ABCMdb

ABCA1 p.Thr774Pro

None has been submitted yet.

Publications

PMID: 19596329 [PubMed] Frikke-Schmidt R et al: "Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population."

No. Sentence Comment

2338 The remaining non-synonymous mutations (S364C, T774P, and K776N), ranging in frequency from 0.1 to four per 1000, were not associated with low HDL cholesterol levels [65,66]. Login to comment

PMID: 18523221 [PubMed] Frikke-Schmidt R et al: "Association of loss-of-function mutations in the ABCA1 gene with high-density lipoprotein cholesterol levels and risk of ischemic heart disease."

No. Sentence Comment

26 The 9022 individuals were genotyped for all non-synonymous mutations (S364C, T774P, K776N, P1065S, G1216V, N1800H, R2144X [http://www.hgmd.cf.ac.uk/ac /index.php; http://www.mutdb.org]), which were previously identified by resequencing the promoter, coding region,andconsensussplicesitesofABCA1 in 190 individuals of Danish ancestry with high and low HDL cholesterol levels.13 All end points and data collection were recorded in the follow-up period of January 1, 1976, through July 9, 2007. Login to comment
70 reductions in levels of HDL cholesterol in plasma in heterozygotes vs noncarriers in the CCHS as well as in the CGPS, while 3 were not (S364C, T774P, K776N). Login to comment
25 The 9022 individuals were genotyped for all nonsynonymous mutations (S364C, T774P, K776N, P1065S, G1216V, N1800H, R2144X [http://www.hgmd.cf.ac.uk/ac /index.php; http://www.mutdb.org]), which were previously identified by resequencing the promoter, coding region,andconsensussplicesitesofABCA1 in 190 individuals of Danish ancestry with high and low HDL cholesterol levels.13 All end points and data collection were recorded in the follow-up period of January 1, 1976, through July 9, 2007. Login to comment
54 LOSS-OF-FUNCTION MUTATIONS IN THE ABCA1 GENE AND RISK OF ISCHEMIC HEART DISEASE 2528 reductions in levels of HDL cholesterol in plasma in heterozygotes vs noncarriers in the CCHS as well as in the CGPS, while were not (S364C, T774P, K776N). Login to comment

PMID: 16806540 [PubMed] Saleheen D et al: "A novel haplotype in ABCA1 gene effects plasma HDL-C concentration."

No. Sentence Comment

80 R219K, V399A and T774P polymorphisms followed the HWE however V825L and V771M showed a departure from HWE. Login to comment
83 Similarly, T774P showed high LD with V825L (DV=0.70; P-value<10À3 ). Login to comment
87 D. Saleheen et al. / International Journal of Cardiology 115 (2007) 7-13 9 polymorphism was in complete linkage equilibrium with T774P, V825L and V771M polymorphisms. Login to comment
97 South Asian populations (from Pakistan, India, Bangladesh and Sri Lanka) represent a quarter of the developing world and harbor thirty percent of the global Table 4 Haplotype association analysis of the ABCA1 gene polymorphisms in relation with the HDL-C levels Haplotype Haplotype frequencies Haplotypic additive effects [95% CI] P-value R219K RV 0.47 + V825L RL 0.18 À0.12 [À0.22 to À0.03] 0.001 KV 0.28 À0.04 [À0.10 to 0.01] 0.15 KL 0.06 0.08 [À0.06 to 0.22] 0.25 T774P TV 0.21 0.03 [À0.05 to 0.12] 0.41 V825L TL 0.09 0.10 [À0.06 to 0.27] 0.22 PV 0.47 + PL 0.21 À0.06 [À0.14 to 0.02] 0.15 R219K RM 0.55 + V771M RV 0.07 À0.13 [À0.45 to 0.19] 0.41 KM 0.34 À0.02 [À0.09 to 0.05] 0.54 KV 0.04 0.07 [À0.12 to 0.27] 0.46 Table 3 Mean HDL-C levels (S.D.) for the genotypes and alleles of the studied polymorphisms Frequencies HDL-C (S.D.) b (95% CI) P-value R219K RR 39.8 1.06 (0.30) À0.02 (À0.16 to 0.13) 0.85 RK 46.0 1.10 (0.28) 0.00 (À0.14 to 0.14) 0.99 KK 14.3 1.10 (0.31) + R 62.7 1.08 (0.26) 0.01 (À0.05 to 0.07) 0.79 K 37.3 1.09 (0.31) V399A AA 6.0 1.01 (0.23) À0.03 (À0.24 to 0.16) 0.70 AV 34.7 1.11 (0.28) 0.10 (À0.04 to 0.16) 0.22 VV 59.3 1.04 (0.31) + A 23.3 1.09 (0.28) À0.03 (À0.10 to 0.05) 0.58 V 76.7 1.04 (0.31) T774P PP 9.6 1.10 (0.31) 0.20 (0.01 to 0.40) 0.03 PT 37.5 1.03 (0.32) 0.13 (À0.03 to 0.20) 0.14 TT 52.9 0.97 (0.28) + P 28.4 1.05 (0.32) À0.15 (À0.18 to À0.02) 0.01 T 71.6 0.99 (0.29) V771M MM 6.1 1.09 (0.30) 0.01 (À0.24 to 0.25) VM 10.1 0.98 (0.24) À0.07 (À0.27 to 0.12) 0.46 VV 83.8 1.07 (0.29) + 0.94 M 11.1 1.04 (0.27) 0.03 (À0.10 to 0.15) 0.71 V 88.9 1.07 (0.29) V825L LL 9.8 0.89 (0.299) À0.17 (À0.32 to À0.19) 0.02 LV 32.8 1.06 (0.265) À0.03 (À0.11 to 0.076) 0.70 VV 57.5 1.07 (0.30) + L 26.1 1.07 (0.29) 0.10 (À0.00 to .13) 0.05 V 73.9 1.00 (0.28) P-values are adjusted for age and gender. Login to comment

PMID: 16429166 [PubMed] Brunham LR et al: "Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene."

No. Sentence Comment

48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment

PMID: 16226177 [PubMed] Frikke-Schmidt R et al: "Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population."

No. Sentence Comment

94 tion (T774P, allele frequency 0.004) situated, respectively, five and two amino acids N-terminal of the K776 residue, have been reported. Login to comment
92 tion (T774P, allele frequency 0.004) situated, respectively, five and two amino acids N-terminal of the K776 residue, have been reported. Login to comment

PMID: 12763760 [PubMed] Singaraja RR et al: "Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene."

No. Sentence Comment

136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment

PMID: 12840658 [PubMed] Miller M et al: "Genetics of HDL regulation in humans."

No. Sentence Comment

66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.] Login to comment

PMID: 11238261 [PubMed] Clee SM et al: "Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease."

No. Sentence Comment

44 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment
48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
132 Carriers of V399A had half the frequency of a positive family history of CAD (22.2% versus 49.4%, Pϭ0.18) and trends toward an increased baseline MOD (Table 6) and less progression in MSD (-0.05Ϯ0.10 versus 0.08Ϯ0.19 mm in noncarriers, Pϭ0.16) during the trial. Login to comment
137 Carriers of the other 3 rare variants (T774P, K776N, and E1172D) showed no significant differences in lipid levels or CAD compared with their respective noncarriers (Table 6). Login to comment
156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D. Login to comment
161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n). Login to comment
186 Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident. Login to comment
191 Similarly, the region containing the V771M, T774P, and K776N variants is unlikely to be critical to ABCA1 function, because a high degree of polymorphism is tolerated without functional effects. Login to comment
39 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment