, N-half co-expressed with C-half containing a K1978M mutation.
X
ABCA4 p.Lys1978Met 12888572:210:31
status: NEWX
ABCA4 p.Lys1978Met 12888572:210:58
status: NEWX
ABCA4 p.Lys1978Met 12888572:210:122
status: NEWX
ABCA4 p.Lys1978Met 12888572:210:130
status: NEWX
ABCA4 p.Lys1978Met 12888572:210:139
status: NEW211 B, ATP photoaffinity labeling was carried out by irradiating membranes from COS-1 cells expressing wild-type (WT), K969M, K1978M, or K969M/K1978M double mutant (MM) with 3 M 8-azido-[␣-32 P]ATP.
X
ABCA4 p.Lys1978Met 12888572:211:122
status: NEWX
ABCA4 p.Lys1978Met 12888572:211:139
status: NEW209 WT, wild-type; K969M, in NBD1; K1978M, in NBD2; MM, K969M/K1978M double mutant; NCM, N-half co-expressed with C-half containing a K1978M mutation.
X
ABCA4 p.Lys1978Met 12888572:209:31
status: NEWX
ABCA4 p.Lys1978Met 12888572:209:58
status: NEWX
ABCA4 p.Lys1978Met 12888572:209:130
status: NEW
PMID: 11804194
[PubMed]
Sun H et al: "Mechanistic studies of ABCR, the ABC transporter in photoreceptor outer segments responsible for autosomal recessive Stargardt disease."
No.
Sentence
Comment
107
(D) Synthetic substitutions of a conserved lysine in the Walker A motif of NBD-1 (K969M), NBD-2 (K1978M), or both (K969M/K1978M).
X
ABCA4 p.Lys1978Met 11804194:107:97
status: NEWX
ABCA4 p.Lys1978Met 11804194:107:121
status: NEW114 When purified, reconstituted, and tested for ATPase activity, the synthetic mutations show (1) that mutations in NBD-1 (G966D or K969M), either alone or in combination with mutations in NBD-2 (G966D/G1975D or K969M/K1978M), abolish both basal and retinal-stimulated ATP hydrolysis and (2) that mutations in NBD-2 (G1975D or K1978M) do not alter the basal ATPase activity but lead to inhibition rather than stimulation of ATP hydrolysis by retinal (Fig. 4(C) and (D)), a pattern noted above for the naturally occurring NBD-2 mutations G1961E, G1977S, and E2096K.
X
ABCA4 p.Lys1978Met 11804194:114:215
status: NEWX
ABCA4 p.Lys1978Met 11804194:114:324
status: NEW
PMID: 24583180
[PubMed]
Tsybovsky Y et al: "Expression, purification and structural properties of ABC transporter ABCA4 and its individual domains."
No.
Sentence
Comment
218
To evaluate the contribution of these contaminants, we generated an inactive K1978M mutant [17] of his-CD2-strep and purified it by using exactly the same protocol, which resulted in similar protein yield and purity (data not shown).
X
ABCA4 p.Lys1978Met 24583180:218:77
status: NEW