ABCA4 p.Leu2027Phe

[switch to full view]
Comments [show]
Publications
PMID: 22661472 [PubMed] Testa F et al: "Correlation between photoreceptor layer integrity and visual function in patients with Stargardt disease: implications for gene therapy."
No. Sentence Comment
66 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundus† FAF‡ ERG§ mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35þ2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35þ2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35þ2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45þ1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40þ5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35þ2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40þ5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35þ2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35þ2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40þ5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40þ5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35þ2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40þ5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45þ1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45þ1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35þ2t > c IVS40þ5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45þ1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram.
X
ABCA4 p.Leu2027Phe 22661472:66:1858
status: NEW
Login to comment

67 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundusߤ FAFߥ ERG&#a7; mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35&#fe;2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35&#fe;2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35&#fe;2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45&#fe;1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40&#fe;5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35&#fe;2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40&#fe;5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35&#fe;2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35&#fe;2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40&#fe;5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40&#fe;5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35&#fe;2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40&#fe;5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45&#fe;1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45&#fe;1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35&#fe;2t > c IVS40&#fe;5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45&#fe;1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Statistics Our set of data is described by continuous (BCVA, OCT foveal thickness, and macular sensitivities) and categorical (fundus, FAF, IS/ OS, ERG, and mfERG groups) variables.
X
ABCA4 p.Leu2027Phe 22661472:67:1849
status: NEW
Login to comment

PMID: 22328824 [PubMed] Roberts LJ et al: "Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients."
No. Sentence Comment
6 Results: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency.
X
ABCA4 p.Leu2027Phe 22328824:6:205
status: NEW
Login to comment

52 Four of the mutations were detected with SNaPshot PCR (p.Cys1490Tyr, p.Arg602Trp, c.5461-10T>C, and p.Leu2027Phe mutations; Table 2, Figure 1, Figure 2, and Figure 3) using the SNaPshot® Multiplex Ready Reaction Mix (Applied Biosystems, Warrington, UK), resolved on the ABI 3100 Genetic Analyzer (Applied Biosystems) and subsequently analyzed using the GeneMapper 3.0 GeneScan software (Applied Biosystems).
X
ABCA4 p.Leu2027Phe 22328824:52:102
status: NEW
Login to comment

61 Exon (mutation) Primer 5'-3' Annealing temperature Mutation detection technique Exon 5 (p.Arg152*) F: gacccatttccccttcaac 60 °C dHPLC, Cycle sequencing using the reverse primer R: aggctgggtgcttccctc Exon 6 (c.768G>T) F: ggtgtctttcctaccacag 57.9 °C dHPLC, Cycle sequencing using the forward primer R: aggaatcaccttgcaattgg Exon 13 (p.Arg602Trp) F: agctatccaagcccgttcc 63 °C SNaPshot PCR R: ccattagcgtgtcatggag Exon 17 (p.Gly863Ala) F: ctgcggtaaggtaggataggg 60 °C Allele-specific PCR R: cacaccgtttacatagagggc Exon 30 (p.Cys1490Tyr) F: gtcagcaactttgaggctg 63 °C SNaPshot PCR R: tccctctgtggcaggcag Intron38/Exon39 (c.5461-10T>C) F: gccccacctgctgaagag 63 °C SNaPshot PCR R: tcccagctttggacccag Exon 44 (p.Leu2027Phe) F: gaagcttctccagccctagc 63 °C SNaPshot PCR R: tgcactctcatgaaacaggc TABLE 2.
X
ABCA4 p.Leu2027Phe 22328824:61:722
status: NEW
Login to comment

63 Exon (mutation) Primer length (bp) with tail Primer sequence (with tail, 5'-3')* 13 (p.Arg602Trp) 34 R: tgttccagtgccacgaacccgccccagatgtacc 30 (p.Cys1490Tyr) 32 R: cttcgtggttactgagcttctccctggtgctg 39 (Intron 38) (c.5461-10T>C) 37 F: ccgatgtagttgaccccgtttccaacagtcctacttc 44 (p.Leu2027Phe) 41 R: tactctggatcttagtaggtaaagatgttctcgtcctgtga *ThenucleotidesequenceinboldisthesequencedesignedtobindcomplementarytothegenomicDNAsequence.Thenucleotide sequence not written in bold is the random nucleotide tail added to the primer sequence. Figure 1.
X
ABCA4 p.Leu2027Phe 22328824:63:276
status: NEW
Login to comment

73 However, seven mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a significantly higher frequency, compared to the other variants in the cohort (Table 4).
X
ABCA4 p.Leu2027Phe 22328824:73:107
status: NEW
Login to comment

91 An electropherogram of the multiplex SNaPshot reaction showing the results obtained for a sample that is heterozygous for the p.Leu2027Phe mutation.
X
ABCA4 p.Leu2027Phe 22328824:91:128
status: NEW
Login to comment

95 The p.Leu2027Phe alleles are represented by blue and green peaks at 45 bp and 46 bp, respectively.
X
ABCA4 p.Leu2027Phe 22328824:95:6
status: NEW
Login to comment

101 Functional analysis of the Nucleotide Binding Domain 2 of ABCA4, which contains the p.Leu2027Phe mutation, has indicated that mutations in this domain cause inhibition of ATP hydrolysis [14].
X
ABCA4 p.Leu2027Phe 22328824:101:86
status: NEW
Login to comment

139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9].
X
ABCA4 p.Leu2027Phe 22328824:139:1417
status: NEW
Login to comment

142 The results obtained from the control cohort screening indicate that the carrier frequency of the p.Cys1490Tyr, p.Arg602Trp, and p.Gly863Ala mutations is slightly higher compared to the other mutations (p.Leu2027Phe, c.768G>T, and p.Arg152*), with the c.5461-10T>C mutation not detected at all.
X
ABCA4 p.Leu2027Phe 22328824:142:205
status: NEW
Login to comment

166 Mutant alleles Cohort p.Cys1490Tyr p.Arg602Trp p.Leu2027Phe c.5461-10T>C c.768G>T p.Gly863Ala p.Arg152* Patient (n=72; 144 alleles) 16 (11.11%) 10 (6.94%) 12 (8.33%) 13 (9.03%) 13 (9.03%) 7 (4.86%) 7 (4.86%) Control (total; n=269; 538 alleles) 2 (0.
X
ABCA4 p.Leu2027Phe 22328824:166:49
status: NEW
Login to comment

PMID: 21873672 [PubMed] Burke TR et al: "Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1)."
No. Sentence Comment
112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel.
X
ABCA4 p.Leu2027Phe 21873672:112:684
status: NEW
Login to comment

PMID: 20696155 [PubMed] Burke TR et al: "Loss of peripapillary sparing in non-group I Stargardt disease."
No. Sentence Comment
184 Also, the type of involvement of the peripapillary area Table 1 Summary of clinical and genetic information for patients with ERG Group I Stargardt Disease. Case Mutation Mutation OA Duration Age at AF Visual Acuity Flecks Atrophy GA (mm2 ) PPA # Sex Allele 1 Allele 2 PPA (years) (years) (years) OD OS OD OS OD OS OD OS Pattern RON 1 Male G1961E G1961E e 19 13 32 20/70 20/70 M M M M 1.6 0.2 None 2 Female G1961E *IVS43 þ 1 G > T e 8 21 27 20/200 20/200 M M M M na na None 3.1 Male L541P/A1038V G1961E e 28 3 31 20/50 20/30 M M M M na na None 3.2 Male L541P/A1038V G1961E e 28 5 33 20/60 20/50 M M M M na na None 4.1 Female L541P/A1038V G1961E e 14 3 17 20/30 20/25 None None None None na na None 4.2 Female L541P/A1038V G1961E e 14 10 24 20/150 20/200 M M M M na na None 5 Female G1961E R2077W e 25 5 30 20/60 20/50 None None M M na na None 6.1 Female G1961E L541P/A1038V e 18 3 21 20/150 20/150 None None M M na na None 6.2 Female G1961E L541P/A1038V e 15 3 18 20/150 20/150 None None M M na na None 7 Female R602Q R602Q e 31 5 36 20/20 20/60 M,EM M,EM M M 0.7 0.3 None 8 Male L541P/A1038V ND e 22 24 46 20/200 20/200 M M M M 13.2 4.1 None 9 Femlae A1038V ND e 27 10 37 20/100 20/60 M,EM M,EM M M na na None 10 Female G1961E ND e 27 6 33 20/150 20/150 M M M M na na None 11 Female G1961E ND e 43 24 67 20/40 20/200 M M M M 4.8 na None 12 Male R212C ND OU 5 23 28 20/200 20/200 M,EM M,EM M M 1.6 4.2 Patchy N,T Abbreviations: ERG, electroretinogram; PPA, peripapillary atrophy; OD, right eye; OS, left eye; OU, both eyes; OA, onset age; AF, autofluoresence; M, macula; EM, extramacular retina; GA, geographic atrophy; na, not available; RON, relation to optic nerve; N, nasal; T, temporal; ND, mutation was not detected by the ABCR array e suggesting the presence of a currently unknown mutant allele; and *newly described mutation.
X
ABCA4 p.Leu2027Phe 20696155:184:666
status: NEW
X
ABCA4 p.Leu2027Phe 20696155:184:813
status: NEW
Login to comment

185 Table 2 Summary of clinical and genetic information for patients with ERG Groups II or III Stargardt Disease. Case Mutation Mutation ERG OA Duration Age at AF Visual Acuity Flecks GA position GA (mm2) PPA # Sex Allele 1 Allele 2 PPA Group (years) (years) (years) OD OS OD OS OD OS OD OS Pattern RON 13 Female P1380L R1640Q OU II 11 24 35 HM HM EM EM M,EM M,EM na na Scalloped - 14 Male IVS38-10 T>C IVS40+5 G>A OU II 7 6 13 20/150 20/150 M,EM M,EM M M na na Flecks N 15 Female M1 V/R2030Q P1380L OU II 8 10 18 20/150 20/150 M,EM M,EM M M 3.52 na Patchy N,T 16 Female P1380L P1380L OU II 18 8 26 20/400 20/400 M,EM M,EM M M 0.25 na Patchy N,T 17 Female L541P/A1038 V L2027F OU II 10 22 32 CF CF M,EM M,EM M M 11.7 5.1 Patchy N,T 18 Male A1773 V ND OU II 35 6 41 CF 20/30 M,EM M,EM M M 4.2 3.7 Patchy N,T 19 Female L2027F ND OU I/II 10 17 27 20/400 20/400 M,EM M,EM M M 1.6 0.1 Patchy N,T 20 Male R602 W R1300X OU III 8 18 26 CF CF None None M,EM M,EM na na Scalloped N,T 21 Female C54Y IVS14+1 G>C OU III 8 55 63 CF HM EM None M,EM M,EM na na Complete - 22.1 Male 4537delC *R107X OU III 5 8 13 20/200 20/200 EM EM M M 2.3 1.7 Patchy N,T 22.2 Female 4537delC *R107X - III 6 2 8 20/200 20/200 M,EM M,EM M M na na - - 23 Male P1380L IVS40+5 G>A OU III 29 26 55 20/400 20/400 EM EM M,EM M,EM na na Complete - 24 Male A1598D A1598D OU III 13 40 53 20/400 20/400 NA NA M,EM M,EM na na Scalloped N,T 25 Male G172S ND OU III 25 7 32 CF CF None None M,EM M,EM na na Complete - 26 Female R1108C ND OU III 9 50 59 20/400 20/400 EM EM M,EM M,EM na na Complete - 27 Male V767D ND OD III 5 10 15 20/400 20/400 EM EM M M na na Patchy T 28 Male P1380L ND OU II/III 9 21 30 20/400 20/400 EM EM M M na na Patchy N,T Abbreviations: ERG, electroretinogram; PPA, peripapillary atrophy; OD, right eye; OS, left eye; OU, both eyes; OA, onset age; AF, autofluoresence; M, macula; EM, extramacular retina; GA, geographic atrophy; na, not available; RON, relation to optic nerve; N, nasal; T, temporal; ND, mutation was not detected by the ABCR array, suggesting the presence of a currently unknown mutant allele; and *newly described mutation.
X
ABCA4 p.Leu2027Phe 20696155:185:666
status: NEW
X
ABCA4 p.Leu2027Phe 20696155:185:813
status: NEW
Login to comment

PMID: 20647261 [PubMed] Schindler EI et al: "Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population."
No. Sentence Comment
54 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text).
X
ABCA4 p.Leu2027Phe 20647261:54:48
status: NEW
Login to comment

57 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text).
X
ABCA4 p.Leu2027Phe 20647261:57:48
status: NEW
Login to comment

PMID: 20398653 [PubMed] Chen B et al: "Analysis of autofluorescent retinal images and measurement of atrophic lesion growth in Stargardt disease."
No. Sentence Comment
82 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,þ1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, þ5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 þ 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND ¼ not done.
X
ABCA4 p.Leu2027Phe 20398653:82:1424
status: NEW
X
ABCA4 p.Leu2027Phe 20398653:82:3286
status: NEW
X
ABCA4 p.Leu2027Phe 20398653:82:3436
status: NEW
Login to comment

81 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,&#fe;1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, &#fe;5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 &#fe; 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND &#bc; not done.
X
ABCA4 p.Leu2027Phe 20398653:81:1423
status: NEW
X
ABCA4 p.Leu2027Phe 20398653:81:3284
status: NEW
X
ABCA4 p.Leu2027Phe 20398653:81:3434
status: NEW
Login to comment

PMID: 19230850 [PubMed] Molday RS et al: "The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration."
No. Sentence Comment
134 Disease mutations, which are substituted in Stargardt disease, are shown in red italics - NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C); NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H).
X
ABCA4 p.Leu2027Phe 19230850:134:173
status: NEW
Login to comment

225 A subset of missense mutations reside in NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C, R1129L) and NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H).
X
ABCA4 p.Leu2027Phe 19230850:225:135
status: NEW
Login to comment

PMID: 19028736 [PubMed] Aguirre-Lamban J et al: "Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants."
No. Sentence Comment
80 Clinical science Br J Ophthalmol 2009;93:614-621. doi:10.1136/bjo.2008.145193 Table 1 Clinical findings of the Spanish patients with Stargardt disease (STGD), autosomal recessive cone-rod dystrophy and autosomal recessive retinitis pigmentosa Pedigree Age (years) Age (years) of onset Visual acuity Diagnosis Allele 1 Allele 2 Segregation OD OS Nucleotide changes (exons) Amino acid change Nucleotide changes (exons) Amino acid change ARDM-135 42 24 0.4 0.6 STGD c.5882G.A(42) p.Gly1961Glu c.1029_1030insT(8) p.Asn344fsX NP ARDM-240 15 13 0.2 0.16 STGD c.5882G.A(42) p.Gly1961Glu c.2285C.A(15) p.Ala762Glu Yes ARDM-225 32 25 0.25 0.50 STGD c.5882G.A(42) p.Gly1961Glu c.6559C.T(48) p.Gln2187X Yes ARDM-164 21 11 NA STGD c.3386G.T(23) p.Arg1129Leu c.700C.T(6) p.Gln234X Yes ARDM-162 50 16 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND Yes ARDM-198 27 19 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND NP ARDM-125 31 9 0.3 0.4 STGD c.3211insGT(22) FS p.KNLFA1876dup Yes ARDM-158 24 9 0.2 0.2 STGD c.3211insGT(22) FS c.4537delC(30) p.Gln1513fsX1525 NP ARDM-165 40 30 NA STGD c.3211insGT(22) FS ND ND NP ARDM-167 49 23 0.05 0.05 STGD c.3211insGT(22) FS ND ND NP ARDM-146 32 13 0.06 0.1 STGD c.3056C.T(21) p.Thr1019Met c.6140T.A(44) p.Ile2047Asn Yes ARDM-40 46 9 0.1 0.1 STGD c.3056C.T(21) p.Thr1019Met c.3943C.T(27) p.Gln1315X Yes ARDM-90 26 8 Hand moving STGD c.5929G.A (43) p.Gly1977Ser IVS21-2A.T Yes ARDM-181 57 16 0.1 0.09 STGD c.3323G.A (22) p.Arg1108His IVS38+5G.A Yes ARDM-197 35 15 0.1 0.1 STGD c.4793C.A(34) (false +) p.Ala1598Asp (false +) c.5172G.T(36) p.Trp1724Cys Yes ARDM-183 63 55 0.150 0.175 STGD c.6079C.T(44) p.Leu2027Phe c.5929G.A(43) (false -) p.Gly1977Ser (false -) NP ARDM-38 35 6 0.01 0.02 STGD c.1804C.T(13) p.Arg602Trp c.4739delT(33) p.Leu1580fs Yes ARDM-163 48 32 0.01 0.32 STGD c.4457C.T(30) p.Pro1486Leu ND ND Yes ARDM-166 42 39 NA STGD c.6320G.A(46) p.Arg2107His ND ND Yes ARDM-222 26 23 NA STGD c.2791G.A(19) p.Val931Met ND ND NP ARDM-160 30 5 0.25 0.1 STGD ND ND ND ND Yes ARDM-173 49 7 NA STGD ND ND ND ND Yes ARDM-205 NA NA NA STGD c.4919G.A(35) p.Arg1640Gln ND ND NP ARDM-247 30 12 0.05 0.1 CRD c.3386G.T(23) p.Arg1129Leu c.6410G.A(47) p.Cys2137Tyr Yes ARDM-99 59 46 0.05 0.05 CRD c.4297G.A(29) p.Val1433Ile ND ND NP ARDM-131 27 15 0.9 0.7 CRD c.2701A.G(18) p.Thr901Ala ND ND Yes ARDM-100 28 4 0.2 0.16 CRD ND ND ND ND Yes ARDM-142 30 25 0.8 0.5 CRD ND ND ND ND Yes RP-773 38 20 0.05 0.05 RP c.33N86G.T(23) p.Arg1129Leu ND ND NP RP-959 53 10 0.1 0.1 RP c.466A.G(5) p.Ile156Val ND ND Yes RP-1058 37 6 0.2 0.6 RP c.4297G.A(29) p.Val1433Ile ND ND NP Twenty-seven out of 31 subjects were found to be compound heterozygous for mutations in the ABCA4 gene detected by microarray.
X
ABCA4 p.Leu2027Phe 19028736:80:1626
status: NEW
Login to comment

PMID: 19365039 [PubMed] Roberts LJ et al: "Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip."
No. Sentence Comment
31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction.
X
ABCA4 p.Leu2027Phe 19365039:31:564
status: NEW
Login to comment

PMID: 19074458 [PubMed] Cideciyan AV et al: "ABCA4 disease progression and a proposed strategy for gene therapy."
No. Sentence Comment
151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years.
X
ABCA4 p.Leu2027Phe 19074458:151:613
status: NEW
Login to comment

PMID: 19365591 [PubMed] Maia-Lopes S et al: "ABCA4 mutations in Portuguese Stargardt patients: identification of new mutations and their phenotypic analysis."
No. Sentence Comment
63 [Met1Val]+ [Arg2030Gln], found in 4.8% of the families (for details, see Table 1).
X
ABCA4 p.Leu2027Phe 19365591:63:144
status: NEW
Login to comment

64 Most of the mutations detected have been reported as STGD-associated variants: p.Met1Val, p.Asn96Asp, p.Arg290Trp, p.Val931Met, p.Gly1961Glu, p.Leu2027Phe, p.Arg2030Gln, p.Asp1048fs, and IVS40+5G>A.
X
ABCA4 p.Leu2027Phe 19365591:64:144
status: NEW
Login to comment

69 4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 2 4458 Mi 5 8/10 / 6/10 ND / ND ND/ND 4455 S 8 1/10 / 8/10 ND / ND ND/ND 3 4431 Mo 6 1,6/10 / 1,6/10 c.1804C>T(13) / c.IVS+5G>A(40) p.Arg602Trp [30]/SPLICE [11] 4 4626 S 6 FC / FC c.3211_3212insGT(22) / c.3211_3212insGT(22) p.Asp1048fs [5]/p.Asp1048fs [5] 5 4514 S 12 1/10 / 1/10 c.32T>C(1) / c.
X
ABCA4 p.Leu2027Phe 19365591:69:184
status: NEW
Login to comment

70 [1A>G(1)]+[6089G>A(44)] p.Leu11Pro [12]/p.(Met1Val [6])+(Arg2030Gln [9]) 6 4525 Mo 14 1/10 / 1/10 ND / c.868C>T(8) ND/p.Arg290Trp [6] 7 4585 Mo 11 0.5/10 / 0.5/10 c.6079C>T(44) / ND p.Leu2027Phe [5]/ND 8 4678 Mo 9 0.5/10 / 1/10 c.3113C>T(21) / c.3602T>G(24) p.Ala1038Val [5]/p.Leu1201Arg [9] 9 4675 Mo 7 0.5/10 / 1/10 c.2T<C(1) / c.2T<C(1) p.Met1Thr/p.Met1Thr 10 4737 Mo 24 1.2/10 / 1.2/10 c.5882G>A(42) / c.3211_3212insGT(22) p.Gly1961Glu [4]/p.Asp1048fs 11 4613 S 9 FC / FC c.
X
ABCA4 p.Leu2027Phe 19365591:70:184
status: NEW
Login to comment

PMID: 18326749 [PubMed] Maia-Lopes S et al: "Evidence of widespread retinal dysfunction in patients with stargardt disease and morphologically unaffected carrier relatives."
No. Sentence Comment
150 Several other sequence changes that have been significantly correlated to the STGD phenotype (M1V, N96D, R290W, L2027F, R2030Q, V2050L, 3211insGT, and IVS40ϩ5GϾA) were also identified.
X
ABCA4 p.Leu2027Phe 18326749:150:112
status: NEW
Login to comment

134 Several other sequence changes that have been significantly correlated to the STGD phenotype (M1V, N96D, R290W, L2027F, R2030Q, V2050L, 3211insGT, and IVS40af9;5Gb0e;A) were also identified.
X
ABCA4 p.Leu2027Phe 18326749:134:112
status: NEW
Login to comment

PMID: 16103129 [PubMed] Wiszniewski W et al: "ABCA4 mutations causing mislocalization are found frequently in patients with severe retinal dystrophies."
No. Sentence Comment
146 Genotype-phenotype correlations among patients bearing one and two mislocalization-mutations Two mislocalization-alleles One mislocalization-allele RP STGD Allele 1 Allele 2 AO Allele 1 Allele 2 AO [L541P; A1038V] [L541P; A1038V] 7 [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 9 [L541P; A1038V] R1108H 13 [L541P; A1038V] G1961E 16 CRD [L541P; A1038V] G1961E 28 Allele 1 Allele 2 AO [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 10 [L541P; A1038V] L2027F 12 [L541P; A1038V] C1490Y 12 [L541P; A1038V] P1380L 5 R602W R602W 7 [L541P; A1038V] T1019M 6 [L541P; A1038V] G1961E 7 STGD [L541P; A1038V] T1019M 6 Allele 1 Allele 2 AO R602W L2027F 9 [L541P; A1038V] [L541P; A1038V] 12 C1490Y G1961E 28 C1490Y C1490Y 7 C1490Y G1961E 13 C1490Y R602W 9 C1490Y L2027F 10 C1490Y R602W 10 C1490Y L2027F 18 C1490 L2027F 18 AO-age of onset (in years).
X
ABCA4 p.Leu2027Phe 16103129:146:248
status: NEW
X
ABCA4 p.Leu2027Phe 16103129:146:411
status: NEW
X
ABCA4 p.Leu2027Phe 16103129:146:472
status: NEW
X
ABCA4 p.Leu2027Phe 16103129:146:654
status: NEW
X
ABCA4 p.Leu2027Phe 16103129:146:770
status: NEW
X
ABCA4 p.Leu2027Phe 16103129:146:803
status: NEW
X
ABCA4 p.Leu2027Phe 16103129:146:819
status: NEW
Login to comment

PMID: 15696369 [PubMed] Yatsenko AN et al: "Evolution of ABCA4 proteins in vertebrates."
No. Sentence Comment
130 As anticipated, the most frequently occurring STGD- associated missense ABCA4 alterations (R212C, L541P, D645N, G863A, A1038V, R1108C, R1380L, W1408R, T1526M, R1640W, G1961E, L2027F, and L2030Q) map to highly conserved regions.
X
ABCA4 p.Leu2027Phe 15696369:130:174
status: NEW
Login to comment

PMID: 15579991 [PubMed] Oh KT et al: "Electroretinographic findings in patients with Stargardt disease and fundus flavimaculatus."
No. Sentence Comment
165 In fact, the six most common HPRDCV, with the exception of His423Arg, (frameshift changes, Ala1038Val, Pro1380Leu, Arg1108Cys, Leu2027Phe) were observed with all three ERG classes: severe ERG derangements, mild ERG derangements, and normal ERG studies.
X
ABCA4 p.Leu2027Phe 15579991:165:127
status: NEW
Login to comment

PMID: 15192030 [PubMed] Stenirri S et al: "Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations."
No. Sentence Comment
35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations.
X
ABCA4 p.Leu2027Phe 15192030:35:1424
status: NEW
Login to comment

34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations.
X
ABCA4 p.Leu2027Phe 15192030:34:1424
status: NEW
Login to comment

PMID: 15161829 [PubMed] September AV et al: "Mutation spectrum and founder chromosomes for the ABCA4 gene in South African patients with Stargardt disease."
No. Sentence Comment
7 The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G3C mutations.
X
ABCA4 p.Leu2027Phe 15161829:7:57
status: NEW
Login to comment

71 List of 16 Different Potential Disease-Associated Sequence Variants Identified in 64 SA Subjects with arSTGD Nucleotide Change Amino Acid Change Families (N ‫؍‬ 64) Exon Reference C454T R152X 4 5 3,33 G455A R152Q 1 5 35 C634T R212C 1 6 16,27 G768T (Splice donor) V256splice 5 6 15 C1885T R602W 6 13 9 2588G3C G863A 4 17 8 T3047C V989A 1 20 11 T4319C F1440S 1 29 9 G4328A* R1443H 1 29 This study G4469A C1490Y 19 30 15,9 G5077A V16931 1 36 36 C6079T L2027F 8 44 8 C6088A R2030X 1 44 9,37 C6112T R2038W 2 44 5 IVS45ϩ7G3A Splice donor 1 45 26 6352⌬A* Frameshift 1 46 This study No individuals positive for the R1443H variant were identified in 47 control individuals of Indian ancestry.
X
ABCA4 p.Leu2027Phe 15161829:71:469
status: NEW
Login to comment

84 Of note, individual 209.1 and 113.3 were compound heterozygotes for the C1490Y and L2027F variations; however, their AOs differ considerably (18 and 10 years, respectively).
X
ABCA4 p.Leu2027Phe 15161829:84:83
status: NEW
Login to comment

96 A single STGD-associated haplotype was identified for the (1) L2027F sequence variant, in two unrelated families; (2) V256splice variant, in two unrelated families; (3) R152X variant, three unrelated families; (4) 2588G3C variant, in one family; (5) F1440S variant, in one family; and (6) IVS45ϩ7G3A variant, in one family.
X
ABCA4 p.Leu2027Phe 15161829:96:62
status: NEW
Login to comment

119 The C1490Y sequence variant was the most common disease-associated variant identified in this study (19/64; 30%), followed by the L2027F (8/64; 13%), the R602W variant (6/64; 9%), the V256splice variant (5/64; 8%), and the 2588G3C and R152X sequence variants occurred at equal frequencies (4/64; 6%).
X
ABCA4 p.Leu2027Phe 15161829:119:130
status: NEW
Login to comment

121 Five (C1490Y, L2027F, R602W, V256splice and R152X) of the six common sequence variants identified were at a higher frequency in the SA STGD cohort than in populations from Europe and the United States.
X
ABCA4 p.Leu2027Phe 15161829:121:14
status: NEW
Login to comment

125 AO (y) Phenotype Mutation 1 Mutation 2 224.1 9 STGD C1490Y R602W 170.2 10 STGD C1490Y R602W 241.1 9 STGD C1490Y 25883C 448.1 20 STGD C1490Y 2588G3C 113.3 10 STGD C1490Y L2027F 209.1 18 STGD C1490Y L2027F 165.4 10 STGD C1490Y V256splice 166.3 27 STGD C1490Y R152X 151.4 5 STGD C1490Y ND 219.1 5 (rapid clinical progression was observed by 9 years) STGD C1490Y ND 223.1 9 STGD C1490Y ND 307.1 9 STGD C1490Y ND 319.3 9 STGD C1490Y ND 385.1 10 STGD C1490Y ND 226.1 10 STGD C1490Y ND 142.2 10 STGD C1490Y ND 273.1 11 STGD C1490Y ND 382.1 12 STGD C1490Y ND 449.1 14 STGD C1490Y ND 344.2 ND STGD C1490Y ND 374.1 10 STGD L2027F 6352⌬A† 305.1 18 STGD L2027F R2038W 377.1 25 STGD L2027F R2038W 276.1 27 STGD L2027F R212C 204.4 8 STGD L2027F ND 135.4 13 STGD L2027F ND 446.1 9 STGD R602W ND 109.3 11 STGD R602W ND 110.7 13 STGD R602W ND 438.3 12 STGD R602W ND 123.1 9 STGD V256splice R152X 105.1* 10 STGD AND atypical RP V256splice R152X 24 129.3* 10 (rapid clinical progression was observed) STGD V256splice ND 163.22 10 STGD V256splice ND 173.1 8 STGD 2588G3C ND 9.4 27 STGD 2588G3C R152X 330.2 29 STGD R152Q V989A 372.1 31 STGD R1443H† R2030X 141.3 11 STGD F1440S IVS45ϩ7G3A (splice site mutation) 206.3 ND STGD V1693I ND Rows are arranged according to the age of onset (AO) starting with the earliest AO for the most common sequence variant.
X
ABCA4 p.Leu2027Phe 15161829:125:169
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:125:197
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:125:613
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:125:656
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:125:684
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:125:712
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:125:738
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:125:762
status: NEW
Login to comment

137 The 10 ABCA4 Disease-Associated Haplotypes Identified in the 10 STGD Families Investigated Family D1S188 Marker ABCA4 MutationD1S406 D1S236 166 14 6 12 C1490Y 170 15 4 9 C1490Y 151 15 4 9 C1490Y 204 9 5 14 L2027F 135 9 5 14 L2027F 105 8 4 14 V256splice 129 8 4 14 V256splice 170 10 5 12 R602W 110 16 6 3 R602W 9 7 5 14 2588G3C 9 16 5 4 R152X 105 16 5 4 R152X 166 16 5 4 R152X 141 8 3 6 F1440S 141 9 5 14 IVS45ϩ7G3A The numbers in column 1 denote the identity number of the family.
X
ABCA4 p.Leu2027Phe 15161829:137:206
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:137:224
status: NEW
Login to comment

152 The severe phenotype noted in this patient was therefore attributed to the subject`s heterozygosity for the 6352⌬A and L2027F mutations, with the latter being the major contributor to the disease phenotype.
X
ABCA4 p.Leu2027Phe 15161829:152:126
status: NEW
Login to comment

153 Further investigation into the AO reported to be associated with L2027F (data not presented), however, highlights a correlation between the L2027F variant with a milder clinical phenotype associated with a late AO (second and third decade of life).
X
ABCA4 p.Leu2027Phe 15161829:153:65
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:153:140
status: NEW
Login to comment

154 It is therefore reasonable to hypothesize that regarding individual 374.1, who was heterozygous for the two mutations, L2027F and the novel mutation 6352⌬A, (1) both mutations contribute equally to the severity of the phenotype, (2) modifying sequences within ABCA4 or other genes modulate the effect of the compound heterozygous mutations 6352⌬A/L2027F on the ABCA4 protein, and hence the phenotype, or (3) environmental factors such as diet, smoking, and UV radiation may all contribute to the scenario in (2).
X
ABCA4 p.Leu2027Phe 15161829:154:119
status: NEW
X
ABCA4 p.Leu2027Phe 15161829:154:361
status: NEW
Login to comment

PMID: 12962493 [PubMed] Biswas-Fiss EE et al: "Functional analysis of genetic mutations in nucleotide binding domain 2 of the human retina specific ABC transporter."
No. Sentence Comment
76 The pET29aNBD2 construct harboring the L2027F mutation was already available in our laboratory and prepared as previously described (12, 13).
X
ABCA4 p.Leu2027Phe 12962493:76:39
status: NEW
Login to comment

103 The locations of the disease associated mutations investigated in this study; L1971R, R2038W, G2146D, L2027F, and D2177N are indicated.
X
ABCA4 p.Leu2027Phe 12962493:103:102
status: NEW
Login to comment

144 Here, we have used site-specific mutagenesis to create disease-related genetic mutations: L1971R, D2177N, L2027F, R2038W, and G2146D as well as a synthetic mutation, K2175A.
X
ABCA4 p.Leu2027Phe 12962493:144:106
status: NEW
Login to comment

153 Lane 1: protein molecular weight standards; lane 2, wild-type NBD2; lane 3, L2027F mutant; lane 4, L1971R mutant; lane 5, D2177N; lane 6, G2146D; lane 7, R2038W mutant; lane 8, K2175A.
X
ABCA4 p.Leu2027Phe 12962493:153:76
status: NEW
Login to comment

231 Previously, we reported that the STGD1-associated mutant L2027F resulted in a significantly impaired in ATP hydrolysis (12).
X
ABCA4 p.Leu2027Phe 12962493:231:57
status: NEW
Login to comment

232 Here, we have examined any possible changes in the nucleotide binding by the L2027F mutant.
X
ABCA4 p.Leu2027Phe 12962493:232:77
status: NEW
Login to comment

233 Fluorescence anisotropy analysis demonstrated that L2027F was defective in ATP binding, as saturation of binding was not observed (Figure 6F, Table 1).
X
ABCA4 p.Leu2027Phe 12962493:233:51
status: NEW
Login to comment

263 Significant changes were observed in the Stern-Volmer plot for the L2027F mutant (Figure 7C, Table 1).
X
ABCA4 p.Leu2027Phe 12962493:263:67
status: NEW
Login to comment

265 Thus, there is a significant difference between the wild-type NBD2 protein and the L2027F mutant.
X
ABCA4 p.Leu2027Phe 12962493:265:83
status: NEW
Login to comment

267 Stern Volmer plots of the (A) wild-type NBD2, (B) L1971R mutant, (C) L2027F mutant, (D) D2177N mutant, (E) R2038W mutant, (F) G2146D mutant, and (F) K2175A mutant.
X
ABCA4 p.Leu2027Phe 12962493:267:69
status: NEW
Login to comment

357 The L2027F mutant, with very low ATPase activity as demonstrated earlier, had a dramatically altered quenching profile (Table 1).
X
ABCA4 p.Leu2027Phe 12962493:357:4
status: NEW
Login to comment

PMID: 12824224 [PubMed] Schmidt S et al: "Detailed analysis of allelic variation in the ABCA4 gene in age-related maculopathy."
No. Sentence Comment
123 Polymorphisms and Rare Sequence Variants in Exons of the ABCA4 Gene Exon Nucleotide Change Effect Allele Frequency* P† P§ Referenceሻ Independent ARM (n ‫؍‬ 140) All ARM (n ‫؍‬ 330) Control Subjects (n ‫؍‬ 118) 6 589G3C Asp197Asn 0.000 0.000 0.009 0.46 0.12 - 6 635G3A Arg212His 0.030 0.026 0.000 0.13 0.11 W, R 10 1268A3G His423Arg 0.394 0.371 0.427 0.62‡ 0.34 W, R 10 1269C3T His423His(syn) 0.033 0.039 0.031 1.0 0.74 W 18 2701A3G Thr901Ala 0.000 0.003 0.000 NA 0.58 W, R 23 3495C3T Asn1165Asn(syn) 0.000 0.003 0.000 NA 0.75 - 30 4469G3A Cys1490Tyr 0.007 0.003 0.000 1.0 0.59 W 37 5206T3C Ser1736Pro 0.009 0.008 0.000 1.0 0.44 W 40 5603T3A Asn1868Ile 0.100 0.102 0.054 0.29 0.18 W 40 5682G3C Leu1894Leu(syn) 0.293 0.272 0.298 1.0 0.64 W 41 5814A3G Leu1938Leu(syn) 0.160 0.169 0.218 0.33 0.38 W 42 5843C3T Pro1948Leu 0.052 0.038 0.054 1.0 0.50 W 42 5844A3G Pro1948Pro(syn) 0.199 0.192 0.205 1.0 0.77 W 44 6069C3T Ile2023Ile(syn) 0.040 0.050 0.044 1.0 0.82 W 44 6079C3T Leu2027Phe 0.000 0.000 0.009 0.48 0.13 W * Actual n (number of chromosomes) varies, as frequencies were calculated relative to nonmissing data only.
X
ABCA4 p.Leu2027Phe 12824224:123:1055
status: NEW
Login to comment

PMID: 12796258 [PubMed] Fishman GA et al: "ABCA4 gene sequence variations in patients with autosomal recessive cone-rod dystrophy."
No. Sentence Comment
72 In 2 instances, the variation was Leu1201Arg, and in another 2 patients it was Leu2027Phe.
X
ABCA4 p.Leu2027Phe 12796258:72:79
status: NEW
Login to comment

94 Patients With Cone-Rod Dystrophy Patient No./ Age, y/Sex Race/ Ethnicity Visual Acuity Visual Field Fundus Type* Mutation Cone vs Rod ERG ReductionOD OS 1/74/F AA 20/60 - 2 5/600 Central and peripheral loss 1 Gly1448Arg C = R 2/35/F W 10/350 5/400 Central and peripheral loss 1 Ala1038Val Leu541Pro C = R 3/42/F H 20/400 20/400 Central and peripheral loss 1 Ala1038Val Trp1618stop C = R 4/54/F W 10/180 10/140 Central scotoma 1 Donor splice, 5bp3Ј g-a intron 40 C = R 5/36/F W 10/120 10/60 - 1 Central scotoma 1 Leu541Pro Asp600Tyr C ↓ R 6/49/F W 5/160 5/180 Central and peripheral loss 1 Donor splice 5bp3Ј g-a intron 40 C = R 7/49/F W 10/350 4/350 Central and peripheral loss 1 Glu328Stop Val767Asp C = R 8/40/M W 10/225 20/400 Central and peripheral loss 1 Ala1038Val C = R 9/36/M W 5/600 5/350 Central and peripheral loss 1 Gly550Arg C = R 10/39/F AA 20/100 - 2 20/400 Central scotoma 1 Ala1038Val C = R 11/26/F W 20/200 20/200 Central and peripheral loss 1 Val2050Leu C ↓ R 12/36/M W 20/200 20/80+1 Central scotoma 1 Donor splice 5bp3Ј g-a intron 40 C = R 13/43/M AA 20/400 20/200 Central and peripheral loss 2 Leu1201Arg C = R (ND) 14/33/M P 20/40+1 20/50 Central scotoma 2 Leu2027Phe C ↓ R 15/44/M AA CF 20/400 Central and peripheral loss 2 Leu1201Arg C = R (ND) 16/56/M AA 20/40 20/40 Central scotoma 2 Leu2027Phe C = R Abbreviations: AA, African American; C ↓ R, cone responses more reduced than rod amplitudes; C = R, cone and rod amplitudes were similarly reduced; CF, counting fingers; ERG, electroretinogram; H, Hispanic; ND, nondetectable; P, Palestinian; W, white.
X
ABCA4 p.Leu2027Phe 12796258:94:1211
status: NEW
X
ABCA4 p.Leu2027Phe 12796258:94:1212
status: NEW
Login to comment

73 In 2 instances, the variation was Leu1201Arg, and in another 2 patients it was Leu2027Phe.
X
ABCA4 p.Leu2027Phe 12796258:73:79
status: NEW
Login to comment

PMID: 11726554 [PubMed] Shroyer NF et al: "Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration."
No. Sentence Comment
97 Pedigree Maternal allele Paternal allele AMD relative A priori Cosegregation AR19 pGM, -6 0.5 - AR33 [W1408R; R1640W] R24H and D1532N mA, -16 0.5 Yes AR59 4232insTATG C1488R pGM, -6 0.5 No AR80 T1526M pGF, -5 0.5 - AR80 T1526M mGF, -7 0.5 Yes AR125 4947delC C1488R pGM, -7 0.5 Yes AR215 [H1406Y; V2050L] pGM, -5 0.5 - AR218 2160+1G→C G1961E mA, -8 0.5 No AR262 W821R pGGF, -7 0.25 No AR271 P68R E1087K mGA, -6 0.25 No AR335 D645N F608I mGM, -9 0.5 Yes AR382 R1108C mGM, -6 0.5 Yes AR389 E2096K 5714+5G→A pGM, -8 0.5 Yes AR397 5196+1G→A 5585-1G→A mA, -5 0.5 No AR410 A1038V 768G→T pC, -5 0.25 Yes AR422 pGM, -6 0.5 - AR423 P1380L D1532N pGF, -4 0.5 No AR468 P1380L P1380L mU, -9 0.5 Yes AR484 L2027F G550R mGU, -5 0.25 Yes AR562 R2107H 3050+5G→A pGU, -5 0.25 No AR643 5196+2T&#x2192;C L2027F mU, -4 0.5 Yes AR661 P1380L C54Y mGF, -6 0.5 Yes AR669 664del13 pGF, -4 0.5 No AR534 W821R P1380L pGM, -7 0.5 Yes (17) Family 1 R212C I2113M mGM, I-2 0.5 Yes (27) Family 2 R1108C R2107H mGM, I-2 0.5 Yes (27) Family 3 R212C G1977S mGF, I-1 0.5 Yes (27) 10.25 15 unlikely to account for many of the remaining alleles (our unpublished observations).
X
ABCA4 p.Leu2027Phe 11726554:97:722
status: NEW
X
ABCA4 p.Leu2027Phe 11726554:97:727
status: NEW
X
ABCA4 p.Leu2027Phe 11726554:97:819
status: NEW
Login to comment

114 Sun et al. (28) reported substantial defects in protein expression or ATP binding of eight AMD-associated mutations (R212C, G863A, A1038V, R1108C, R1129L, P1380L, G1961E and L2027F) and an abnormal increase in the ATPase activity of the D2177N mutation, and they reported mild defects or wild-type activity within the sensitivity of the assay in four other AMD-associated variants (E471K, C1488R, T1526M and R1898H).
X
ABCA4 p.Leu2027Phe 11726554:114:174
status: NEW
Login to comment

PMID: 11702214 [PubMed] Fumagalli A et al: "Mutational scanning of the ABCR gene with double-gradient denaturing-gradient gel electrophoresis (DG-DGGE) in Italian Stargardt disease patients."
No. Sentence Comment
37 DNA samples (n=22) carrying previously identified mutations in the ABCR gene were employed as controls for evaluating the efficacy of the DG-DGGE approach in detecting sequence variations R572Q (Lewis et al. 1999), Y639X (Lewis et al. 1999), G863A (Lewis et al. 1999; Maugeri et al. 1999), A1038V (Rozet et al. 1998), T1019M (Rozet et al. 1998), 3211insGT (Lewis et al. 1999), P1380L (Lewis et al. 1999), H1406Y (Lewis et al. 1999), 4947delC (Lewis et al. 1999), H1838Y (Lewis et al. 1999), 5714+5G→A (Cremers et al. 1998), N1868I (De La Paz et al. 1999), L1938L (Rivera et al. 2000), G1961E (Allikmets et al. 1997a, 1997b), L1970F (Lewis et al. 1999), L2027F (Nasonkin et al. 1998), V2050L (Lewis et al. 1999), E2131K (Lewis et al. 1999), R2139W (Lewis et al. 1999), 6709insG (Lewis et al. 1999), D2177N (Allikmets et al. 1997a, 1997b), 2181del12 (Lewis et al. 1999).
X
ABCA4 p.Leu2027Phe 11702214:37:660
status: NEW
Login to comment

PMID: 11527935 [PubMed] Briggs CE et al: "Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration."
No. Sentence Comment
63 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P Ͻ 0.04).
X
ABCA4 p.Leu2027Phe 11527935:63:53
status: NEW
Login to comment

89 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 ϩ 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 ϩ 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 ϩ 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 ϩ 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 ϩ 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 ϩ 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No.
X
ABCA4 p.Leu2027Phe 11527935:89:2084
status: NEW
X
ABCA4 p.Leu2027Phe 11527935:89:2477
status: NEW
X
ABCA4 p.Leu2027Phe 11527935:89:3931
status: NEW
X
ABCA4 p.Leu2027Phe 11527935:89:4023
status: NEW
X
ABCA4 p.Leu2027Phe 11527935:89:6154
status: NEW
Login to comment

62 Specifically, Leu541Pro, Pro1380Leu, Gly1961Glu, and Leu2027Phe were not identified in any of the control individuals (P b0d; 0.04).
X
ABCA4 p.Leu2027Phe 11527935:62:53
status: NEW
Login to comment

88 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 af9; 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 af9; 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 af9; 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 af9; 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 af9; 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 af9; 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None IOVS, September 2001, Vol. 42, No. 10 ABCR in Stargardt Macular Degeneration Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. 10 TABLE 1 (continued).
X
ABCA4 p.Leu2027Phe 11527935:88:2084
status: NEW
X
ABCA4 p.Leu2027Phe 11527935:88:2477
status: NEW
X
ABCA4 p.Leu2027Phe 11527935:88:4009
status: NEW
X
ABCA4 p.Leu2027Phe 11527935:88:4101
status: NEW
X
ABCA4 p.Leu2027Phe 11527935:88:6232
status: NEW
Login to comment

PMID: 11444963 [PubMed] Biswas EE et al: "Nucleotide binding domain 1 of the human retinal ABC transporter functions as a general ribonucleotidase."
No. Sentence Comment
34 Site-directed mutagenesis was then used to introduce the Leu2027Phe mutation, which is genetically linked to Stargardt macular degeneration, into the recombinant polypeptide.
X
ABCA4 p.Leu2027Phe 11444963:34:57
status: NEW
Login to comment

PMID: 11328725 [PubMed] Webster AR et al: "An analysis of allelic variation in the ABCA4 gene."
No. Sentence Comment
102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution.
X
ABCA4 p.Leu2027Phe 11328725:102:5432
status: NEW
Login to comment

148 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His.
X
ABCA4 p.Leu2027Phe 11328725:148:183
status: NEW
Login to comment

103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution.
X
ABCA4 p.Leu2027Phe 11328725:103:5342
status: NEW
Login to comment

149 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His.
X
ABCA4 p.Leu2027Phe 11328725:149:183
status: NEW
Login to comment

PMID: 11379881 [PubMed] Yatsenko AN et al: "Late-onset Stargardt disease is associated with missense mutations that map outside known functional regions of ABCR (ABCA4)."
No. Sentence Comment
65 Allele 1 nucleotide Amino acid Allele 2 Amino acid Age of change nucleotide change onset (years) AR129-08 37 AR140-01 6079C→T L2027F 3322C→T R1108C 36 AR204-04 35 AR280-03 6316C→T R2106C 6710insA T2237fs 35 AR311-04 4462T→C C1488R 35 AR336-03 2588G→C G863A 5898+1G→A E1966splice 39 AR343-06 2588G→C G863A 3322C→T R1108C 43 AR387-03 4919G→A R1640Q 2971G→C G991R 40 AR410-04 768G→T V256splice 3113C→T A1038V 38 AR440-03 6238-6239del2 bp S2080fs 44 AR448-01a 454C→T R152X 6089G→A R2030Q 52 AR452-04 2005-2006del2 bp M669fs 6089G→A R2030Q 40 AR455-05 [1622T→C;3113C→T] [L541P;A1038V] 43 AR474-02 36 AR516-01a 5196+1G→A I1732splice 3113C→T A1038V 47 AR518-03 3322C→T R1108C 35 AR540-01a 4685T→C I1562T 51 AR594-02a 5196+1G→A I1732splice 36 AR606-04 3322C→T R1108C 2588G→C G863A 39 AR608-02 1025-1038del14 bp D342fs 40 AR617-03 2827C→T R943W 39 AR632-02a 3386G→T R1129L 50 AR649-03 3303G→A W1101X 3113C→T A1038V 36 AR662-02a 1015T→G W339G 50 AR723-01a 3602T→G L1201R 65 Fig.1 Pedigrees of late-onset Stargardt disease families (filled symbols STGD1-affected individuals).
X
ABCA4 p.Leu2027Phe 11379881:65:133
status: NEW
Login to comment

87 Proband AR140-01 is a father with onset of STGD at 36 years and who carries two missense mutant alleles (L2027F, R1108C; Fig.1).
X
ABCA4 p.Leu2027Phe 11379881:87:105
status: NEW
Login to comment

111 To compare this observation directly with our previous report (Lewis et al. 1999), we replaced five mutations (A1038V, L2027F, R2030Q, R2038W, V2050L) to linker regions.
X
ABCA4 p.Leu2027Phe 11379881:111:119
status: NEW
Login to comment

PMID: 11123914 [PubMed] Biswas EE et al: "The C-terminal nucleotide binding domain of the human retinal ABCR protein is an adenosine triphosphatase."
No. Sentence Comment
11 The NBD2 expression plasmid was used to generate a Leu2027Phe mutation associated with Stargardt disease.
X
ABCA4 p.Leu2027Phe 11123914:11:51
status: NEW
Login to comment

77 The NBD2 expression vector pET29aNBD2 was used as template, 12 cycles of PCR, and each cycle was 30 s at 95 °C, 30 s at 50 °C, and 15 min at 68 °C using the complementary oligonucleotides 5'-AGT TTG ATG CAA TCG ATG AGC TGT TCA CAG GAC GAG AAC ATC TTT AAC ATC TTT ACC TT-3' and 5'-AAG GTA AAG ATG TTC TCG TCC TGT GAA CAG CTC ATC GAT TGC ATC AAA CT-3') as mutagenic primers to generate NBD2 L2027F.
X
ABCA4 p.Leu2027Phe 11123914:77:404
status: NEW
Login to comment

162 Influence of a Leu2027Phe Mutation on ATP Hydrolysis by NBD2 Polypeptide.
X
ABCA4 p.Leu2027Phe 11123914:162:15
status: NEW
Login to comment

163 The mutation L2027F has been previously reported in some patients suffering from Stargardt macular degeneration (9, 21).
X
ABCA4 p.Leu2027Phe 11123914:163:13
status: NEW
Login to comment

165 Using a site-directed mutagenesis protocol, the mutation (L2027F) was introduced into the pET29aNBD2 plasmid, following which the mutant protein was expressed and purified.
X
ABCA4 p.Leu2027Phe 11123914:165:58
status: NEW
Login to comment

168 The L2027F point mutation in the NBD2 polypeptide increased the affinity of binding Km (46 µM) and resulted in a decrease in the rate of ATP hydrolysis, 16.6 nmol of ATP min-1 mg-1 .
X
ABCA4 p.Leu2027Phe 11123914:168:4
status: NEW
Login to comment

194 This protein was also able to utilize dATP as a substrate, but appeared to do so with FIGURE 5: (A) DNA sequence analysis of NBD2mut1 (L2027F).
X
ABCA4 p.Leu2027Phe 11123914:194:135
status: NEW
Login to comment

195 Chromatogram of DNA sequence analysis surrounding the region of the L2027F mutation of NBD2.
X
ABCA4 p.Leu2027Phe 11123914:195:68
status: NEW
Login to comment

197 (B) ATPase activity of the Leu2027Phe NBD2 mutant protein.
X
ABCA4 p.Leu2027Phe 11123914:197:27
status: NEW
Login to comment

215 As we indicated under Results, this increase in binding affinity (also observed with the Leu2027Phe mutant) was accompanied by a decrease in the rate of hydrolysis (Vmax).
X
ABCA4 p.Leu2027Phe 11123914:215:89
status: NEW
Login to comment

216 Functional Consequence of L2027F Mutation Associated with Stargardt Disease.
X
ABCA4 p.Leu2027Phe 11123914:216:26
status: NEW
Login to comment

217 The L2027F mutation in the full-length ABCR gene is associated with Stargardt disease (SGD1) (9, 21).
X
ABCA4 p.Leu2027Phe 11123914:217:4
status: NEW
Login to comment

219 Introduction of the point mutation L2027F in the NBD2 polypeptide was observed to increase the affinity of ATP binding 14-fold (Km ) 46 µM) while decreasing the rate of ATP hydrolysis (Vmax ) 16.6 nmol of ATP min-1 mg-1).
X
ABCA4 p.Leu2027Phe 11123914:219:35
status: NEW
Login to comment

222 The observed defects in retinal transport associated with the L2027F mutation may be related, at least in part, to the decreased rate of ATP hydrolysis.
X
ABCA4 p.Leu2027Phe 11123914:222:62
status: NEW
Login to comment

230 What we have demonstrated in this report is that the Leu2027Phe mutation does indeed lead to a significant decrease in the basal level of ATPase of the NBD2 domain of ABCR.
X
ABCA4 p.Leu2027Phe 11123914:230:53
status: NEW
Login to comment

PMID: 10913642 [PubMed] Fuse N et al: "Molecular genetic analysis of ABCR gene in Japanese dry form age-related macular degeneration."
No. Sentence Comment
31 Mutations Found in ABCR* Gene in 26 Exons Examined in This Study Exon AMD† Stargardt`s Disease Exon AMD Stargardt`s Disease 11 E471K 29 T1428M 15 31 R1517S 16 G818E, G863A (D847H) 33 I1562T G1578R 17 34 N1614FS 18 35 19 V931M, 2884delC N965M, (R943Q) 36 5196ϩ1G→A 5041deL15 5196ϩ2T→C 20 40 R1898H R1898H 21 A1028V 42 G1961E G1961E 22 3211insGT, V1072A E1087K 43 L1970F 6006ϩ1G→T 23 R1129L 44 L2027F, R2038W (I2023I) 24 45 V2050L, R2077W (I2083I) 25 46 R2106C (V2094V) 27 48 6519⌬11bp D2177N 6568⌬C 6519⌬11bp 6709insG *ABCR: ATP-binding cassette transporter.
X
ABCA4 p.Leu2027Phe 10913642:31:438
status: NEW
Login to comment

PMID: 9973280 [PubMed] Lewis RA et al: "Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease."
No. Sentence Comment
76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift.
X
ABCA4 p.Leu2027Phe 9973280:76:893
status: NEW
Login to comment

101 For the double-mutant chromosomes in the compound heterozygous families (AR31: Y340D and R572Q; AR106: E471K and E2131K; AR128: R572Q and G863A; and AR189: L541P and A1038V) and in those families in which the second disease chromosome was not identified (AR215: H1406Y and V2050L; AR264: D1204N and L2027F; AR254: D249G and R1898H; AR265: G863A and R1898H; AR285: 2714ϩ5GrA and 2884delC; and AR305: G863A and R1898H), in three cases (AR128, AR265, and AR305) each mutation on the double-mutant chromosome had been identified independently as disease causing in other, unrelated families with STGD1 (table 1).
X
ABCA4 p.Leu2027Phe 9973280:101:299
status: NEW
Login to comment

110 Seven mutant alleles, including six missense amino acid substitutions and one splice-site mutation (G863A, A1038V, R1108C, T1526M, G1961E, L2027F, and 5714ϩ5GrA) accounted for 41% of the disease-causing mutations identified in this cohort.
X
ABCA4 p.Leu2027Phe 9973280:110:139
status: NEW
Login to comment

111 In three instances, identical codons were affected by different base-pair substitutions, yielding different predicted missense amino acid substitutions (R572Q and R572P; R1129C and R1129L) or a missense substitution and a stop codon (R2030Q and R2030X).
X
ABCA4 p.Leu2027Phe 9973280:111:139
status: NEW
Login to comment

139 Different families with the same combination of alleles (e.g., AR326 and AR391, both with genotype L2027F/T1526M; AR376 and AR393, both with genotype A1038V/R1108C) usually have similar ages at onset, as was shown for Figure 4 Pedigree AR33, a family with STGD that manifests a pseudodominant inheritance pattern.
X
ABCA4 p.Leu2027Phe 9973280:139:99
status: NEW
Login to comment

178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ‫ע‬ SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ‫ע‬ 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ‫ע‬ 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ‫ע‬ 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ‫ע‬ 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ‫ע‬ 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade.
X
ABCA4 p.Leu2027Phe 9973280:178:406
status: NEW
X
ABCA4 p.Leu2027Phe 9973280:178:767
status: NEW
Login to comment

77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift.
X
ABCA4 p.Leu2027Phe 9973280:77:899
status: NEW
Login to comment

102 For the double-mutant chromosomes in the compound heterozygous families (AR31: Y340D and R572Q; AR106: E471K and E2131K; AR128: R572Q and G863A; and AR189: L541P and A1038V) and in those families in which the second disease chromosome was not identified (AR215: H1406Y and V2050L; AR264: D1204N and L2027F; AR254: D249G and R1898H; AR265: G863A and R1898H; AR285: 2714af9;5GrA and 2884delC; and AR305: G863A and R1898H), in three cases (AR128, AR265, and AR305) each mutation on the double-mutant chromosome had been identified independently as disease causing in other, unrelated families with STGD1 (table 1).
X
ABCA4 p.Leu2027Phe 9973280:102:299
status: NEW
Login to comment

140 Different families with the same combination of alleles (e.g., AR326 and AR391, both with genotype L2027F/T1526M; AR376 and AR393, both with genotype A1038V/R1108C) usually have similar ages at onset, as was shown for Figure 4 Pedigree AR33, a family with STGD that manifests a pseudodominant inheritance pattern.
X
ABCA4 p.Leu2027Phe 9973280:140:99
status: NEW
Login to comment

179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade.
X
ABCA4 p.Leu2027Phe 9973280:179:359
status: NEW
X
ABCA4 p.Leu2027Phe 9973280:179:688
status: NEW
Login to comment

PMID: 9490294 [PubMed] Nasonkin I et al: "Mapping of the rod photoreceptor ABC transporter (ABCR) to 1p21-p22.1 and identification of novel mutations in Stargardt's disease."
No. Sentence Comment
56 Subsequently, the disease-associated mobility shifts were sequenced and revealed the following: a G→A transition at nucleotide 2565 resulting in a stop at codon 855, a G→A transition at 3106 replacing the negatively charged glutamic acid with the positively charged lysine residue at codon 1036, an insertion of two bases, GT, at 3211 causing a frameshift at codon 1071 and leading to protein termination 11 amino acids further downstream, and finally a C→T transition at 6079 resulting in a leucine to phenylalanine change at codon 2027 (Fig.3, Table 1).
X
ABCA4 p.Leu2027Phe 9490294:56:513
status: NEW
Login to comment

79 The family numbers correspond to those of Weber et al. (1996) Family Base change at Exon Consequence nucleotide positiona 1 G3106A 3188 E1036K 1 C6007T 6007a I20231 6 3211insGTb 3188 S1071 frameshift 9 G2565A 2383 W855Stop 13 C6079Tb 6007a L2027F 16 6816+21C→T 6480a Silent polymorphism (?)
X
ABCA4 p.Leu2027Phe 9490294:79:240
status: NEW
Login to comment

PMID: 23143460 [PubMed] Downes SM et al: "Detection rate of pathogenic mutations in ABCA4 using direct sequencing: clinical and research implications."
No. Sentence Comment
28 In 5 of the 11 patients, the identification of 2 pathogenic mutations confirmed the historical diagnosis and all had chorioretinal atro- Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 1 1Ab0e;G M1V 2588Gb0e;C G863A In trans Unaffected parents carriers 30 STGD maf9;/0/0 R2030Q 3 PVs 2 161Gb0e;A C54Y 2588Gb0e;C G863A In trans Affected sibling with same mutations 12 STGD m/0/0 0 2 PVs 3 161Gb0e;A C54Y 5882Gb0e;A G1961E NK NK 18 STGD m/0/0 0 2 PVs 4 634Cb0e;T R212C 4457Cb0e;T P1486L In trans Unaffected parents carriers 17 STGD m/0/0 0 2 PVs 5 2588Gb0e;C G863A 4469Gb0e;A C1490Y NK NK 48 STGD maf9;/0/1 0 2 PVs 6 2971Gb0e;C G991R 4254-2Ab0e;G Splice NK NK 21 STGD m/0/0 0 2 PVs 7 2971Gb0e;C G991R 3602Tb0e;G L1201R NK NK 18 STGD maf9;af9;/NP/NP V643M (likely), G885E (likely), G1441D (unlikely), V2244V (highly likely) b0e;2 PVs 8 3322Cb0e;T R1108C 768Gb0e;T V256V NK NK 13 STGD maf9;af9;/1/1 0 2 PVs 9 3322Cb0e;T R1108C 6079Cb0e;T L2027F NK NK 26 STGD maf9;/0/0 0 2 PVs 10 3386Gb0e;T R1129L 4469Gb0e;A C1490Y In trans Unaffected parents carriers 15 STGD maf9;/0/0 R152Q (unlikely) 2 PVs (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1486 phy on current clinical examination, consistent with progression of the disorder.5 One of the 11 patients with chorioretinal atrophy (subject 40) had a single stop codon, again strongly supporting the original clinical diagnosis. Six of the 11 patients did not have pathogenic mutations in ABCA4.
X
ABCA4 p.Leu2027Phe 23143460:28:1215
status: NEW
Login to comment

30 In 3 of the 6 patients with a historical diagnosis Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients (continued) Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 11 4139Cb0e;T P1380L 5714 af9; 5Gb0e;A Splice NK NK 19 STGD m/0/0 0 2 PVs 12 4457Cb0e;T P1486L 4457Cb0e;T P1486L In trans Unaffected sibling carries 1 mutation 25 STGD maf9;af9;/1/1 0 2 PVs 13 4537dupC Q1513fs 6391Gb0e;A E2131K In trans Unaffected parents carriers 10 STGD maf9;/0/0 R152Q in cis with Q1513fs, E2131K in cis with E471K 2 PVs 14 6079Cb0e;T L2027F 6079Cb0e;T L2027F In trans Unaffected sibling carrier 28 STGD maf9;af9;/0/0 0 2 PVs 15 5018 af9; 2Tb0e;C NA 6316Cb0e;T R2106C In trans Affected sibling with same mutations 17 STGD m/0/1 0 2 PVs 16 3004Cb0e;T R1002Wb 1957Cb0e;T R653C In trans NK 16 STGD m/0/1 0 2 PVs 17 1253Tb0e;C F418S 2588Gb0e;C G863A NK NK 52 STGD maf9;/0/0 0 2 PVs 18 6709Ab0e;C T2237Pb 3064Gb0e;A E1022K In trans 2 Affected siblings with same mutations 6 STGD maf9;af9;/0/0 0 2 PVs 19 5260Tb0e;G Y1754D 4469Gb0e;A C1490Y In trans NK 12 STGD maf9;af9;/0/0 0 2 PVs 20 551Cb0e;T S184Fb 4793Cb0e;A A1598D NK 2 Affected siblings with same mutations 58 STGD m/NP/NP 0 2 PVs 21 550-551TCb0e;CG S184Rb 5882Gb0e;A G1961E In trans Affected sibling with same mutations 25 STGD maf9;af9;/0/0 0 2 PVs 22 5313-3Cb0e;G Spliceb 5882Gb0e;A G1961E In trans Unaffected parents carriers 47 STGD m/0/1 0 2 PVs 23 2588Gb0e;C G863A 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans NA 26 STGD maf9;af9;/3/1 1 In cis with G863A 2 PVs 24 5537Tb0e;C I1846T 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected son carries I1846T only 17 STGD maf9;af9;/3/3 0 2 PVs 25 6089Gb0e;A R2030Q 5461-10Tb0e;C Disease-associated allele, unknown mechanism In trans Unaffected sibling carries R2030Q 4 STGD m/NP/NP 0 2 PVs 26 6730-1Gb0e;C Spliceb 2588Gb0e;C G863A NK NK 15 STGD NP/NP/NP 0 2 PVs 27 3291Ab0e;T R1097Sb 3056Cb0e;T T1019M In trans NK 9 STGD NP/NP/NP 1 In cis with R1097S 2 PVs 28 498delT L167HisfsX2b Not present NA NA NK 28 STGD m/1/1 0 1 PV 29 2345Gb0e;A W782Xb Not present NA NA Unaffected mother carries mutation 25 STGD m/1/1 0 1 PV 30 2588Gb0e;C G863A 4326Cb0e;A N1442K NK NK 36 STGD maf9;/0/0 0 1 PV af9; N1442K (unlikely) 31 2966Tb0e;C V989A Not present NA NA NK 49 STGD m/1/1 0 1 PV (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1487 (c)2012 American Medical Association. All rights reserved. Downloaded From: http://archopht.jamanetwork.com/ by a Semmelweis University Budapest User on 12/06/2015 lopathy is genetically heterogeneous. A total of 10 novel mutations were identified (Table).
X
ABCA4 p.Leu2027Phe 23143460:30:702
status: NEW
X
ABCA4 p.Leu2027Phe 23143460:30:723
status: NEW
Login to comment

PMID: 23499370 [PubMed] Fujinami K et al: "A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations."
No. Sentence Comment
89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2.
X
ABCA4 p.Leu2027Phe 23499370:89:351
status: NEW
X
ABCA4 p.Leu2027Phe 23499370:89:551
status: NEW
X
ABCA4 p.Leu2027Phe 23499370:89:2380
status: NEW
X
ABCA4 p.Leu2027Phe 23499370:89:2528
status: NEW
Login to comment

PMID: 23695285 [PubMed] Heathfield L et al: "Stargardt disease: towards developing a model to predict phenotype."
No. Sentence Comment
13 This study considers a South African cohort of 118 individuals who express biallelic combinations of seven founder mutations in ABCA4 (c.454C4T (p.Arg152*), c.768G4T (p.Val256Val), c.1804C4T (p.Arg602Trp), c.2588G4C (p.Gly863Ala), c.4469G4A (p.Cys1490Tyr), c.5461-10T4C, c.6079C4T (p.Leu2027Phe)), which collectively account for 36% of STGD cases studied to date in South Africa.19,20 These data, together with clinical information for each patient, were used to test the genotype-phenotype model.
X
ABCA4 p.Leu2027Phe 23695285:13:284
status: NEW
Login to comment

33 Table 1 A summary of the 23 mutation combinations observed in 118 patients with STGD, showing the number of patients per combination and the average and median AOO (in years) per combination Mutation 1 Mutation 2 Number of patients Average AOO (years) Median AOO (years) c.5461-10T4C c.768G4T (p.Val256Val) 1 6 6 c.5461-10T4C c.5461-10T4C 2 6.5 6.5 c.1804C4T (p.Arg602Trp) c.768G4T (p.Val256Val) 3 6.7 6 c.5461-10T4C c.454C4T (p.Arg152*) 3 7 8 c.4469G4A (p.Cys1490Tyr) c.454C4T (p.Arg152*) 6 7.8 8 c.768G4T (p.Val256Val) c.454C4T (p.Arg152*) 4 8 9 c.768G4T (p.Val256Val) c.768G4T (p.Val256Val) 1 8 8 c.4469G4A (p.Cys1490Tyr) c.4469G4A (p.Cys1490Tyr) 9 8.1 8 c.6079C4T (p.Leu2027Phe) c.454 C4T (p.Arg152*) 7 8.2 7 c.4469G4A (p.Cys1490Tyr) c.1804C4T (p.Arg602Trp) 13 8.6 8 c.4469G4A (p.Cys1490Tyr) c.5461-10T4C 13 8.8 9 c.4469G4A (p.Cys1490Tyr) c.768G4T (p.Val256Val) 10 10.3 9 c.4469G4A (p.Cys1490Tyr) c.6079C4T (p.Leu2027Phe) 12 10.3 9.5 c.6079C4T (p.Leu2027Phe) c.5461-10T4C 3 11 10 c.1804C4T (p.Arg602Trp) c.5461-10T4C 1 11 11 (c.1804C4T (p.Arg602Trp) c.6079C4T (p.Leu2027Phe) 8 12 11 c.6079C4T (p.Leu2027Phe) c.768G4T (p.Val256Val) 6 12.5 13 c.768G4T (p.Val256Val) c.2588G4C (p.Gly863Ala) 3 16.7 18 c.1804C4T (p.Arg602Trp) c.2588G4C (p.Gly863Ala) 2 17.5 17.5 c.4469G4A (p.Cys1490Tyr) c.2588G4C (p.Gly863Ala) 4 18.5 19 c.5461-10T4C c.2588G4C (p.Gly863Ala) 1 20 20 c.6079C4T (p.Leu2027Phe) c.6079C4T (p.Leu2027Phe) 2 28 28 c.2588G4C (p.Gly863Ala) c.454C4T (p.Arg152*) 4 28 30 In some cases, the average AOO of a given mutation differed significantly depending on the mutational context in which it occurred.
X
ABCA4 p.Leu2027Phe 23695285:33:671
status: NEW
X
ABCA4 p.Leu2027Phe 23695285:33:914
status: NEW
X
ABCA4 p.Leu2027Phe 23695285:33:951
status: NEW
X
ABCA4 p.Leu2027Phe 23695285:33:1067
status: NEW
X
ABCA4 p.Leu2027Phe 23695285:33:1100
status: NEW
X
ABCA4 p.Leu2027Phe 23695285:33:1379
status: NEW
X
ABCA4 p.Leu2027Phe 23695285:33:1404
status: NEW
Login to comment

35 For example, the average AOO is significantly lower among individuals who are homozygous for the Cys1490Tyr mutation compared to individuals who express a single Cys1490Tyr mutation and the Leu2027Phe mutation.
X
ABCA4 p.Leu2027Phe 23695285:35:190
status: NEW
Login to comment

45 Table 2 Covariates included in the generalised linear model (with inverse link function) with their respective coefficients, standard errors and P-values Covariate Coefficient Standard error P-value (Intercept) 0.0460 0.0106 3.53e 05 c.4469G4A (p.Cys1490Tyr) 0.0528 0.0076 2.71e 10 c.1804C4T (p.Arg602Trp) 0.0468 0.0085 2.33e 07 c.6079C4T (p.Leu2027Phe) 0.0090 0.0089 0.3117 c.5461-10T4C 0.0562 0.0106 6.59e 07 c.768G4T (p.Val256Val) 0.0507 0.0083 2.06e 08 c.2588G4C (p.Gly863Ala) 0.0413 0.0081 1.58e 06 c.454C4T (p.Arg152*) 0.0311 0.0080 0.0002 c.4469G4A (p.Cys1490Tyr) (homozygous) 0.0336 0.0144 0.0214 c.4469G4A (p.Cys1490Tyr): c.5461-10T4C 0.0419 0.0146 0.0049 c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp) 0.0295 0.0145 0.0442 c.4469G4A (p.Cys1490Tyr): c.768G4T (p.Val256Val) 0.0520 0.0134 0.0002 c.6079C4T (p.Leu2027Phe): c.454C4T (p.Arg152*) 0.0519 0.0158 0.0013 Figure 1 Graph depicting the actual and predicted average AOO with 95% confidence bands for each mutation combination observed in five or more patients.
X
ABCA4 p.Leu2027Phe 23695285:45:345
status: NEW
X
ABCA4 p.Leu2027Phe 23695285:45:830
status: NEW
Login to comment

53 The mutation combinations not detected in the cohort were c.454C4T (p.Arg152*) (homozygous), c.1804C4T (p.Arg602Trp) (homozygous), c.2588G4C (p.Gly863Ala) (homozygous), c.454C4T (p.Arg152*):c.1804C4T (p.Arg602Trp) and c.2588G4C (p.Gly863Ala): c.6079C4T (p.Leu2027Phe).
X
ABCA4 p.Leu2027Phe 23695285:53:256
status: NEW
Login to comment

57 The c.2588G4C (p.Gly863Ala): c.6079C4T (p.Leu2027Phe) combination may be an example of this, as this combination has not yet been reported in the literature, to the best of our knowledge, and c.2588G4C (p.Gly863Ala) was previously proposed as a mild mutation.16 Lastly, and least likely, the mutation combination may be so severe that it leads to panretinal atrophy and therefore would not be identified in this STGD patient cohort.
X
ABCA4 p.Leu2027Phe 23695285:57:42
status: NEW
Login to comment

PMID: 23769331 [PubMed] Fujinami K et al: "The clinical effect of homozygous ABCA4 alleles in 18 patients."
No. Sentence Comment
7 Results: Eleven disease-associated homozygous ABCA4 alleles were identified, including 1 frame shift, 2 stops, 1 intronic variant causing splice-site alteration, 2 complex missense variants, and 5 missense variants: p.Glu905fsX916, p.Arg1300X, p.Gln2220X, c.4253&#fe;4 C>T, p.Leu541Pro and p.Ala1038Val (homozygosity for complex allele), p.Val931Met and p.Arg1705Gln (complex allele), p.Arg212Cys, p.Cys1488Arg, p.Arg1640Trp, p.Gly1961Glu, and p.Leu2027Phe.
X
ABCA4 p.Leu2027Phe 23769331:7:446
status: NEW
Login to comment

12 One patient with homozygous p.Leu2027Phe showed a spared fovea and preserved visual acuity.
X
ABCA4 p.Leu2027Phe 23769331:12:30
status: NEW
Login to comment

13 Conclusions: The phenotypes represented in patients identified as homozygous for presumed disease-associated ABCA4 variants gives insight into the effect of individual alleles. Null alleles have severe functional effects, and certain missense variants are similar to nulls, suggesting complete abrogation of protein function. The common alleles identified, p.Gly1961Glu and p. Leu2027Phe, both have a mild structural and functional effect on the adult retina; the latter is associated with relatively retained photoreceptor architecture and function at the fovea.
X
ABCA4 p.Leu2027Phe 23769331:13:377
status: NEW
Login to comment

60 Sex Ethnicity Consanguinity Age at Onset (yrs) Age (yrs) Duration of Disease (yrs) LogMAR VA Fundus Appearance AF Pattern ERG Group OCT Central Foveal Thickness (mm) Mutation Status RE LE RE LE 1 1 M S Asian Yes (1st cousin) 11 33 22 1.0 1.0 2 2 1 64 69 c.634 C>T, p.Arg212Cys 2 1 F S Asian Yes (1st cousin) 11 36 25 1.0 1.0 2 2 3 31 41 c.634 C>T, p.Arg212Cys 3* 2 M European No 3 8 5 1.2 1.2 2 2 3y 41 36 c.1622 T>C, p.Leu541Pro / c.3113 C>T, p.Ala1038Val 4 3 F S Asian Yes (2nd cousin once removed) 5 8 3 1.0 1.0 2 2 3 NA NA c.2713delG, p.Glu905fsX916 5 4 M S Asian Yes (unknown) 10 25 15 1.0 1.08 2 2 3 64 60 c.2791 G>A, p.Val931Met / c.5114 G>A, p.Arg1705Gln 6 5 M S Asian Yes (1st cousin) 10 30 20 1.0 1.0 2 2 3 NA NA c.4462 T>C, p.Cys1488Arg 7 5 F S Asian Yes (1st cousin) 10 22 12 2.0 1.0 2 2 3 NA NA c.4462 T>C, p.Cys1488Arg 8 6 M ME Asian Yes (1st cousin) 30 36 6 1.08 2.0 3 3 3 103 95 c.4918 C>T, p.Arg1640Trp 9 7 F S Asian Yes (2nd cousin) 19 27 8 1.78 2.0 1 2 1 128 90 c.5882 G>A, p.Gly1961Glu 10 7 M S Asian Yes (2nd cousin) 30 34 4 0.48 0.48 1 2 1 NA NA c.5882 G>A, p.Gly1961Glu 11 8 F S Asian Yes (1st cousin) 17 26 9 0.78 0.78 1 1 1 54 47 c.5882 G>A, p.Gly1961Glu 12 9 F European No 44 44 0 0.18 0.0 2 2 1 NA NA c.6079 C>T, p.Leu2027Phe 13 10 M ME Asian Yes (1st cousin) 5 11 6 1.3 1.0 3 2 3 62 68 c.3898 C>T, p.Arg1300X 14 11 M S Asian Yes (unknown) 8 11 3 1.0 1.0 2 2 3 NA NA c.4253&#fe;4 C>T 15 12 M S Asian Yes (1st cousin) 9 48 39 3.0 3.0 3 NA 3 NA NA c.6658 C>T, p.Gln2220X 16 13 M S Asian Yes (uncle and niece) 4 7 3 1.08 1.08 1 NA 3 NA NA c.6658 C>T, p.Gln2220X 17 13 M S Asian Yes (uncle and niece) 6 8 2 1.08 1.0 1 NA 3 NA NA c.6658 C>T, p.Gln2220X 18 13 M S Asian Yes (1st cousin) 17 25 8 1.78 1.78 3 NA 3 NA NA c.6658 C>T, p.Gln2220X AF &#bc; autofluorescence; ERG &#bc; electroretinography; F &#bc; female; FM No.
X
ABCA4 p.Leu2027Phe 23769331:60:1242
status: NEW
Login to comment

80 One putative novel variant (p.Glu905fsX916) was identified by NGS, and 7 have not been described in the homozygous state before: p.Val931Met, p.Cys1488Arg, p.Arg1705Gln, p.Leu2027Phe, p.Arg1300X, c.4253&#fe;4C>T, and p.Gln2220X (Table 4, available at http://aaojournal.org).
X
ABCA4 p.Leu2027Phe 23769331:80:172
status: NEW
Login to comment

89 Three heterozygous changes were found in patient 12, suggesting that the p.Leu2027Phe had occurred recurrently on 2 distinct chromosomal backgrounds.
X
ABCA4 p.Leu2027Phe 23769331:89:75
status: NEW
Login to comment

96 A very mild phenotype was observed in patient 12, homozygous for p.Leu2027Phe, with late onset (44 years), well-preserved visual acuity (0.18 and 0.0 for each eye), type 2 fundus appearance, type 2 AF pattern with spared AF signal at the fovea, and normal full-field ERGs (group 1).
X
ABCA4 p.Leu2027Phe 23769331:96:67
status: NEW
Login to comment

117 The 2 previously reported variants (p.Asn96Lys and p.His1838Asp) in complex with p.Gly1961Glu that were associated with a very severe phenotype were not detected in our patients.12 We observed a particularly late-onset mild disorder, with numerous flecks and foveal sparing, associated with p.Leu2027Phe, suggesting primary disease of the parafoveal RPE with preservation of foveal structure, a "foveal sparing" phenotype.
X
ABCA4 p.Leu2027Phe 23769331:117:293
status: NEW
Login to comment

118 This supports previous reports of p.Leu2027Phe in heterozygous patients.14,23 Of note, p.Gly1961Glu and p.Leu2027Phe are both situated in the nucleotide-binding domain 2 subunit, shown to be the site of adenosine triphosphatase activity (Fig 5, available at http://aaojournal.org).39,40 Subjects homozygous for p.Arg212Cys had phenotypes of moderate severity, and these findings are generally in keeping with previous reports.19 Patient 5, homozygous for p.Val931Met and p.Arg1705Gln in complex, and subjects 6 and 7, homozygous for p.Cys1488Arg, had "typical" Stargardt`s disease fundus and AF findings with macular atrophy surrounded by flecks with electrophysiologic evidence of generalized rod and cone system dysfunction.
X
ABCA4 p.Leu2027Phe 23769331:118:36
status: NEW
X
ABCA4 p.Leu2027Phe 23769331:118:106
status: NEW
Login to comment

PMID: 23953153 [PubMed] Fujinami K et al: "Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function."
No. Sentence Comment
48 6089 G>A, p.Arg2030Gln] 16 44* 44 0.18 0 2 NA NA 1 A A NA NA [c.6079 C>T, p.Leu2027Phe/c.6079 C>T, p.Leu2027Phe] 17 48 73 0.18 3 4 135 86 U 2 A ND NA NA [c.4956 T>G, p.Tyr1652*] 18 56 57 0 0 2 254 273 1 ND A NA NA [c.5018&#fe;2 T>C, Splice site] 19 53* 53 0.48 0.18 1 137 133 1 A A NA NA [c.5461-10 T>C, Splice site] 20 49 58 0.18 0 1 256 222 U 1 A N 1 1 [c.5461-10 T>C, Splice site] 21 47** 47 0.3 0.3 1 239 202 U 1 A A 1 1 [c.1805 G>A, p.Arg602Gln] 22 50* 50 0.48 0.18 1 263 261 U 1 N N NA NA [c.1957 C>T, p.Arg653Cys] 23 39* 39 0 0.1 2 225 228 1 N N NA NA [c.2588 G>C, p. Gly863Ala] 24 55 57 0.48 0.48 1 117 74 1 ND ND NA NA [c.3602 T>G, p.Leu1201Arg] 25 50 54 0.48 0.18 1 147 144 U 3 ND ND NA NA [c.3602 T>G, p.Leu1201Arg] 26 43 47 2 0.18 1 70 52 1 ND ND NA NA [c.4319 T>C, p.Phe1440Ser] 27 30 51 0.3 0.3 1 75 79 U 3 A A NA NA [c.4685 T>C, p.Ile1562Thr] 28 29 34 0.18 0.18 3 132 107 1 A A NA NA [c.4926 C>G, p.Ser1642Arg] 29 52* 52 0.18 0.18 3 180 200 1 ND ND 2 2 [c.5882 G>A, p.Gly1961Glu] 30 28 28 0.1 0.1 2 NA NA 1 N ND NA NA [c.6079 C>T, p.Leu2027Phe] 31 40* 40 0.1 0.1 2 222 223 U NA NA NA NA NA [c.6079 C>T, p.Leu2027Phe] 32 45 48 0.18 3 1 237 252 U NA NA NA NA NA NA Continued on next page Tartu, Estonia) in all probands.43 The term ''variants`` used herein includes those sequence changes previously shown to be enriched in patients with Stargardt disease from prior studies.
X
ABCA4 p.Leu2027Phe 23953153:48:76
status: NEW
X
ABCA4 p.Leu2027Phe 23953153:48:101
status: NEW
X
ABCA4 p.Leu2027Phe 23953153:48:1051
status: NEW
X
ABCA4 p.Leu2027Phe 23953153:48:1125
status: NEW
Login to comment

127 2588G>C, p.Gly863Ala 4 Het Allikmets46 Intol. 0.01 PRD 0.996 No change 68/13006 db SNP (rs76157638) 21 c.3113C>T, p.Ala1038Val 1 Het Webster53 Tol. NA Benign 0.014 Donor 43.5 70 New site (&#fe;61.72) 22/13006 db SNP (rs61751374) 24 c.3602T>G, p.Leu1201Arg 2 Het Lewis48 Tol. NA Benign 0.052 Donor 61.3 74 New site (&#fe;20.08) 416/13006 db SNP (rs61750126) 27 c.3898C>T, p.Arg1300* 1 Het Rivera49 NA NA ND 28 c.4139C>T, p.Pro1380Leu 2 Het Lewis48 Intol. 0.01 Benign 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4222 T>C, p.Trp1408Arg 2 Het Lewis48 Tol. NA PRD 0.845 No change ND dbSNP (rs61750135) 29 c.4319T>C, p.Phe1440Ser 1 Het Lewis48 Tol. NA PRD 0.744 No change ND dbSNP (rs61750141) 30 c.4469G>A, p.Cys1490Tyr 1 Het Webster53 Intol. 0.03 PRD 0.994 No change ND dbSNP (rs61751402) 31 c.4577C>T, p.Thr1526Met 1 Het Lewis48 Intol. 0.00 PRD 0.91 No change ND db SNP (rs61750152) 31 c.4594G>T, p.Asp1532Asn 3 Het Lewis48 Tol. NA PRD 0.853 No change ND 33 c.4685T>C, p.Ile1562Thr 1 Het Allikmets46 Tol. NA Benign 0.034 No change 18/13006 db SNP (rs1762111) 35 c.4956T>G, p.Tyr1652* 1 Het Fumagalli52 NA NA Acceptor 43 72 New site (&#fe;67.36) ND 35 c.4918C>T, p.Arg1640Trp 2 Het Rozet47 Intol. 0.00 PRD 1 No change ND dbSNP (rs61751404) 35 c.4926C>G, p.Ser1642Arg 1 Het Birch50 Tol. 0.68 Benign 0.116 No change ND db SNP (rs61753017) Int 35 c.5018&#fe;2T>C, Splice site 1 Het Fumagalli52 NA NA Donor 81.2 54 WT site broken (33.07) ND Int 38 c.5461-10T>C 3 Het Briggs50 NA NA No change 3/13006 db SNP (rs1800728) 40 c.5693G>A, p.Arg1898His 2 Het Allikmets46 NA Benign 0.00 No change 25/13006 db SNP (rs1800552) 42 c.5882G>A, p.Gly1961Glu 1 Het Allikmets46 Tol. 0.18 PRD 1 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T, p.Leu2027Phe 4 Homo Lewis48 Intol. 0.02 PRD 0.999 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A, p.Arg2030Gln 4 Het Lewis48 Tol. NA PRD 0.995 No change 8/13006 db SNP (rs61750641) 44 c.6118C>T, p.Arg2040* 1 Het Rosenberg54 NA NA ND 46 c.6320G>A, p.Arg2107His 1 Het Fishman8 Intol. 0.00 PRD 0.996 No change 91/13006 db SNP (rs62642564) EVS &#bc; Exome Variant Server; HSF &#bc; Human Splicing Finder program; Hum var score &#bc; Human var score; Int &#bc; intron; Intol &#bc; intolerant; Mt CV &#bc; mutant consensus value; NA &#bc; not applicable; ND &#bc; not detected; PRD &#bc; probably damaging; Pred. &#bc; prediction; SIFT &#bc; Sorting Intolerant from Tolerance program; Tol. &#bc; tolerant; Wt CV &#bc; wild-type consensus value.
X
ABCA4 p.Leu2027Phe 23953153:127:1730
status: NEW
Login to comment

136 The most common variants identified were p.Gly863Ala, c.5461-10T>C, p.Leu2027Phe, and p.Arg2030Gln, occurring, respectively, in 4, 3, 3, and 4 patients with the foveal-sparing phenotype of Stargardt disease.
X
ABCA4 p.Leu2027Phe 23953153:136:70
status: NEW
Login to comment

137 One patient was identified to be homozygous for the p.Leu2027Phe variant; none had 2 or more null variants.
X
ABCA4 p.Leu2027Phe 23953153:137:54
status: NEW
Login to comment

142 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) (Continued) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency Int 33 c.4773&#fe;48C>T 1 0.36% 34 c.4793C>A, p.Ala1598Asp 1 0.36% 35 c.c.4918C>T, p.Arg1640Trp 1 0.36% Int 35 c.5018&#fe;2T>C, Splice site 2 0.71% 36 c.5114G>A, p.Arg1705Gln 2 0.71% 37 c.5222_5233delTGGTGGTGGGC, p.Lys1741Hisfs 1 0.36% 37 c.5281_5289delCTT CCT GCC, p.Pro1761_Leu1763del 2 0.71% Int 38 c.5461-10T>C 23 8.21% Int 39 c.5585-1G>A, Splice site 1 0.36% Int 40 c.5714&#fe;5G>A, Splice site 5 1.79% 42 c.5882G>A, p.Gly1961Glu 17 6.07% 43 c.5908C>T, p.Leu1970Phe 2 0.71% 43 c.5917delG, p.Val1973* 1 0.36% 44 c.6079C>T, p.Leu2027Phe 10 3.57% 44 c.6089G>A, p.Arg2030Gln 3 1.07% 44 c.6118C>T, p.Arg2040* 1 0.36% 45 c.6148G>C, p.Val2050Leu 3 1.43% 46 c.6286G>A, p.Glu2096Lys 1 0.36% 46 c.6320G>A, p.Arg2107His 4 1.43% 47 c.6445C>T, p.Arg2149* 1 0.36% 47 c.6449G>A, p.Cys2150Tyr 3 1.07% 48 c.6658C>T, p.Gln2220* 3 1.07% 48 c.6709_6710insG, p.Thr2237Serfs 1 0.36% Int &#bc; Intron.
X
ABCA4 p.Leu2027Phe 23953153:142:814
status: NEW
Login to comment

164 Comparison of the Most Prevalent ABCA4 Variants` Frequency Between the Cohort With the Foveal-Sparing Stargardt Disease and the Group With the Typical Stargardt Disease (Without Evidence of Foveal Sparing) Number of Alleles and Those Frequencies Foveal-Sparing Stargardt Disease (n &#bc; 31, Total 30 Variants in 62 Alleles) Typical Stargardt Disease (n &#bc; 140, Total 72 Variants in 280 Alleles) c.2588G>C, p.Gly863Ala 4 (6.45%) 19 (6.79%) c.4139C>T, p.Pro1380Leu 2 (3.23%) 14 (5.00%) c.6079C>T, p.Leu2027Phe 4 (6.45%) 10 (3.57%) c.6089G>A, p.Arg2030Gln 4 (6.45%) 3 (1.07%) c.5461-10T>C 3 (4.84%) 23 (8.21%) c.5882G>A, p.Gly1961Glu 1 (1.61%) 17 (6.07%) in the foveal-sparing phenotype compared to the typical phenotype; there was also clear concordance in sibships with the foveal-sparing phenotype, although a possible influence of genetic/environmental modifiers cannot be excluded.
X
ABCA4 p.Leu2027Phe 23953153:164:501
status: NEW
Login to comment

PMID: 23982839 [PubMed] Fujinami K et al: "ABCA4 gene screening by next-generation sequencing in a British cohort."
No. Sentence Comment
56 40 c.4926C>G p.S1642R DC c.5041_5055del GTGGTTGCCATCTGC p.V1681_C1685del DC 2 41 c.4956T>G p.Y1652* DC 1 42 c.5018&#fe;2T>C Splice site DC 1 43 c.5461-10T>C DC c.6385A>G p.S2129G PDC 2 44 c.5461-10T>C DC 1 45 c.5461-10T>C DC 1 46 c.5461-10T>C DC 1 47 c.5461-10T>C DC 1 48 c.5461-10T>C DC 1 49 c.5461-10T>C DC 1 50 c.5461-10T>C DC 1 51 c.5585-1G>A Splice site DC 1 52 c.5714&#fe;5G>A Splice site DC c.6209C>G p.T2070R DC 2 53 c.5882G>A p.G1961E DC c.2686A>G p.K896E B 1 54 c.5882G>A p.G1961E DC c.3050&#fe;1G>C Splice site DC 2 55 c.5882G>A p.G1961E DC c.3392delC/3393C>G p.A1131Gfs DC 2 56 c.5882G>A p.G1961E DC c.4539&#fe;2T>G Splice site DC 2 57 c.5882G>A p.G1961E DC c.4552A>C p.S1518R DC 2 58 c.5882G>A p.G1961E DC c.5899-2delA Splice site DC 2 59 c.5882G>A p.G1961E DC 1 60 c.6079C>T p.L2027F DC c.1906C>T p.Q636* DC 2 61 c.6079C>T p.L2027F DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 62 c.6079C>T p.L2027F DC c.3370G>T p.D1124Y DC 2 63 c.6079C>T p.L2027F DC 1 64 c.6089G>A p.R2030Q DC c.4326C>A p.N1442K DC 2 65 c.6445C>T p.R2149* DC 1 66 c.6709A>C p.T2237P DC c.5899-3_5899-2delTA Splice site DC 2 67 c.2971G>C p.G991R B c.4538A>G p.Q1513R DC 1 68 c.3602T>G p.L1201R B c.1749G>C p.K583N DC 1 69 c.3602T>G p.L1201R B c.1982_1983insG p.A662fs DC 1 70 c.3602T>G p.L1201R B c.2972G>T p.G991V DC 1 71 c.4685T>C p.I1562T B c.3289A>T p.R1097* DC 1 72 c.6320G>A p.R2107H B c.2510T>C p.L837P DC 1 73 c.6320G>A p.R2107H B c.4352&#fe;1G>A Splice site DC 1 74 c.2701A>G p.T901A B 0 75 c.3602T>G p.L1201R B 0 76 c.4283C>T p.T1428M B 0 77 c.466A>G p.I156V B 0 78 c.466A>G p.I156V B 0 79 c.4715C>T p.T1572M B 0 Putative novel variants are shown in italics.
X
ABCA4 p.Leu2027Phe 23982839:56:791
status: NEW
X
ABCA4 p.Leu2027Phe 23982839:56:839
status: NEW
X
ABCA4 p.Leu2027Phe 23982839:56:932
status: NEW
X
ABCA4 p.Leu2027Phe 23982839:56:981
status: NEW
Login to comment

63 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 30 c.4537_4538insC p.G1513fs 1 38 [ Briggs CE, et al. 19 ND False-negative in NGS in patient 38 31 c.4577C>T p.T1526M 1 39 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.910 No change ND db SNP (rs61750152) 33 c.4685T>C p.I1562T 1 71 [ [ Yatsenko, et al. 13 Tol. NA PRD 0.783 No change ND Benign 33 c.4715C>T p.T1572M 1 79 [ [ Pang CP and Lamm DS 23 Del. 0.02 B 0.326 No change ND db SNP (rs185093512) Benign 35 c.4926C>G p.S1642R 1 40 [ [ Birch DG, et al. 22 Tol. 0.68 B 0.116 No change ND db SNP (rs61753017) 35 c.4956T>G p.Y1652* 1 41 [ [ Fumagalli A, et al. 16 ND db SNP (rs61750561) IVS35 c.5018&#fe;2T>C Splice site 1 42 [ [ APEX Don. 81.2 54.3 WT site broken (33.07) ND 36 c.5113C>T p.R1705W 1 7 [ Ernest PJ, et al. 26 Del. NA PRD 0.996 Don. 46.5 73.3 No change ND IVS38 c.5461-10T>C 8 43, 44, 45, 46, 47, 48, 49, 50 [ [ Briggs CE, et al. 19 No change 3/13006 db SNP (rs1800728) IVS39 c.5585-1G>A Splice site 1 51 [ [ Shroyer NF, et al. 21 Acc. 86.3 57.4 WT site broken (33.53) ND IVS40 c.5714&#fe;5G>A Splice site 1 52 [ [ Cremers FP, et al. 8 Don. 85.5 73.3 Wild type site broken (14.23) ND 42 c.5882G>A p.G1961E 7 53, 54, 55, 56, 57, 58, 59 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.998 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T p.L2027F 4 60, 61, 62, 63 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 1.000 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A p.R2030Q 1 64 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.995 No change 8/13006 db SNP (rs61750641) 46 c.6320G>A p.R2107H 2 72, 73 [ [ Fishman GA, et al. 15 Del. 0.04 PRD 0.999 No change 91/13006 db SNP (rs62642564) Benign 47 c.6445C>T p.R2149* 1 65 [ [ Lewis RA, et al. 14 1/13006 db SNP (rs61750654) 48 c.6529G>A p.D2177N 1 19 [ Rivera A, et al. 17 Tol. 0.41 B 0.004 No change 116/13006 db SNP (rs1800555) Benign 48 c.6709A>C p.T2237P 1 66 [ [ APEX Del. NA POD 0.719 No change ND IVS48 c.6729&#fe;4_ &#fe;18del AGTTGGCCCTGGGGC Splice site 1 17 [ Littink KW, et al. 28 NA ND Splice-site alteration (described as splice site) includes the change expected to affect splicing, for example, when the splice donor or splice acceptor site is changed, and the change that might affect splicing, for example, changes close to the splice donor or splice acceptor site, or in the first or last nucleotide of an exon. SIFT (version 4.0.4) results are reported to be tolerant if tolerance index is ߥ0.05 or deleterious if tolerance index is <0.05.
X
ABCA4 p.Leu2027Phe 23982839:63:1296
status: NEW
Login to comment

PMID: 24071957 [PubMed] Duncker T et al: "Distinct characteristics of inferonasal fundus autofluorescence patterns in stargardt disease and retinitis pigmentosa."
No. Sentence Comment
51 Summary of Demographic, Clinical, and Genetic Data Patient Condition ABCA4 Mutations Sex Age, y Eye Iris Color Race/Ethnicity BCVA Snellen (logMAR) P1 STGD1 p.P1380L, p.G1961E M 12 OS Blue White 20/100 (0.70) P2 STGD1 p.P1380L, p.G1961E F 17 OS Brown White 20/150 (0.88) P3 STGD1 p.Q1003X, p.G1961E M 25 OS Brown White 20/40 (0.30) P4 STGD1 p.C54Y F 48 OD Blue White 20/30 (0.20) P5 STGD1 p.R2077W F 52 OD Blue White 20/40 (0.30) P6 STGD1 p.[L541P;A1038V] M 13 OS Brown White 20/150 (0.88) P7 STGD1 p.T972N, p.L2027F F 14 OS Blue White 20/80 (0.60) P8 STGD1 c.4537_4538insC, p.V1686M M 49 OS Brown White 20/50 (0.40) P9 STGD1 p.R1108H, p.P1380L M 50 OS Blue White 20/200 (1.00) P10 STGD1 c.5714&#fe;5G>A F 34 OD Blue White 20/200 (1.00) P11 STGD1 p.Q636H, p.G1961E M 46 OD Brown Indian 20/400 (1.30) P12 STGD1 c.5461-10T>C M 35 OD Brown Black 20/400 (1.30) P13 STGD1 p.R1640W F 20 OD Brown Black 20/125 (0.80) P14 STGD1 p.R290W M 47 OS Brown White 20/40 (0.30) P15 STGD1 p.A1773V, p.G1961E M 18 OD Brown White 20/150 (0.88) P16 AD RP p.T17M* F 23 OD Brown Hispanic 20/30 (0.20) P17 AD RP N/A M 39 OS Brown White 20/20 (0.00) P18 AR RP N/A M 50 OS Green White 20/20 (0.00) AD, autosomal dominant; AR, autosomal recessive; BCVA, best corrected visual acuity; F, female; logMAR, logarithm of the minimum angle of resolution; M, male; N/A, not available.
X
ABCA4 p.Leu2027Phe 24071957:51:510
status: NEW
Login to comment

PMID: 24265018 [PubMed] Fujinami K et al: "A longitudinal study of Stargardt disease: quantitative assessment of fundus autofluorescence, progression, and genotype correlations."
No. Sentence Comment
131 Four of eight patients from eight families harboring the missense variant p.Leu2027Phe had small central atrophy (<0.18 mm2 ) at baseline (Supplementary Table S1).
X
ABCA4 p.Leu2027Phe 24265018:131:76
status: NEW
Login to comment

167 Consistent with previous reports, four of nine patients with the c.5461-10 T>C variant had a severe phenotype, with multiple large areas of atrophy.9,33,55,56 In contrast, there were three patients with the c.5461-10 T>C variant with a lower atrophy enlargement, all of whom also harbored missense variants (p.Gly1961Glu in one patient, and p.Leu2027Phe in the remaining two subjects); considered to be associated with a milder phenotype.2,10,54,56,57 The substitutions p.Leu2027Phe, and to a greater extent p.Gly1961Glu, also were associated with a milder AF phenotype in our study.
X
ABCA4 p.Leu2027Phe 24265018:167:343
status: NEW
X
ABCA4 p.Leu2027Phe 24265018:167:472
status: NEW
Login to comment

PMID: 24550365 [PubMed] Huang WC et al: "Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations."
No. Sentence Comment
74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized.
X
ABCA4 p.Leu2027Phe 24550365:74:1472
status: NEW
Login to comment

PMID: 24677105 [PubMed] Burke TR et al: "Quantitative fundus autofluorescence in recessive Stargardt disease."
No. Sentence Comment
47 In some cases where no mutations were detected by the array, or in more recently recruited patients, the next generation sequencing of the entire ABCA4 open reading frame and adjacent intronic sequences was performed on the Roche 454 platform.30 The four most common mutations found in six or more patients were: G1961E (12 patients from 11 families); L541P/ A1038V (eight patients from five families); L2027F (six patients from five families); and P1380L (six patients from six families).
X
ABCA4 p.Leu2027Phe 24677105:47:403
status: NEW
Login to comment

80 [L541P; A1038V] 356 354 1.7 1.8 5 F 14 1 0.60 0.60 II II p.L2027F; p.T972N 737 718 2.3 2.6 6 M 45 31 1.00 0.88 I I p.G1961E; p.P1380L 623 543 4.2 4.0 7 F 42 5 0.30 CF - I p.E1252* 557 2.1 8 M 15 4 0.80 0.80 II II p.L2027F; p.R2077W 728 697 3.2 3.2 9 F 24 2 0.60 0.40 II II p.R1161S 571 647 3.8 3.5 10 M 46 15 1.30 1.30 I I p.G1961E; p.Q636H 394 351 2.3 2.4 11.1 M 12 2 1.00 1.00 II - p.
X
ABCA4 p.Leu2027Phe 24677105:80:59
status: NEW
X
ABCA4 p.Leu2027Phe 24677105:80:215
status: NEW
Login to comment

82 [L541P; A1038V]; p.R1640W 850 4.4 12 F 27 9 1.30 1.00 - III p.P1380L; p.P1380L 577 4.8 13 F 39 8 0.12 0.00 - I c.250_251insCAAA 616 2.3 14 M 23 4 0.88 0.60 - II p.C54Y 535 5.1 15.1 M 49 17 1.00 0.88 I I p.Y1557C 646 604 4.1 3.9 15.2 M 46 7 0.10 0.48 I I p.Y1557C 456 508 2.6 2.3 16.1 F 27 14 0.88 0.88 III III p.L2027F; p.G851D 448 459 6.0 6.3 16.2 F 29 19 1.30 1.18 III III p.L2027F; p.G851D 538 569 7.4 7.9 17 M 22 18 1.30 1.00 III III p.P1380L; p.R2030Q 434 411 5.7 6.0 18 M 37 16 0.70 0.70 I I p.G1961E; p.G1961E 281 279 2.6 2.2 19 F 33 5 0.88 0.70 I I p.G1961E; c.4540-2A > G 412 420 2.5 2.8 20 F 26 12 0.60 0.60 - I p.G1961E; p.
X
ABCA4 p.Leu2027Phe 24677105:82:313
status: NEW
X
ABCA4 p.Leu2027Phe 24677105:82:378
status: NEW
Login to comment

84 [A854T; A1038V]; p.C2150Y 512 2.3 26 F 52 1 0.70 0.48 I - p.R212C 722 2.0 27 F 52 13 1.00 1.00 - I p.A1038V; p.A848D 459 4.1 28 M 20 5 0.30 0.40 I - p.L2027F; p.R1108H 507 2.3 29 M 23 7 1.00 1.00 I I p.G1961E; p.R2030Q 334 347 2.4 2.0 30 M 44 26 0.70 0.70 - II p.P1380L; p.R1108H 453 4.7 31 F 30 22 1.00 1.30 - I p.G1961E; c.6005&#fe;1G > T 428 2.3 32 M 12 8 0.40 0.40 I - p.W821R; p.C2150Y 306 2.0 33 F 20 9 0.88 0.88 III III p.R602W; p.M1882I 650 655 2.6 2.5 34 F 47 4 0.40 0.40 I - p.G1961E; p.R1129C 400 2.5 35 F 19 3 0.70 0.48 II II p.
X
ABCA4 p.Leu2027Phe 24677105:84:151
status: NEW
Login to comment

85 [L541P; A1038V]; p.L2027F 733 749 3.9 4.0 36 F 20 7 0.88 1.00 II II p.R1640W 571 552 3.4 3.8 37 F 12 3 0.80 0.80 I I p.R1108C; p.Q1412* 536 501 1.7 1.7 * All subjects were white, except for patients 10, 22, and 36 who were Indian, Hispanic, and black, respectively.
X
ABCA4 p.Leu2027Phe 24677105:85:19
status: NEW
Login to comment

135 Comparing each of the four most common mutations separately with healthy eyes, G1961E (P &#bc; 0.001); L541P/ A1038V (P < 0.001); L2027F (P < 0.001); and P1380L (P &#bc; 0.024) eyes had qAF8 that was significantly higher than in FIGURE 2.
X
ABCA4 p.Leu2027Phe 24677105:135:130
status: NEW
Login to comment

146 When corrected for age (P &#bc; 0.04) and sex (P &#bc; 0.004), compared with all other patients who did not have that particular mutation, the mutations L2027F (P &#bc; 0.009) and L541P/A1038V (P &#bc; 0.015) were associated with higher qAF8, while A1038V (when not in conjunction with L541P, P &#bc; 0.06); G851D (P &#bc; 0.006); and G1961E (P < 0.001) were associated with lower qAF8 in this sample.
X
ABCA4 p.Leu2027Phe 24677105:146:153
status: NEW
Login to comment

152 Genotype-Phenotype Relations (TF) When compared separately with healthy eyes, three of the four most common mutations, L541P/A1038V (P < 0.001); L2027F (P < 0.001); and P1380L (P &#bc; 0.001), had TF that was significantly higher than in healthy eyes, when corrected for age.
X
ABCA4 p.Leu2027Phe 24677105:152:145
status: NEW
Login to comment

180 The mutations were confirmed in six or more patients (G1961E, L541P/A1038V, L2027F, and P1380L) or in two to four patients (R1640W, Y1557C, G851D, and R2030Q).
X
ABCA4 p.Leu2027Phe 24677105:180:76
status: NEW
Login to comment

226 For example, based on our cross-sectional data, the mutations L2027F and L541P/A1038V seem to confer a faster rate of accumulation, whereas G1961E and G851D seems to confer a slower increase (Fig. 5).
X
ABCA4 p.Leu2027Phe 24677105:226:62
status: NEW
Login to comment

233 Additional missense mutations found to associate with elevated qAF8 compared with other mutations in our sample were L2027F and P1380L.
X
ABCA4 p.Leu2027Phe 24677105:233:117
status: NEW
Login to comment

234 The L2027F mutation causes an amino acid change in NBD-2 and confers reduced ATP binding.11,48 P1380L is also a severe mutation and is suggested to cause either impaired ATP binding11 or altered transport of ABCA4 protein across the outer segment membrane.46 When P1380L is carried in compound heterozygosity with R2077W, autosomal recessive cone-rod dystrophy results.49 When harbored as a homozygous mutation or as a compound heterozygous mutation with R2030Q or IVS40 &#fe; 5G>A, the mutation is associated with central atrophy and peripapillary disease, the latter being an uncommon phenotype.50 The missense mutation G1961E in exon 42 of the ABCA4 gene is the most common ABCA4 mutation.51 This sequence change results in a glycine to glutamate substitution within the NBD-2 of the protein.11,45 The G1961E allele always cosegregates with the disease in families.45,52 Nevertheless, the G1961E mutation in ABCA4 is perplexing since in an in vitro assay this mutation conferred a markedly aberrant decrease in all-trans-retinal stimulated ABCA4 ATPase activity,11 yet it is considered to be associated with mild disease.
X
ABCA4 p.Leu2027Phe 24677105:234:4
status: NEW
Login to comment

PMID: 24713488 [PubMed] Bertelsen M et al: "Generalized choriocapillaris dystrophy, a distinct phenotype in the spectrum of ABCA4-associated retinopathies."
No. Sentence Comment
123 Summary of Detected Potential Pathogenic Variants (Known and Novel [in Bold Face]) Found in the ABCA4 Gene of Patients With Generalized Choriocapillaris Dystrophy Patient Method Mutation 1 Mutation 2 Nucleotide Protein Nucleotide Protein D513 NGS c.203C>T p.P68L c.2894A>G p.N965S D514 Microarray, NGS c.2894A>G p.N965S c.5461-10T>C - D516 NGS c.4926C>G p.S1642R c.5041_5055del p.V1681_C1685del D517 NGS c.5169C>G p.Y1723* c.6079C>T p.L2027F D137 Microarray, NGS c.2894A>G p.N965S c.2894A>G p.N965S D801 Microarray, NGS c.6386&#fe;1G>A Aberrant splicing c.4234C>T p.Q1412* D109 Microarray c.2894A>G p.N965S c.4234C>T p.Q1412* D040 Microarray c.6229C>T p.R2077W c.6229C>T p.R2077W D159 Microarray c.3113C>T p.L541P/A1038V c.3113C>T p.L541P/A1038V D129 Microarray c.2894A>G p.N965S c.3322C>T p.R1108C D115 Microarray c.2894A>G p.N965S c.3113C>T p.L541P/A1038V D033 Microarray c.2894A>G p.N965S c.2041C>T p.R681* D023 Microarray c.203C>T p.P68L c.3329-2A>G Aberrant splicing D001 Microarray c.666_678del p.K223_R226delfs c.4667&#fe;2T>C Aberrant splicing D147 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D162 Microarray c.3329-2A>G Aberrant splicing c.6089G>A p.R2030Q D022 Microarray, HRM c.4462T>C p.C1488R c.4102C>T p.R1368C D112 Microarray, HRM c.2894A>G p.N965S c.1529T>G p.L510R D108 Microarray, HRM c.1648G>A p.G550R c.4102C>T p.R1368C D107 Microarray c.666_678del p.K223_R226delfs c.2588G>C p.G863A D070 Microarray c.2588G>C p.G863A c.2588G>C p.G863A D116 Microarray c.2300T>A p.V767D c.5461-10T>C - D135 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D117 Microarray, HRM c.3191-2A>G Aberrant splicing c.2408delG p.G803fs D186 Microarray, HRM c.3322C>T p.R1108C c.6386&#fe;1G>A Aberrant splicing D173 Microarray, HRM c.4469G>A p.C1490Y c.2915C>A p.T972N TABLE 3.
X
ABCA4 p.Leu2027Phe 24713488:123:435
status: NEW
Login to comment

124 In Silico Analysis of ABCA4 Variants Detected in This Study Using Alamut 2.2 Software cDNA Variant Protein Variant Effect on Protein Function AGVGD Class SIFT Prediction Effect on Protein PPH2 Prediction Effect on Protein TASTER Prediction Effect on Splicing Missense variants c.203C>T p.P68L C65 Deleterious Probably damaging Disease causing c.1529T>G p.L510R C65 Deleterious Benign Polymorphism c.1622T>C p.L541P Reduced ATP binding mislocali- zation26,27 C65 Deleterious Probably damaging Disease causing c.1648G>A p.G550R C65 Deleterious Possibly damaging Disease causing New acceptor site c.2300T>A p.V767D Reduced protein28 C65 Deleterious Benign Disease causing c.2588G>C p.G863A Reduced protein level, reduced ATP binding, reduced ATPase activity26 C55 Deleterious Possibly damaging Disease causing Predicted change at acceptor site 1 bp upstream: 11.1%, creating a new stronger acceptor 3 bp downstream c.2894A>G p.N965S Reduced ATP binding26 C45 Deleterious Probably damaging Disease causing New acceptor site c.2915C>A p.T972N C55 Deleterious Probably damaging Disease causing c.3113C>T p.A1038V Reduced ATP binding, reduced ATP hydrolysis26 C65 Deleterious Benign Disease causing c.3322C>T p.R1108C Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing c.4102C>T p.R1368C C65 Deleterious Probably damaging Disease causing c.4462T>C p.C1488R C65 Deleterious Possibly damaging Disease causing c.4469G>A p.C1490Y Misfolding, mislocali- zation27 C65 Deleterious Probably damaging Disease causing Cryptic donor strongly activated c.4926C>G p.S1642R C25 Deleterious Benign Disease causing c.6079C>T p.L2027F Reduced ATP binding26,29 C15 Deleterious Probably damaging Disease causing c.6089G>A p.R2030Q C35 Deleterious Probably damaging Disease causing c.6229C>T p.R2077W Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing Deletion/frame-shift/stop variants c.666_678del p.K223_ R226delfs c.2041C>T p.R681* c.2408delG p.G803fs c.4234C>T p.Q1412* c.5041_5055del p.V1681_ C1685del c.5169C>G p.Y1723* Splicing affecting variants c.3191-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.3329-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.4667&#fe;2T>C Predicted change at donor site 2 bps upstream: 100% generalized choriocapillaris dystrophy have the occasional hallmarks of early Stargardt disease, such as vermillion fundus, fundus hyperautofluorescence, and a dark choroid on fluorescein angiograms.
X
ABCA4 p.Leu2027Phe 24713488:124:1626
status: NEW
Login to comment

PMID: 25139735 [PubMed] Lee W et al: "The external limiting membrane in early-onset Stargardt disease."
No. Sentence Comment
88 [L541P;A1038V] p.L2027F P7 8 Caucasian n/a n/a 1 n/a ND p.
X
ABCA4 p.Leu2027Phe 25139735:88:17
status: NEW
Login to comment

89 [L541P;A1038V] p.L2027F P8 10 Caucasian 20/40 (0.30) 20/80 (0.60) 1 1 None-early 1 p.R1108C p.Q1412* P9 14 Caucasian 20/100 (0.70) 20/100 (0.70) 2 1 Early-late 0.5 p.T972N p.L2027F P10 9 Caucasian 20/150 (0.88) 20/400 (1.30) 2 1 Late ND c.5312&#fe;1G>A p.R2030* P11 15 Caucasian 20/200 (1.00) 20/200 (1.00) 2 2 Mid-late 3 p.L2027F p.R2077W P12 5 Caucasian 20/30 (0.18) 20/40 (0.30) 1 n/a ND c.5018&#fe;2T>C p.G1961E P13 10 Caucasian 20/200 (1.00) 20/200 (1.00) 2 2 Mid 4 p.
X
ABCA4 p.Leu2027Phe 25139735:89:17
status: NEW
X
ABCA4 p.Leu2027Phe 25139735:89:174
status: NEW
X
ABCA4 p.Leu2027Phe 25139735:89:324
status: NEW
Login to comment

92 [L541P;A1038V] p.L2027F P19 16 Caucasian 20/150 (0.88) 20/150 (0.88) 1 n/a Early 6 p.G863A p.
X
ABCA4 p.Leu2027Phe 25139735:92:17
status: NEW
Login to comment

PMID: 25342616 [PubMed] Duncker T et al: "Correlations among near-infrared and short-wavelength autofluorescence and spectral-domain optical coherence tomography in recessive Stargardt disease."
No. Sentence Comment
90 [L541P;A1038V] p.L2027F 4 13 19.7 M White Brown 0.9 0.9 p.G1961E p.
X
ABCA4 p.Leu2027Phe 25342616:90:17
status: NEW
Login to comment

PMID: 26024107 [PubMed] Greenstein VC et al: "Near-infrared autofluorescence: its relationship to short-wavelength autofluorescence and optical coherence tomography in recessive stargardt disease."
No. Sentence Comment
74 Selected Demographic, Clinical, and Genetic Characteristics of the Study Cohort Patient Sex Disease-Associated ABCA4 Variant(s) Age Eye BCVA 1 F p.G1961E; c2382&#fe;1G>A 36 OS 0.8 2 M p.[L541P;A1038V] 8 OS 0.6 3 M p.G1961E; c.6729&#fe;5_&#fe;19del 18 OS 0.9 4 M p.P1380L; p.G1961E 12 OD 0.8 5 M c.571-1G>T 43 OD 0.4 6 M p.Q1003*; p.G1961E 25 OS 0 7 M p.[L541P;A1038V]; p.L2027F 8 OD N/A 8 F p.R212C; p.G1961E 22 OD 0.8 9 F p.P1380L; p.G1961E 20 OD 0.9 10 M p.R1300*; p.R2106C 26 OS 0 11 M c.3050&#fe;5G>A; p.G1961E 27 OD 0.5 12 F p.G1961E; p.C2150R 25 OD 0.7 13 M p.W821R; p.C2150Y 13 OD 0.4 14 F p.N1799D 36 OD 1.3 15 M p.A1773V; p.G1961E 19 OD 0.7 FIGURE 1.
X
ABCA4 p.Leu2027Phe 26024107:74:371
status: NEW
Login to comment

PMID: 26230768 [PubMed] Sparrow JR et al: "Flecks in Recessive Stargardt Disease: Short-Wavelength Autofluorescence, Near-Infrared Autofluorescence, and Optical Coherence Tomography."
No. Sentence Comment
48 [IVS15&#fe;1G>A 2 M 12.00 Caucasian 0.5 0.5 p. [L541P; A1038V] 3* M 9.00 Caucasian 1 1 p. [W855*]; [T1526M] 4 F 47.55 Caucasian 1.3 1.3 p. [L541P; A1038V]; [G1961E] 5* F 16.47 Caucasian 0.6 0.6 p. [T972N]; [L2027F] 6* M 16.98 Caucasian 1.3 1.3 p. [K346T]; [T1117I] 7 F 23.80 Caucasian 0.6 0.4 p. [R1161S] 8* F 28.67 Caucasian 1.3 1.3 p. [P1380L]; [P1380L] 9 M 42.83 Caucasian 0.9 0.4 c.
X
ABCA4 p.Leu2027Phe 26230768:48:207
status: NEW
Login to comment

49 [571-1G>T 10* M 13.89 Caucasian 0.4 0.4 p. [L541P; A1038V]; [L2027F] 11* F 20.20 Caucasian 0.9 0.9 p. [P1380L]; [G1961E] 12 M 27.61 African-Arab 0 0 p. [R1300*]; [R2106C] 13* M 46.93 Caucasian 0.3 0.4 p. [C1490Y]; [G1961E] 14* M 26.82 Caucasian 0 0 c.
X
ABCA4 p.Leu2027Phe 26230768:49:61
status: NEW
Login to comment

PMID: 26551331 [PubMed] Duncker T et al: "Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers."
No. Sentence Comment
28 [L541P;A1038V] 0.10 0.10 OS n/a 141 S2.2 F 44.4 Indian Mother c.6729&#fe;5_&#fe;19del 0.10 0.00 OS 257 291 S2.3 M 56.2 Indian Father p.G1961E 0.00 0.00 OD 475 431 S3.4 F 54.1 White Mother p.G863A 0.00 0.00 OS 459 451 S3.5 F 82.0 White Grandmother p.G863A 0.00 0.00 OD n/a n/a S4.2 F 44.6 White Mother p.W855* 0.00 0.00 OD 330 n/a S4.3 M 40.9 White Father p.T1526M 0.00 0.00 OS 283 271 S5.2 F 71.5 White Sister p.C698Y 0.00 0.10 OD n/a n/a S5.3 F 67.5 White Sister c.2160&#fe;1G>C 0.00 0.00 OS n/a n/a S5.4 F 62.9 White Sister p.C698Y 0.00 0.00 OD n/a n/a S6.2 M 54.9 Black Brother p.T1526M 0.10 0.00 OS 477 423 S7.2 F 48.9 White Mother c.5196&#fe;1G>A 0.00 0.00 OS 443 415 S8.2 F 59.6 White Mother p.K346T 0.00 0.00 OD 546 483 S8.3 M 54.6 White Father p.T1117I 0.10 0.10 OD 289 n/a S9.2 F 51.5 White Mother c.5196&#fe;1137G>A 0.00 0.00 n/a 302 n/a S9.3 M 57.8 White Father p.C54Y 0.00 0.00 OS 419 375 S10.2 M 24.1 Indian Brother p.Q2220* 0.00 0.00 OD 227 227 S11.2 F 40.0 Asian Mother c.5923del 0.00 0.18 OD 229 191 S11.3 M 40.1 Asian Father p.R408* 0.00 0.00 OD 195 178 S12.2 F 53.2 White Mother p.L2027F 0.00 0.00 n/a 355 309 S13.2 F 49.8 White Mother p.R1161S 0.00 0.00 OS 367 372 S13.3 M 22.3 White Brother p.R1161S 0.00 0.00 OD 202 206 S14.2 F 67.0 White Mother p.P1380L 0.00 0.00 OD n/a n/a S14.3 F 24.4 White Sister p.P1380L 0.00 0.00 OS n/a 163 S15.3 F 26.8 White Sister c.3050&#fe;5G>A 0.00 0.00 n/a 293 281 S16.2 M 53.7 Black Father c.4253&#fe;5G>T 0.00 0.00 n/a n/a 204 S17.2 F 60.0 Hispanic Mother p.A1038V 0.00 0.00 n/a 247 n/a S18.2 F 41.8 Indian Father c.5917del 0.00 0.00 OD n/a 194 S18.3 M 48.6 Indian Mother c.859-9T>C 0.00 0.00 OD 253 215 S18.4 F 12.9 Indian Sister c.5917del 0.00 0.00 OD 84 93 S19.4 F 58.5 White Mother p.L2027F 0.00 0.00 OD 205 n/a S19.5 M 61.6 White Father p.G851D 0.10 0.10 OD n/a n/a S20.2 F 41.5 White Mother c.5312&#fe;1G>A 0.00 0.00 n/a 335 351 S20.3 M 39.0 White Father p.R2030* 0.00 0.10 n/a 442 n/a S21.3 F 53.1 White Mother p.G1961E 0.00 0.00 OD 490 488 S22.3 M 46.3 White Father p.L2027F 0.00 0.00 OS 386 376 S22.4 F 47.1 White Mother p.
X
ABCA4 p.Leu2027Phe 26551331:28:1099
status: NEW
X
ABCA4 p.Leu2027Phe 26551331:28:1742
status: NEW
X
ABCA4 p.Leu2027Phe 26551331:28:2030
status: NEW
Login to comment

68 [66G>A;859-9T>C] p.Q2220* CF 1.30 n/a n/a P 11.1 M 15.0 Asian p.R408* c.5935del 1.10 1.30 n/a n/a P 12.1&#a7; M 15.1 White p.L2027F p.R2077W 0.80 0.80 728 697 P 13.1&#a7; F 23.8 White p.R1161S 0.60 0.40 571 647 P 14.1&#a7; F 27.3 White p.P1380L p.P1380L 1.30 1.00 n/a 577 P 15.1 M 17.0 White p.G1961E c.3050&#fe;5G>A 0.88 0.88 n/a n/a P 15.2 F 22.0 White p.G1961E c.3050&#fe;5G>A 0.88 0.88 n/a n/a P 16.1 F 19.1 Black p.V989A c.4253&#fe;5G>T 0.30 0.40 97 n/a P 17.1 F 21.8 Hispanic p.A1038V p.G1441D 0.70 0.88 551 528 P 18.1 M 22.0 Indian c.859-9T>C c.5917del 0.88 0.88 527 n/a P 19.1&#a7; F 27.2 White p.G851D p.L2027F 0.88 0.88 448 459 P 19.2&#a7; F 29.2 White p.G851D p.L2027F 1.30 1.18 538 569 P 19.3 F 34.2 White p.G851D p.L2027F 1.00 1.30 442 n/a P 20.1 F 9.5 White c.5312&#fe;1G>A p.R2030* 0.88 0.70 998 929 P 21.1ߤ F 24.6 White p.N96D p.G1961E 0.30 0.18 513 549 P 21.2ߤ F 20.9 White p.N96D p.G1961E 0.30 0.40 397 355 P 22.1 M 8.0 White p.
X
ABCA4 p.Leu2027Phe 26551331:68:125
status: NEW
X
ABCA4 p.Leu2027Phe 26551331:68:613
status: NEW
X
ABCA4 p.Leu2027Phe 26551331:68:673
status: NEW
X
ABCA4 p.Leu2027Phe 26551331:68:728
status: NEW
Login to comment

69 [L541P;A1038V] p.L2027F n/a n/a P 22.2 M 13.9 White p.
X
ABCA4 p.Leu2027Phe 26551331:69:17
status: NEW
Login to comment

70 [L541P;A1038V] p.L2027F 0.30 0.40 591 608 P 23.1ߤ F 26.0 White p.G1961E c.5196&#fe;1056A>G 0.40 0.70 379 344 P 24.1 F 52.0 White c.247_250dup 0.80 0.00 n/a n/a P 25.1 F 26.0 Black p.E526A p.R2107H 0.48 0.00 507 536 P 25.2 F 25.9 Black p.E526A p.R2107H 0.18 0.00 461 468 P 26.1&#a7; F 25.6 White p.
X
ABCA4 p.Leu2027Phe 26551331:70:17
status: NEW
Login to comment

111 [L541P; A1038V] in six carriers, p.P1380L in four carriers, and p.L2027F in three carriers.
X
ABCA4 p.Leu2027Phe 26551331:111:66
status: NEW
Login to comment

124 [L541P; A1038V], p.L2027F.
X
ABCA4 p.Leu2027Phe 26551331:124:19
status: NEW
Login to comment

137 [L541P; A1038V], p.P1380L, and p.L2027F mutations (and no p.G1961E mutation on the other allele).24 To determine whether similar differences in the segregation of qAF8 levels could also be observed for ABCA4 mutations in carriers and whether specific ABCA4 mutations may be associated with higher qAF8 levels, we plotted qAF values for carriers and affected patients who carried one of the four most common mutations (p.G1961E, p.
X
ABCA4 p.Leu2027Phe 26551331:137:33
status: NEW
Login to comment

138 [L541P;A1038V], p.P1380L, and p.L2027F) (Fig. 4).
X
ABCA4 p.Leu2027Phe 26551331:138:32
status: NEW
Login to comment

163 [L541P; A1038V], p.P1380L, and p.L2027F, are indicated in color.
X
ABCA4 p.Leu2027Phe 26551331:163:33
status: NEW
Login to comment

169 Nevertheless, we concluded that based on qAF values (measured at an eccentricity of 78-98), the mutations p.L2027F and p.P1380L and the complex allele p.
X
ABCA4 p.Leu2027Phe 26551331:169:108
status: NEW
Login to comment

196 Thickness profiles acquired by segmentation of spectral-domain optical coherence tomography (SD-OCT) images of carriers of ABCA4 mutations p.G1961E, p.L541P/A1038V, p.P1380L, and p.L2027F.
X
ABCA4 p.Leu2027Phe 26551331:196:181
status: NEW
Login to comment