ABCMdb

ABCC2 p.Val1188Glu

Predicted by SNAP2:	A: N (61%), C: N (57%), D: D (59%), E: N (72%), F: D (59%), G: D (59%), H: D (63%), I: N (53%), K: D (53%), L: D (53%), M: N (53%), N: N (53%), P: D (75%), Q: N (53%), R: D (63%), S: N (61%), T: N (66%), W: D (91%), Y: D (80%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment
148 Furthermore, both non-synonymous SNPs, 3563T>C (Val1188Glu) and 4544G>A (Cys1515Tyr), in combination with an ABCC1 SNP were associated with anthracycline-induced cardiotoxicity (Wojnowski et al., 2005). Login to comment

[hide] Pharmacogenetics of intestinal absorption. Curr Drug Deliv. 2008 Jul;5(3):153-69. Nakamura T, Yamamori M, Sakaeda T
Pharmacogenetics of intestinal absorption.
Curr Drug Deliv. 2008 Jul;5(3):153-69., [PMID:18673259]

Abstract [show]
The small intestine is the primary site of absorption for many drugs administered orally and so is the target tissue for pharmacotherapeutic strategies to control the oral absorption of drugs. Drug transporters, including the ATP-binding cassette (ABC) superfamily and the solute carrier (SLC) superfamily, have been considered to play a physiological role in regulating the absorption of xenobiotics, and variations in their expression level and function in the small intestine cause intra- and inter-individual variation in the oral absorption of drugs. Recent advances in molecular biology have suggested that genetic polymorphisms are associated with the expression level and function, and thereby inter-individual variation. In this review, the pharmacogenetics of these transporters is summarized, and their future significance in the clinical setting is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 In Vitro Studies Associated with Common SNPs of Drug Transporter Genes Exon Polymorphism Effect dbSNP Cell Expression Function Reference ABCC2 Exon 1 -24C>T 5`-UTR rs717620 116A>T Tyr2Phe rs927344Exon 2 159A>G synonymous rs17222596 Exon 7 736A>C Met246Leu rs17222744 Exon 8 998A>G Asp333Gly rs17222674 Exon 9 1058G>A Arg353His rs7080681 1219C>T synonymous rs17216198 1249G>A Val417Ile rs2273697 LLC-PK1 Protein (n.s.) Membrane localization (n.s.) Transport activity (n.s.) Hirouchi et al. [51] 1434G>T synonymous 1434G>A synonymous rs4267009 Exon 10 1457C>T Thr486Ile rs17222589 Exon 11 1483A>G Lys495Glu rs17222561 Exon 13 1686T>G Phe562Leu rs17216233 2009T>C Ile670Thr rs17222632Exon 16 2073C>A synonymous rs17222624 Exon 17 2153A>G Asn718Ser rs3740072 Exon 19 2546T>G Leu849Arg rs17222617 Exon 20 2677G>C Glu893Gln rs3740071 2901C>A Tyr967stop rs17222547 2934G>A synonymous rs3740070 Exon 22 2944A>G Ile982Val rs17222554 3107T>C Ile1036Thr rs17216149Exon 23 3188A>G Asn1063Ser rs17222540 Exon 24 3396T>C synonymous rs17216345 3542G>T Arg1181Leu rs8187692 3561G>A synonymous rs17216324 Exon 25 3563T>A Val1188Glu rs17222723 Exon 27 3817A>G Thr1273Ara rs8187699 3872C>T Pro1291Leu rs17216317 3895A>C Lys1299Gln rs4148400 3927C>T synonymous rs4148401 Exon 28 3972C>T synonymous rs3740066 4062C>T synonymous rs17216275Exon 29 4110C>T synonymous rs7899457 4242C>T synonymous rs17216296Exon 30 4290G>T synonymous rs1137968 4410G>A synonymous rs8187706Exon 31 4488C>T synonymous rs8187707 4527C>T synonymous rs8187709Exon 32 4544G>A Cys1515Tyr rs8187710 ABCG2 PA317 mRNA (n.s.) Protein (n.s.) Drug sensitivity (n.s.) Topotecan uptake (n.s.) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (impaired) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] Exon 2 34G>A Val12Met rs2231137 LLC-PK1 Apical localization (n.s.) . Login to comment
93 Exon Polymorphism Effect dbSNP Subject Expression Function Reference Exon 24 3396T>C synonymous rs17216345 3542G>T Arg1181Leu rs8187692 3561G>A synonymous rs17216324 3563T>A Val1188Glu rs17222723 Healthy (Finnish) Pravastatin PK (TT TA) Niemi et al. [48] HIV patient (Caucasian) Nelfinavir intracellular AUC (TT TA) Colombo et al. [58] Exon 25 Patient Acute anthracycline-induced cardiotoxicity (TT<TA) Chronic anthracycline-induced cardiotoxicity (TT TA) Wojnowski et al. [59] Exon 27 3817A>G Thr1273Ara rs8187699 3872C>T Pro1291Leu rs17216317 3895A>C Lys1299Gln rs4148400 3927C>T synonymous rs4148401 3972C>T synonymous rs3740066 Women undergoing cesarean section Placental mRNA (GG GA AA) Placental protein (GG GA AA) Meyer zu Schwabedissen et al. [52] DNT patient Tumoral protein (GG GA) Peritumoral protein (GG GA) Vogelgesang et al. [54] Patient 9-nitrocamptotecin PK and toxicity (CC CT TT) 9-aminocamptotecin PK and toxicity (CC CT TT) Zamboni et al. [55] Exon 28 Colorectal cancer patient (Japanese) Tumoral mRNA (CC CT TT) Drug sensitivity (CC CT TT) Tumor growth rate (CC CT TT) Nishioka et al. [57] 4062C>T synonymous rs17216275Exon 29 4110C>T synonymous rs7899457 4242C>T synonymous rs17216296Exon 30 4290G>T synonymous rs1137968 Exon 31 4410G>A synonymous rs8187706 4488C>T synonymous rs8187707 HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CT) Colombo et al. [58] 4527C>T synonymous rs8187709 4544G>A Cys1515Tyr rs8187710 Healthy (Finnish) Pravastatin PK (GG GA) Niemi et al. [48] HIV patient (Caucasian) Nelfinavir intracellular AUC (GG GA) Colombo et al. [58] Exon 32 Patient Acute anthracycline-induced cardiotoxicity (GG<GA) Chronic anthracycline-induced cardiotoxicity (GG GA) Wojnowski et al. [59] ABCG2 34G>A Val12Met rs2231137 Nasopharyngeal cancer patient Irinotecan PK (GG GA+AA) SN-38 PK (GG GA+AA) SN-38G PK (GG GA+AA) Zhou et al. [56] HIV patient (Caucasian) Nelfinavir intracellular AUC (GG GA) Colombo et al. [58] Exon 2 Patient (Japanese) Placental mRNA (GG GA AA) Placental protein (GG GA AA) Kobayashi et al. [91] (Table 3) contd…. Login to comment

[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]

Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96). Login to comment
212 [98] c.1446C>G T482T Bioavailability of pravastatin Increased [101] c.3563T>A V1188E Higher protein expression in liver Increased [102] c.3972C>T I1324I Intrahepatic cholestasis in pregnancy Decreased [103] c.4544G>A C1515Y Higher protein expression in liver Increased [102] composed of 655 amino acids (109). Login to comment

[hide] Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplot... Pharmacogenet Genomics. 2005 Sep;15(9):599-608. Colombo S, Soranzo N, Rotger M, Sprenger R, Bleiber G, Furrer H, Buclin T, Goldstein D, Decosterd L, Telenti A
Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo.
Pharmacogenet Genomics. 2005 Sep;15(9):599-608., [PMID:16041239]

Abstract [show]
OBJECTIVES: The human immunodeficiency virus protease inhibitor nelfinavir is substrate of polyspecific drug transporters encoded by ABCB1 (P-glycoprotein), ABCC1 (MRP1) and ABCC2 (MRP2), and an inhibitor of BCRP, encoded by ABCG2. Genetic polymorphism in these genes may be associated with changes in transport function. METHODS: A comprehensive evaluation of single nucleotide polymorphisms (39 SNPs in ABCB1, 7 in ABCC1, 27 in ABCC2, and 16 in ABCG2), and inferred haplotypes was done to assess possible associations of genetic variants with cellular exposure of nelfinavir in vivo. Analysis used peripheral mononuclear cells from individuals receiving nelfinavir (n=28). Key results were re-examined in a larger sample size (n=129) contributing data on plasma drug levels. RESULTS AND CONCLUSIONS: There was no significant association between cellular nelfinavir area under the curve (AUC) and SNPs or haplotypes at ABCC1, ABCC2, ABCG2. There was an association with cellular exposure for two loci in strong linkage disequilibrium: ABCB1 3435C>T; AUCTT>AUCCT>AUCCC (ratio 2.1, 1.4, 1, Ptrend=0.01), and intron 26 +80T>C; AUCCC> AUCCT > AUCTT (ratio 2.4, 1.3, 1, Ptrend=0.006). Haplotypic analysis using tagging SNPs did not improve the single SNP association values.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 - 24C > T exon 1 Itoda et al., 2002 mp-v-004 rs717620 IVS 6-30 G > T intron 6 Epidauros mp-v-051 rs8187666 c.842G > A exon 7 p.S281N Epidauros mp-v-115 c.998G > A intron 7 Epidauros mp-v-083 c.1219C > T exon 10 synonymous (p.L407L) Epidauros mp-v-007 rs8187669 c.1249G > A exon 10 p.V417I Itoda et al., 2002 mp-v-008 rs2273697 c.1346C > G exon 10 synonymous (p.T482T) Epidauros mp-v-114 c.1457C > T exon 10 p.T486I Epidauros mp-v-055 rs8187670 IVS 16 - 47 G > A intron 16 Epidauros mp-v-118 IVS 16 - 30 T > A intron 16 Epidauros mp-v-119 c.2153A > G exon 17 p.N718S Epidauros mp-v-093 rs3740072 c.2216T > C exon 17 p.L739P Epidauros mp-v-108 c.3449G > A exon 25 p.R1150H Mor-Cohen et al., 2001 mp-v-085 c.3517A > T exon 25 p.I1173F Keitel et al., 2003 mp-v-096 c.3521G > A exon 25 p.R1174H Epidauros mp-v-068 c.3542G > T exon 25 p.R1181L Epidauros mp-v-069 rs8187692 c.3563T > A exon 25 p.V1188E Epidauros mp-v-025 rs8187694 IVS 30 - 53 C > T intron 30 Epidauros mp-v-105 rs3824610 c.4348G > A exon 31 p.A1450T Suzuki et al. 2002 mp-v-106 c.4410G > A exon 31 synonymous (p.E1470E) Epidauros mp-v-077 rs8187706 c.4488C > T exon 31 synonymous (p.H1496H) Epidauros mp-v-038 rs8187707 IVS 31 + 12 G > A intron 31 Epidauros mp-v-039 rs8187708 IVS 31 + 74 C > T intron 31 Epidauros mp-v-040 IVS 31 - 9 T > C intron 31 Epidauros mp-v-042 c 4527C > T exon 32 synonymous (p.A1509A) Epidauros mp-v-048 rs8187709 c.4544G > A exon 32 p.C1515Y Epidauros mp-v-043 rs8187710 + 259 G > T 30 flanking Epidauros mp-v-120 Transporter polymorphisms and HIV treatment Colombo et al. 601 BCRP (ABCG2) g. Login to comment
102 - 24C > T rs717620 19 5 3 1 1.5 1.1 0.64 0.73 c.1249G > A (V417I) rs2273697 20 7 1 1 1.4 0.2 4.43 0.11 c.1346C > G NM_000392; c.1483C > G 26 1 1 0.6 1.34 0.25 IVS 16 - 47 G > A NC_000010; g.34448G > A 27 1 1 1.5 0.86 0.35 c.3563T > A (V1188E) rs8187694 23 4 1 1.1 0.07 0.78 c.4488C > T rs8187707 23 5 1 0.8 0.04 0.83 IVS 31 + 12G > A rs8187708 23 5 1 0.8 0.04 0.83 IVS 31 + 74C > T NC_000010; g.68057C > T 24 4 1 1.1 0.00 0.95 c.4544G > A (C1515Y) rs8187710 22 5 1 0.8 0.02 0.90 g. Login to comment

[hide] NAD(P)H oxidase and multidrug resistance protein g... Circulation. 2005 Dec 13;112(24):3754-62. Epub 2005 Dec 5. Wojnowski L, Kulle B, Schirmer M, Schluter G, Schmidt A, Rosenberger A, Vonhof S, Bickeboller H, Toliat MR, Suk EK, Tzvetkov M, Kruger A, Seifert S, Kloess M, Hahn H, Loeffler M, Nurnberg P, Pfreundschuh M, Trumper L, Brockmoller J, Hasenfuss G
NAD(P)H oxidase and multidrug resistance protein genetic polymorphisms are associated with doxorubicin-induced cardiotoxicity.
Circulation. 2005 Dec 13;112(24):3754-62. Epub 2005 Dec 5., 2005-12-13 [PMID:16330681]

Abstract [show]
BACKGROUND: A significant number of patients treated with anthracyclines develop cardiotoxicity (anthracycline-induced cardiotoxicity [ACT]), mainly presenting as arrhythmias (acute ACT) or congestive heart failure (chronic ACT). There are no data on pharmacogenomic predictors of ACT. METHODS AND RESULTS: We genotyped participants of the German non-Hodgkin lymphoma study (NHL-B) who were followed up for the development of heart failure for a median of >3 years. Single-nucleotide polymorphisms (SNPs) were selected from 82 genes with conceivable relevance to ACT. Of 1697 patients, 55 developed acute and 54 developed chronic ACT (cumulative incidence of either form, 3.2%). We detected 5 significant associations with polymorphisms of the NAD(P)H oxidase and doxorubicin efflux transporters. Chronic ACT was associated with a variant of the NAD(P)H oxidase subunit NCF4 (rs1883112, -212A-->G; symbols with right-pointing arrows, as edited?' odds ratio [OR], 2.5; 95% CI, 1.3 to 5.0). Acute ACT was associated with the His72Tyr polymorphism in the p22phox subunit (rs4673; OR, 2.0; 95% CI, 1.0 to 3.9) and with the variant 7508T-->A (rs13058338; OR, 2.6; 95% CI, 1.3 to 5.1) of the RAC2 subunit of the same enzyme. In agreement with these results, mice deficient in NAD(P)H oxidase activity, unlike wild-type mice, were resistant to chronic doxorubicin treatment. In addition, acute ACT was associated with the Gly671Val variant of the doxorubicin efflux transporter multidrug resistance protein 1 (MRP1) (OR, 3.6; 95% CI, 1.6 to 8.4) and with the Val1188Glu-Cys1515Tyr (rs8187694-rs8187710) haplotype of the functionally similar MRP2 (OR, 2.3; 95% CI, 1.0 to 5.4). Polymorphisms in adrenergic receptors previously demonstrated to be predictive of heart failure were not associated with ACT. CONCLUSIONS: Genetic variants in doxorubicin transport and free radical metabolism may modulate the individual risk to develop ACT.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 In addition, acute ACT was associated with the Gly671Val variant of the doxorubicin efflux transporter multidrug resistance protein 1 (MRP1) (OR, 3.6; 95% CI, 1.6 to 8.4) and with the Val1188Glu-Cys1515Tyr (rs8187694-rs8187710) haplotype of the functionally similar MRP2 (OR, 2.3; 95% CI, 1.0 to 5.4). Login to comment
132 The 2 missense mutations in MRP2, Val1188Glu (rs8187694) and Cys1515Tyr (rs8187710), yielded identical frequencies and relationships with acute ACT, as characterized by an OR of 2.3 (95% CI, 1.0 to 5.4). Login to comment
136 All associations except 1 (the Val1188Glu and Cys1515Tyr haplotype) were still significant when chronic cases were defined more conservatively (ejection fraction Ͻ45% instead of Ͻ50%). Login to comment
202 The 2 missense variants associating with ACT, Val1188Glu (rs8187694), and Cys1515Tyr (rs8187710), were initially described in the Japanese.48 No data on their functional significance have been published, and the specific variant relevant to doxorubicin treatment cannot be inferred from our results because of the 100% LD between the 2 missense mutations in our cohort. Login to comment

[hide] Impact of CYP2C8*3 on paclitaxel clearance: a popu... Pharmacogenomics J. 2011 Apr;11(2):113-20. Epub 2010 Apr 6. Bergmann TK, Brasch-Andersen C, Green H, Mirza M, Pedersen RS, Nielsen F, Skougaard K, Wihl J, Keldsen N, Damkier P, Friberg LE, Peterson C, Vach W, Karlsson MO, Brosen K
Impact of CYP2C8*3 on paclitaxel clearance: a population pharmacokinetic and pharmacogenomic study in 93 patients with ovarian cancer.
Pharmacogenomics J. 2011 Apr;11(2):113-20. Epub 2010 Apr 6., [PMID:20368717]

Abstract [show]
The primary purpose of this study was to evaluate the effect of CYP2C8*3 and three genetic ABCB1 variants on the elimination of paclitaxel. We studied 93 Caucasian women with ovarian cancer treated with paclitaxel and carboplatin. Using sparse sampling and nonlinear mixed effects modeling, the individual clearance of unbound paclitaxel was estimated from total plasma paclitaxel and Cremophor EL. The geometric mean of clearance was 385 l h(1) (range 176-726 l h(1)). Carriers of CYP2C8*3 had 11% lower clearance than non-carriers, P=0.03. This has not been shown before in similar studies; the explanation is probably the advantage of using both unbound paclitaxel clearance and a population of patients of same gender. No significant association was found for the ABCB1 variants C1236T, G2677T/A and C3435T. Secondarily, other candidate single-nucleotide polymorphisms were explored with possible associations found for CYP2C8*4 (P=0.04) and ABCC1 g.7356253C>G (P=0.04).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
135 This effect on clearance of a 'non-fixed` variable provides a competing and dynamic biological explanation for clearance that certainly should be Table 4 Clearance of unbound paclitaxel as function of observed genotypes Gene/allelea Effectb Reference homozygote Heterozygote Variant homozygote P-valuee SNP IDf Nc CLd (10th-90th) Nc CLd (10th-90th) Nc CLd (10th-90th) Candidate SNPs for confirmative analysis CYP2C8 1196A4G(*3) K399R 74 395 (297-490) 19 350 (238-458) 0.03* (0.04) rs10509681 ABCB1 1236C4T G412G 29 391 (270-569) 45 393 (299-490) 19 359 (291-437) 0.25 (0.25) rs1128503 2677G4T/Ag A893S/T 26 387 (270-490) 42(GT) 396 (299-490) 20(TT) 356 (294-437) 0.20 (0.26) rs2032582 3435C4T I1145I 11 403 (326-548) 44 387 (282-490) 38 378 (297-468) 0.83 (0.43) rs1045642 Candidate SNPs for exploratory analysis CYP2C8 792C4G(*4) I264M 86 391 (297-490) 7 321 (270-374) 0.04* (0.03) rs1058930 15577956G4T (*1B) - 49 395 (298-552) 43 373 (291-478) 1 461 0.75 (0.36) rs7909236 15578055A4C (*1C) - 69 382 (291-478) 24 393 (300-552) 0.48 (0.62) rs17110453 ABCB1 À1A4G - 1 458 29 396 (270-592) 63 379 (297-477) 0.56 (0.3) rs2214102 61A4G N21D 63 384 (282-490) 29 386 (298-478) 1 437 0.52 (0.77) rs9282564 1199G4A S400N 83 385 (291-490) 10 386 (322-461) 0.74 (0.99) rs2229109 CYP3A4 24616372T4C (*1B) - 85 383 (296-490) 7 397 (270-641) 0.67 (0.72) rs2740574 CYP3A5 219-237G4A Frameshift 84 388 (297-490) 9 360 (176-726) 0.30 (0.36) rs776746 SLCO1B3 699G4A M233I 1 326 19 377 (299-481) 73 388 (291-490) 0.99 (0.46) rs7311358 767G4C G256A 67 386 (298-481) 26 383 (291-490) 0.63 (0.89) rs60140950 CYP1B1 1294C4G (*3) V432L 30 389 (270-530) 36 401 (298-490) 27 361 (300-470) 0.77 (0.24) rs1056836 ABCC1 7356253C4G - 65 394 (297-548) 27 368 (291-470) 1 332 0.04* (0.15) rs504348 ABCC2 1249G4A V417I 67 381 (291-490) 24 396 (297-552) 2 415 (368-468) 0.21 (0.39) rs2273697 3563T4A V1188E 87 386 (296-490) 5 370 (176-569) 0.7 (0.7) rs17222723 4544G4A C1515Y 75 389 (296-490) 3 355 (176-569) 0.72 (0.52) rs8187710 ABCG2 421C4A Q141K 61 374 (291-478) 32 408 (315-548) 0.4 (0.09) rs2231142 34G4A V12M 87 385 (291-490) 4 395 (296-726) 0.68 (0.83) rs2231137 ABCC10 2759T4C I920T 46 386 (297-478) 43 386 (291-548) 4 373 (326-467) 0.88 (0.89) rs2125739 Abbreviations: CL, clearance of unbound paclitaxel; SNP, single-nucleotide polymorphism. Login to comment

[hide] Interindividual variability of canalicular ATP-bin... Hepatology. 2006 Jul;44(1):62-74. Meier Y, Pauli-Magnus C, Zanger UM, Klein K, Schaeffeler E, Nussler AK, Nussler N, Eichelbaum M, Meier PJ, Stieger B
Interindividual variability of canalicular ATP-binding-cassette (ABC)-transporter expression in human liver.
Hepatology. 2006 Jul;44(1):62-74., [PMID:16799996]

Abstract [show]
Interindividual variability in hepatic canalicular transporter expression might predispose to the development of hepatic disorders such as acquired forms of intrahepatic cholestasis. We therefore investigated expression patterns of bile salt export pump (BSEP, ABCB11), multidrug resistance protein 3 (MDR3, ABCB4), multidrug resistance associated protein 2 (MRP2, ABCC2) and multidrug resistance protein 1 (MDR1, ABCB1) in healthy liver tissue of a white population. Protein expression levels were correlated with specific single nucleotide polymorphisms (SNPs) in the corresponding transporter genes. Hepatic protein expression levels from 110 individuals undergoing liver resection were assessed by Western blot analysis of liver plasma membranes enriched in canalicular marker enzymes. Each individual was genotyped for the following synonymous (s) and nonsynonymous (ns) SNPs: ABCB11: (ns:1457T>C and 2155A>G), ABCB4: (ns:3826A>G) and ABCC2 (ns:1286G>A,3600T>A and 4581G>A) and ABCB1 (ns:2677G>T/A and s:3435C>T). Transporter expression followed unimodal distribution. However, of all tested individuals 30% exhibited a high expression and 32% a low or very low expression phenotype for at least one of the four investigated transport proteins. Transporter expression levels did not correlate with age, sex, underlying liver disease, or presurgery medication. However, low BSEP expression was associated with the 1457C-allele in ABCB11 (P = .167) and high MRP2 expression was significantly correlated with the 3600A and 4581A ABCC2 variants (P = .006). In conclusion, the results demonstrate a considerable interindividual variability of canalicular transporter expression in normal liver. Furthermore, data suggest a polymorphic transporter expression pattern, which might constitute a risk factor for the development of acquired forms of cholestatic liver diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
154 Box-plot analysis of (A) normalized BSEP-expression against genetic variants of 1457TϾC(V444A) and 2155A Ͼ G(M677V); (B) MDR3-expression against 3826A Ͼ G (R652G); (C) MRP2-expression against 1286G Ͼ A(V417I), 3600T Ͼ A(V1188E), and 4581G Ͼ A(C1515Y) and MDR1 against 3435C Ͼ T and 2677G Ͼ T/A(A893S/T). Login to comment
63 Primers and Probes of RealTime PCR for Allelic Discrimination of Single Nucleotide Polymorphisms (SNPs) in Whites Gene Exon cDNA PositionA SNPB GenBank Reference Amino Acid Exchange Sense-Antisense Primer Probesc ABCB11 13 1457 T Ͼ C rs2287617* V444A 5Ј-CTTTCTTCTCCAGATTCTAAATGACCTCA-3Ј/ VIC 5Ј-CCTGGTTTAATGACCATGT-3Ј 5Ј-GTCCTACCAGAGCTGTCATTTCC-3Ј FAM 5Ј-CTGGTTTAATGGCCATGT-3Ј ABCB11 17 2155 A Ͼ G Ref. 14,15** M677V 5Ј-TCATGCTGTGTTGAGTAGATGCA-3Ј/ VIC 5Ј- CTGAAGATGACATGCTT-3Ј 5Ј-GGTAGCTCCCTCTGCTAAAGGT-3Ј FAM 5Ј- ACTGAAGATGACGTGCTT-3Ј ABCB4 16 3826 A Ͼ G rs8187799* R652G 5Ј-TCCAGTCAGAAGAATTTGAACTAAATGATGAA-3Ј/ VIC 5Ј-CTGCCACTAGAATGG-3Ј 5Ј-GCCTAAATAGATTTCCAGCCATTTGG-3Ј FAM 5Ј-TGCCACTGGAATGG-3Ј ABCC2 10 1286 G Ͼ A rs2273697* V417I 5Ј-CCAACTTGGCCAGGAAGGA-3Ј/ VIC 5Ј-CTGTTTCTCCAACGGTGTA-3Ј 5Ј-GGCATCCACAGACATCAGGTT-3Ј FAM 5Ј-ACTGTTTCTCCAATGGTGTA-3Ј ABCC2 25 3600 T Ͼ A rs8187694* V1188E 5Ј-GCACCAGCAGCGATTTCTG-3Ј/ VIC 5Ј-ACACAATGAGGTGAGGAT-3Ј 5Ј-AGGTGATCCAGGAAAAGACACATTT-3Ј FAM 5Ј-ACAATGAGGAGAGGAT-3Ј ABCC2 32 4581 G Ͼ A rs8187710* C1515Y 5Ј-GTAATGGTCCTAGACAACGGGAAG-3Ј/ VIC 5Ј- AGAGTGCGGCAGCC -3Ј 5Ј-CCAGGGATTTGTAGCAGTTCTTCAG-3Ј FAM 5Ј-ATTATAGAGTACGGCAGCC-3Ј ABCB1 26 3435 CϾT rs1045642* synonym. Login to comment
141 Distribution of Genotypes and Allelic Frequencies of Investigated SNPs in Individuals With Low, Normal and High Transporter Expression Phenotypes SNP Study population Low expressorsA Normal expressorsB High expressionC 1) BSEP n ϭ 110 (100%) n ϭ 14 (100%) n ϭ 79 (100%) n ϭ 17 (100%) Alleles (2n) 220 (100%) 28 (100%) 158 (100%) 34 (100%) a) ABCB11 1457T>C (V444A): Genotypes: TT 19 (17%) 1 (7%) 14 (18%) 4 (24%) CC 29 (26%) 6 (43%) 19 (24%) 4 (24% TC 62 (56%) 7 (50%) 46 (58%) 9 (53%) Allelic frequency: C-allele 120 (55%) 19 (68%) 84 (53%) 17 (50%) b) ABCB11 2155A>G (M677V): Genotypes: AA 102 (93%) 14 (100%) 72 (91%) 16 (94%) AG 8 (7%) 7 (9%) 1 (6%) Allelic frequency: G-allele 8 (4%) 7 (7%) 1 (3%) 2) MDR3 n ϭ 110 (100%) n ϭ 13 (100%) n ϭ 86 (100%) n ϭ 11 (100%) Alleles (2n) 220 (100%) 26 (100%) 172 (100%) 22 (100%) ABCB4 3826A>G (R652G): Genotypes: AA 87 (89%) 8 (62%) 71 (83%) 8 (73%) AG 23 (21%) 5 (38%) 15 (17%) 3 (27%) Allelic frequency: G-allele 23 (10%) 5 (19%) 15 (9%) 3 (14%) 3) MRP2 n ϭ 110 (100%) n ϭ 11 (100%) n ϭ 90 (100%) n ϭ 9 (100%) Alleles (2n) 220 (100%) 22 (100%) 180 (100%) 18 (100%) a) ABCC2 1286G>A (V417I): Genotypes: GG 64 (58%) 7 (64%) 51 (57%) 6 (67%) AA 1 (1%) 1 (1%) GA 45 (41%) 4 (36%) 38 (42%) 3 (33%) Allelic frequency: A-allele 47 (26%) 4 (18%) 40 (22%) 3 (17%) b) ABCC2 3600T>A (V1188E): Genotypes: TT 95 (86%) 10 (91%) 80 (89%) 5 (56%) AA 1 (1%) 1 (11%) TA 14 (13%) 1 (9%) 10 (11%) 3 (33%) Allelic frequency: A-allele 16 (6%) 1 (5%) 10 (5%) 5 (28%) c) ABCC2 4581G>A (C1515Y): Genotypes: GG 95 (86%) 10 (91%) 80 (89%) 5 (56%) AA 1 (1%) 1 (11%) GA 14 (13%) 1 (9%) 10 (11%) 3 (33%) Allelic frequency: A-allele 16 (6%) 1 (5%) 10 (5%) 5 (28%) 4) MDR1 n ϭ 110 (100%) n ϭ 17 (100%) n ϭ 77 (100%) n ϭ 16 (100%) Alleles (2n) 220 (100%) 34 (100%) 154 (100%) 32 (100%) a) ABCB1 3435C>T: Genotypes: CC 23 (21%) 3 (18%) 16 (21%) 4 (25%) TT 28 (25%) 4 (24%) 20 (26%) 4 (25%) CT 59 (54%) 10 (58%) 41 (53%) 8 (50%) Allelic frequency: T-allele 115 (52%) 18 (53%) 81 (53%) 16 (50%) b) ABCB1 2677G>T/A (A893S/T): Genotypes: GG 31 (28%) 6 (35%) 20 (26%) 5 (31%) TT 21 (19%) 5 (29%) 15 (20%) 1 (6%) AA 1 (1%) 1 (6%) GT 48 (44%) 4 (24%) 35 (45%) 9 (56%) GA 4 (4%) 3 (4%) 1 (6%) TA 5 (5%) 1 (6%) 4 (5%) Allelic frequency: T/A-allele 95/11 (43%/5%) 15/3 (44%/9%) 69/7 (45%/5%) 11/1 (34%/3%) AIndividuals with phenotype low expressors (Ͻmean-1SD) and very low (Ͻmean-2SD) transporter expression levels. Login to comment
130 As indicated in Table 3, the overall distribution of the allelic variants in our study population was found to be similar to previously published data in whites,14,19 with the exception of ABCC2 variants 3600TϾA(V1188E) and 4581GϾA(C1515Y), which occurred with allelic frequencies of 6% in our study population as compared with the 1% recently published for a Finish collective.20 However, correlation of expression levels of transporter proteins with allelic variants of the corresponding transporter genes indicated a deviation from this distribution pattern. Login to comment
148 However, for 3600TϾA (V1188E), a significant difference (P ϭ .006) was seen between the mean protein expression levels in the 3600TT variant (0.93 Ϯ 0.56) and the 3600TA variant(1.36 Ϯ 0.83) (Fig. 5C). Login to comment
149 Among nine individuals exhibiting high MRP2 expression phenotypes, four individuals had at least one 3600A-allele (1 ϫ AA; 3 ϫ TA), resulting in an allelic frequency of 28% for 3600TϾA(V1188E) compared with 5% of normal or low expressors (P ϭ .005), further supporting and indicating that the 3600A-allele is associated with increased MRP2 expression (Table 3). Login to comment
170 Interestingly, two alanine- containing ABCB11 haplotypes were encountered more frequently in patients with pri mary biliary cirrhosis or associated with higher Mayo Risk Scores in patients with primary sclerosing cholangitis.34 The 444AA phenotype therefore also could be a risk factor to develop acquired cholestasis under certain challenges, such as inhibition of BSEP function by certain drugs such as cyclosporine, troglitazone, or bosentan.1,2,13,35,36 Furthermore, MRP2 expression levels were significantly higher in the presence of the two linked polymorphisms in exon 28 (V1188E) and in exon 32 (C1515Y) compared with carriers of the reference alleles. Login to comment

[hide] Pharmacogenetics of HIV therapy. Pharmacogenet Genomics. 2006 Oct;16(10):693-703. Owen A, Pirmohamed M, Khoo SH, Back DJ
Pharmacogenetics of HIV therapy.
Pharmacogenet Genomics. 2006 Oct;16(10):693-703., [PMID:17001288]

Abstract [show]
Drug treatment in HIV disease is characterized by variable responses, in terms of both efficacy and toxicity. Both genetic and environmental factors are important determinants of this variability, although the relative contributions are unclear and likely to vary with different drugs. Many of the antiretrovirals are metabolized by polymorphically expressed enzymes (cytochrome P450, CYP450; glucuronyl transferase, GT) and/or transported by drug transporters (ABC and SLC families). Initial studies of antiretroviral efficacy have therefore focused on these genes. For example, it has recently been shown that a CYP2B6 genetic variant predicts higher plasma efavirenz exposure and possibly increased central nervous system toxicity. A large number of studies on ABCB1 genetics with antiretrovirals have also been undertaken; however, as in other therapeutic areas, the data have been contradictory, and currently, no firm conclusions can be reached on the effect of ABCB1 variability as a determinant of efficacy. Indeed, this highlights the need for validation of initial association studies in pharmacogenetic research. By contrast, the clearest association between genetic variants and response relates to the hypersensitivity reaction that occurs with abacavir. The identification that the major histocompatibility complex haplotype 57.1 acts as a strong genetic predisposing factor can be regarded as a prime example of how fundamental research can be translated into a pharmacogenetic test. Nevirapine hypersensitivity has also been related to an HLA gene (HLA-DRB1*0101) but the predictive value does not appear to be sufficient to implement in clinical practice. Much more work needs to be done to define the genetic factors determining response to antiretroviral agents. These studies need to be sufficiently powered and utilize a modern genotyping strategy. Most importantly, the phenotype needs to be carefully characterized. We also need to disseminate this information: a pivotal resource for this can be found at www.HIV-pharmacogenomics.org.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
171 Pharmacogenetics of HIV therapy Owen et al. 699 Table 1 Polymorphisms that have been studied within the context of metabolism, transport and toxicity (but not progression and response) along with the reference ID (where available), the genotypic consequence and the observed phenotype for antiretroviral drugs Gene SNP (haplotype) Reference SNP Genotypic consequence Phenotypic consequence Confirmation CYP3A4 A - 392G (CYP3A4*1B) rs2740574 Promoter; altered expression No effect on nelfinavir or efavirenz Yes for nelfinavir; controversial for efavirenz T878C (CYP3A4*18) rs4986909 L293P; altered activity No effect on efavirenz No CYP3A5 A6986G (CYP3A5*3) rs776746 Splice defect No effect on nelfinavir, saquinavir or efavirenz AUC but altered urinary metabolic ratio of saquinavir Yes for efavirenz G14690A (CYP3A5*6) rs10264272 Splice defect No effect on nelfinavir or efavirenz Yes CYP2C19 G681A (CYP2C19*2) rs4244285 Truncated protein Higher nelfinavir AUC and trend toward decreased virological failure; no effect on efavirenz Yes for efavirenz; controversial for nelfinavir CYP2D6 A2549del (CYP2D6*3) NT21914757 Frameshift Trend to higher plasma levels of nelfinavir and efavirenz No G1846A (CYP2D6*4) rs3892097 Splice defect Trend to higher plasma levels of nelfinavir and efavirenz No T1707del (CYP2D6*6) rs5030655 Frameshift Higher plasma nelfinavir concentrations No CYP2B6 G516 T (CYP2B6*6, *7, *9, *13, *19 and *20) rs3745274 Q172H Higher plasma and intracellular efavirenz AUCs and increased neurotoxicity Yes, numerous studies C1459T (CYP2B6*5 and *7) rs3211371 R487C No effect on nelfinavir or efavirenz No ABCB1 IVS1 - 80delG rs3214119 N/A No influence on cellular nelfinavir No A61G rs9282564 N21D No influence on cellular nelfinavir No TAG1 rs3789243 N/A No influence on cellular nelfinavir No G1199A rs2229109 S400N No influence on cellular nelfinavir No TAG5 rs1128503 N/A No influence on cellular nelfinavir No TAG6 rs2235046 N/A No influence on cellular nelfinavir No IVS21 + T49C rs2032583 N/A No influence on cellular nelfinavir No C3435T rs1045642 Synonymous Some evidence of an influence on plasma and intracellular nelfinavir; decreased efavirenz plasma concentrations; currently under debate; increase in HDL cholesterol with efavirenz Controversial G2677T rs2032582 Ala893Ser No effect on efavirenz, ritonavir, nelfinavir, indinavir or viral decay and CD4 count Yes IVS26 + T59G rs2235047 N/A No influence on cellular nelfinavir No IVS26 + T80C rs2235048 N/A Increased intracellular nelfinavir concentrations No TAG11 rs1186746 N/A No influence on cellular nelfinavir No TAG12 rs1186745 N/A No influence on cellular nelfinavir No ABCC1 G816A P272P No influence on cellular nelfinavir No T825C rs246221 V275V No influence on cellular nelfinavir No T1062C rs35587 Synonymous No influence on cellular nelfinavir No IVS9 + A8G rs35588 N/A No influence on cellular nelfinavir No IVS10 + C64T N/A No influence on cellular nelfinavir No ABCC2 C - 24T rs717620 N/A No influence on cellular nelfinavir No G1249A rs2273697 V417I No influence on cellular nelfinavir No C1436G Synonymous No influence on cellular nelfinavir No IVS16 - G47A N/A No influence on cellular nelfinavir No T3563A rs8187694 V1188E No influence on cellular nelfinavir No C4488T rs8187707 Synonymous No influence on cellular nelfinavir No IVS31 + G12A rs8187708 N/A No influence on cellular nelfinavir No IVS31 + C74T N/A No influence on cellular nelfinavir No G4544A rs8187710 C1515Y No influence on cellular nelfinavir No G + 259T N/A No influence on cellular nelfinavir No ABCG2 - 19571_ - 19568delT- CAC rs4148162 Deletion No influence on cellular nelfinavir No A-19541G N/A No influence on cellular nelfinavir No G34A rs2231137 V12M No influence on cellular nelfinavir No IVS2 + 35G rs4148152 N/A No influence on cellular nelfinavir No C421A rs2231142 Q141K No influence on cellular nelfinavir No APOCIII C-482T Pending Promoter Hyperlipidaemia in presence of ritonavir Yes T-455C Pending Promoter Hyperlipidaemia in presence of ritonavir Yes C3238G rs5128 30 UTR variant Hyperlipidaemia in presence of ritonavir Yes APOE 2060T/2198T (APOEe2) rs429358 R112C/R158C Hyperlipidaemia in presence of ritonavir Yes 2060T/2198C (APOEe3) rs7412 R112C/R158R Hyperlipidaemia in presence of ritonavir Yes TNFa G - 238A rs361525 Promoter Rapid development of lipoatrophy Controversial SPINK-1 C112T rs17107315 N34S Associated with risk of pancreatitis Yes, in general population CFTR G1717 - 1A Splice defect Associated with risk of pancreatitis Yes, in general population IVS8 5T Splice defect Associated with risk of pancreatitis Yes, in general population HLA-B HLA-B*57.1 N/A Abacavir hypersensitivity Yes, but not in all populations HLA-DR HLA-DRB1*0101 N/A Nevirapine hypersensitivity No HSPA1L C2437T rs2227956 M493T Abacavir hypersensitivity No UGT1A1 A(TA)7TAA, - 43_ - 42in- sTA (UGT1A1*28) rs8175347 Promoter; insertion at TATA box Gilberts syndrome, hyperbilirubinaemia in presence of atazanavir and indinavir but not saquinavir Yes MT-CO1 C7028T Synonymous Haplogroup T associated with greater incidence of peripheral neuropathy No 700 Pharmacogenetics and Genomics 2006, Vol 16 No The NNRTI nevirapine can also cause a hypersensitivity syndrome characterized by a rash with systemic symptoms; occasionally liver injury may be part of the clinical picture, or alternatively, may actually be the only manifestation. Login to comment

[hide] Increased susceptibility for intrahepatic cholesta... World J Gastroenterol. 2008 Jan 7;14(1):38-45. Meier Y, Zodan T, Lang C, Zimmermann R, Kullak-Ublick GA, Meier PJ, Stieger B, Pauli-Magnus C
Increased susceptibility for intrahepatic cholestasis of pregnancy and contraceptive-induced cholestasis in carriers of the 1331T>C polymorphism in the bile salt export pump.
World J Gastroenterol. 2008 Jan 7;14(1):38-45., 2008-01-07 [PMID:18176959]

Abstract [show]
AIM: To study the association of three common ABCB11 and ABCC2 polymorphisms (ABCB11: 1331T>C --> V444A; ABCC2: 3563T>A --> V1188E and 4544G>A --> C1515Y) with intrahepatic cholestasis of pregnancy (ICP) and contraceptive-induced cholestasis (CIC). METHODS: ABCB11 and ABCC2 genotyping data were available from four CIC patients and from 42 and 33 ICP patients, respectively. Allele-frequencies of the studied polymorphisms were compared with those in healthy pregnant controls and Caucasian individuals. Furthermore, serum bile acid levels were correlated with the presence or absence of the 1331 C allele. RESULTS: The ABCB11 1331T>C polymorphism was significantly more frequent in cholestatic patients than in pregnant controls: C allele 76.2% (CI, 58.0-94.4) vs 51.3% (CI 35.8-66.7), respectively (P = 0.0007); and CC allele 57.1% (CI 36.0-78.3) vs 20% (CI 7.6-32.4), respectively (P = 0.0065). All four CIC patients were homozygous carriers of the C allele. In contrast, none of the studied ABCC2 polymorphism was overrepresented in ICP or CIC patients. Higher serum bile acid levels were found in carriers of the 1331CC genotype compared to carriers of the TT genotype. CONCLUSION: Our data support a role for the ABCB11 1331T>C polymorphism as a susceptibility factor for the development of estrogen-induced cholestasis, whereas no such association was found for ABCC2. Serum bile acid and gamma-glutamyl transferase levels might help to distinguish ABCB4- and ABCB11-related forms of ICP and CIC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Specifically, the CC genotype was encountered in 57.1% of all ICP patients (ICPnew, 47.6% and ICPold, 67.7%) and 100% of CIC patients compared to 20 and 32.2% in pregnant Table 2 New group of patients with ICP (ICPnew) Patient ID Age (yr) Liver parameters Comments Genotypes of SNPs ALT (ULN) AP (ULN) g-GT (ULN) tBili (ULN) tBA (ULN) No of preg/ No ICP Others ABCB11 1331T>C (V444A) ABCC2 3600T>A (V1188E) ABCC2 4581G>A (C1515Y) 1 36 0.9 2.3 3.3 0.8 10.7 2/1 CC TA GA 2 31 1.6 2.5. Login to comment
90 Table 3 Characteristics of patients with oral CIC Patient ID Oral contraceptive Age (yr) Exposure time Liver parameters Comments Genotypes of SNPs ALT AP gGT tBili tBA Clinical features Histology ABCB11 1331T>C (V444A) ABCC2 3600T>A (V1188E) ABCC2 4581G>A (C1515Y) (ULN) (ULN) (ULN) (ULN) (ULN) 11 30 ʼg ethinylestradiol/ 75 ʼg gestodene 32 nd 4.9 1.7 1 10.9 22.3 Jaundice Intrahepatic cholestasis CC TT GG 2 30 ʼg ethinylestradiol/ 150 ʼg levonorgestrel 15 21 d 1 3 1 4.2 nd Jaundice, nausea, pruritus Extensive intrahepatic cholestasis CC TT GG 3 35 ʼg ethinylestradiol/ 50 ʼg levonorgestrel 40 2 yr 3.9 2.8 3.6 0.5 1.6 Pruritus Bland CC TT GG 4 35 ʼg ethinylestradio/ 2 mg cyproteron 34 nd 1 1.3 nd 2.8 1.6 Jaundice Extensive canalicular cholestasis, mild portal inflamation CC TA GA 1 Patient exhibited previous episodes of ICP. Login to comment
105 DISCUSSION We investigated the risk association between different ABCB11 and ABCC2 polymorphisms in ICP and CIC, and correlated different genotypes with serum bile acid levels Table 4 Genotype distribution of non-synonymous ABCB11 variant site 1331T>C in patients and controls Genotype SNP ICPold ICPnew ICPtotal Pregnant controls Caucasian controls n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI ABCB11 1331T>C (V444A) 21 (100) 21 (100) 42 (100) 40 (100) 205 (100) TT (VV) - - 2 (9.5) 0.0-22.1 2 (4.8) 0.0-13.9 7 (17.5) 5.7-29.3 38(18.5) 13.2-23.9 CC (AA) 14 (67.7) 46.5 -86.8 10 (47.6) 26.3-69.0 24 (57.1) 36.0-78.3 8 (20) 7.6-32.4 66 (32.2) 25.8-38.6 TC (VA) 7 (33.3) 13.2-53.5 9 (42.9) 21.7-64.0 16 (38.1) 17.3-58.9 25 (62.5) 47.5-77.5 101 (49.3) 42.4-56.1 Frequency C allele 35 (83.3) 67.4-99.3 29 (69.0) 49.3-88.8 64 (76.2) 58.0-94.4 41 (51.3) 35.8-66.7 233 (56.8) 50.1-63.6 Frequency T allele 7 (16.7) 0.7-32.6 13 (31.0) 11.2-50.7 20 (23.8) 5.6-42.0 39 (48.8) 33.3-64.2 177 (43.2) 36.4-50.0 ABCC2 3563T>A (V1188E) 16 (100) 17 (100) 33 (100) 42 (100) 110 (100) TT (VV) 15 (93.8) 71.3-98.6 13 (76.5) 52.3-90.4 28 (84.8) 68.9-93.3 37 (88.1) 74.3-96.1 95 (86.4) 68.9-93.3 AA (EE) - - - - - - - - 1 (0.9) 0.0-5.0 TA (VE) 1 (3.1) 0.0-15.8 4 (23.5) 9.6-47.7 5 (15.2) 6.7-31.1 5 (11.9) 3.9-25.7 14 (12.7) 7.1-20.5 ABCC2 4544G>A (C1515Y) 16 (100) 17 (100) 33 (100) 42 (100) 110 (100) GG (CC) 15 (93.8) 71.3-98.6 13 (76.5) 52.3-90.4 28 (84.8) 68.9-93.3 36 (85.7) 71.4-94.6 95 (86.4) 68.9-93.3 AA (YY) - - - - - - - - 1 (0.9) 0.0-5.0 GA (CY) 1 (3.1) 0.0-15.8 4 (23.5) 9.6-47.7 5 (15.2) 6.7-31.1 6 (14.3) 5.4-28.6 14 (12.7) 7.1-20.5 Results are given with 95 percent confidence interval (95% CI). Login to comment
31 Furthermore, two non-synonymous ABCC2 polymorphisms (V1188E and C1515Y) showed significant differences in hepatic MRP2 expression levels compared to the wildtype sequence, which could be relevant for the extent of BSEP trans inhibition[25] . Login to comment
59 ABCC2: Three non-synonymous polymorphisms with a potential impact on MRP2 function and expression were chosen for genotyping[25] : 1249G>A variant (V417I, rs2273697), 3563T>A (V1188E, rs17222723) and 4544G>A (C1515Y, rs8187710). Login to comment
82 Table 1 Primers and probes of real-time PCR for allelic discrimination of ABCC2 SNPs in Caucasians cDNA position 1 SNP Exon Amino acid change Eense-/antisense primer Probes 2 1249 G>A 10 V417I 5'-CCAACTTGGCCAGGAAGGA-3'/ VIC 5'-CTGTTTCTCCAACGGTGTA-3' 5'-GGCATCCACAGACATCAGGTT-3' FAM 5'-ACTGTTTCTCCAATGGTGTA-3' 3563 T>A 25 V1188E 5'-GCACCAGCAGCGATTTCTG-3'/ VIC 5'-ACACAATGAGGTGAGGAT-3' 5'-AGGTGATCCAGGAAAAGACACATTT-3' FAM 5'-ACAATGAGGAGAGGAT-3' 4544 G>A 32 C1515Y 5'-GTAATGGTCCTAGACAACGGGAAG-3'/ VIC 5'-AGAGTGCGGCAGCC-3' 5'-CCAGGGATTTGTAGCAGTTCTTCAG-3' FAM 5'-ATTATAGAGTACGGCAGCC-3' 1 cDNA sequence from GenBank accession numbers NM_000392 starting at the ATG; 2 For each SNP two probes were designed and labeled with the fluorescent reporter dyes VIC (allele 1) and FAM (allele 2). Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

[hide] Genetic association analysis of transporters ident... Pharmacogenet Genomics. 2012 Jun;22(6):447-65. Grover S, Gourie-Devi M, Bala K, Sharma S, Kukreti R
Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs.
Pharmacogenet Genomics. 2012 Jun;22(6):447-65., [PMID:22565165]

Abstract [show]
OBJECTIVE: The ATP-binding cassette (ABC) superfamily of transporters is known to efflux antiepileptic drugs (AEDs) primarily in the brain, gastrointestinal tract, liver, and kidneys. In addition, they are also known to be involved in estrogen disposition and may modulate seizure susceptibility and drug response. The objective of the present study was to investigate the role of genetic variants from ABC transporters in seizure control in epilepsy patients treated with monotherapy of first-line AEDs for 12 months. METHODS: On the basis of gene coverage and functional significance, a total of 98 single nucleotide polymorphisms from ABCB1, ABCC1, and ABCC2 were genotyped in 400 patients from North India. Of these, 216 patients were eligible for therapeutic assessment. Genetic variants were compared between the 'no-seizures' and the 'recurrent-seizures' groups. Bonferroni corrections for multiple comparisons and adjustment for covariates were performed before assessment of associations. RESULTS: Functionally relevant promoter polymorphisms from ABCC2: c.-1549G>A and c.-1019A>G either considered alone or in haplotype and diplotype combinations were observed for a significant association with seizure control in women (odds ratio>3.5, P<10, power>95%). Further, low protein-expressing CGT and TGT (c.-24C>T, c.1249G>A, c.3972C>T) haplotypes were always observed to be present in combination with the AG (c.-1549G>A, c.-1019A>G) haplotype that was over-represented in women with 'no seizures'. CONCLUSION: The distribution of the associated variants supports the involvement of ABCC2 in controlling seizures in women possibly by lowering of its expression. The biological basis of this finding could be an altered interaction of ABCC2 with AEDs and estrogens. These results necessitate replication in a larger pool of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 - 24C > T 50 UTR k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k mRNA expression [29] m Expression and activity [35] m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of mycophenolic acid [35] k Clearance of methotrexate [37] k Clearance of irinotecan (ABCC2*2 containing the wild-type C allele) [29] 0.137 5 rs4919395 chr10:101542963 c.33 + 329G > A Intron 1 0.384 6 rs2756104 chr10:101544026 c.34 - 339C > T Intron 1 0.392 7 rs927344 chr10:101544447 c.116T > A Exon 2 (Phe39Tyr) 0.000 8 rs4148385 chr10:101548177 c.207+ 3639C > A Intron 2 0.382 9 rs2180990 chr10:101548974 c.208 - 3017C > G Intron 2 0.392 10 rs35191126 chr10:101549533:34 c.208 - 2458_208 - 2457G > delG Intron 2 0.384 11 rs4148389 chr10:101549911 c.208 - 2080A > G Intron 2 0.396 12 rs2804400 chr10:101553259 c.334 - 49C > T Intron 3 0.394 13 rs2756109 chr10:101558746 c.868 - 218T > G Intron 7 0.364 14 rs7080681 chr10:101560169 c.1058G > A Exon 9 (Arg353His) 0.000 15 rs2273697 chr10:101563815 c.1249G > A Exon 10 (Val417Ile) m mRNA expression [38] m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of irinotecan (ABCC*2 containing G allele) [34] 0.271 16 rs113646094 chr10:101564012 c.1446C > G Exon 10 (Thr482Thr) m mRNA expression [39] 0.002 17 rs2073337 chr10:101567426 c.1668 + 148A > G Intron 12 0.388 18 rs2756114 chr10:101569483 c.1816 - 408T > C Intron 13 0.393 19 rs3740074 chr10:101571528 c.1967+ 169T > C Intron 15 0.368 20 rs4148394 chr10:101572343 c.1968 - 432A > C Intron 15 0.206 21 rs3740072 chr10:101577123 c.2153A > G Exon 17 (Asn718Ser) 0.000 22 rs56199535 chr10:101578577 c.2302C > T Exon 18 (Arg768Trp) 0.000 23 rs56220353 chr10:101578641 c.2366C > G/T Exon 18 (Ser789Cys/Phe) k Activity, k expression and impaired membrane localization [40] 0.000 24 rs2002042 chr10:101587931 c.2621 - 2133C > T Intron 19 0.204 25 rs11442349 chr10:101589215:16 c.2621 - 849_2621 - 848T > delT Intron 19 0.375 26 rs3740071 chr10:101590120 c.2677C > G Exon 20 (Gln893Glu) 0.000 27 rs7898096 chr10:101593385 c.3259 -752G > A Intron 23 0.000 28 rs17216345 chr10:101594274 c.3396T > C Exon 24 (Ile1132Ile) 0.027 29 rs72558200 chr10:101595882 c.3449 G > A Exon 25 (Arg1150His) 0.000 30 rs72558201 chr10:101595950 c.3517 A > T Exon 25 (Ile1173Phe) 0.000 31 rs8187692 chr10:101595975 c.3542G > T Exon 25 (Leu1181Arg) 0.000 32 rs17222723 chr10:101595996 c.3563T > A Exon 25 (Val1188Glu) m Expression [41] 0.016 ABCC2 polymorphism and response to AEDs Grover et al. 451 or liver functioning. Login to comment

[hide] Interindividual variability in hepatic expression ... Drug Metab Dispos. 2012 May;40(5):852-5. Epub 2012 Feb 8. Deo AK, Prasad B, Balogh L, Lai Y, Unadkat JD
Interindividual variability in hepatic expression of the multidrug resistance-associated protein 2 (MRP2/ABCC2): quantification by liquid chromatography/tandem mass spectrometry.
Drug Metab Dispos. 2012 May;40(5):852-5. Epub 2012 Feb 8., [PMID:22318656]

Abstract [show]
Multidrug-associated protein 2 (MRP2) is an efflux transporter that is expressed at the bile canalicular membrane. To allow in vitro to in vivo extrapolation of the contribution of MRP2 toward hepatic disposition of its substrates, data on the interindividual variability of hepatic MRP2 protein expression are required. Therefore, we quantified the expression of MRP2 in the University of Washington (UW) human liver bank (n = 51) using a modified version of a previously validated liquid chromatography/tandem mass spectrometry assay. An unlabeled (LTIIPQDPILFSGSLR) and stable isotope-labeled (LTIIPQDPILFSGSL[(13)C(6)(15)N(1)]R) surrogate peptide for MRP2 were used as the calibrator and internal standard, respectively. After isolation of the membrane fraction from the liver tissue, in-solution tryptic digestion was conducted. Quality control samples created by spiking human serum albumin or pooled human liver (n = 51) matrix with three different MRP2 synthetic peptide concentrations generated error and precision values of less than 15%. As determined by the surrogate peptide, the average MRP2 expression in the UW liver bank samples was 1.54 +/- 0.64 fmol/mug liver membrane protein and was found to be independent of age (7-63 years) or sex. A single nucleotide polymorphism in the promoter region (rs717620), previously thought to affect MRP2 expression, did not influence hepatic expression of MRP2. In contrast, the single nucleotide polymorphism 21214G>A (V417I; rs2273697) was associated with significantly higher hepatic MRP2 expression.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Genotyping revealed polymorphisms for ABCC2 at the following sites: 1846AϾT(Y39F; rs927344), 21214GϾA(V417I; rs2273697), -24CϾT (rs717620), 36351TϾG(L849R; rs45494393), 53395TϾA(V1188E; rs17222723), 61606CϾT(I1324I; rs3740066), SNP-1 - - + - - - + - - + - - + - - - - - + - - - - - + - - + - - - - - - - - - + + - - + - - - - - - + + - SNP-2 - - - - - - - - - - - - - - - - - - - - - - - - - - - - + - - - - - - - - - - - + - - - - - - - - + - SNP-3 - - - + + - - - - - - - - + + + - - + + - - + + - - - - - - + - - + + + - + - + - - - + - - - + + - - 0.00 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 HL102 HL103 HL105 HL106 HL111 HL112 HL113 HL114 HL115 HL119 HL127 HL129 HL132 HL137 HL139 HL152 HL155 HL157 HL167 HL168 HL171 HL172 Average HL104 HL109 HL120 HL126 HL128 HL133 HL135 HL142 HL144 HL150 HL151 HL153 HL156 HL158 HL159 HL162 HL163 HL165 Average HL125 HL136 HL138 HL146 Average HL143 HL145 HL147 HL149 HL166 Average HL141 HL140 MRP2protein(fmol/ugprotein) A Acute injury FaƩy FibroƟc Normal B FIG. 2. Login to comment

[hide] Germline genetic polymorphisms may influence chemo... Cancer. 2012 Apr 1;118(7):1856-67. doi: 10.1002/cncr.26472. Epub 2011 Sep 1. Windsor RE, Strauss SJ, Kallis C, Wood NE, Whelan JS
Germline genetic polymorphisms may influence chemotherapy response and disease outcome in osteosarcoma: a pilot study.
Cancer. 2012 Apr 1;118(7):1856-67. doi: 10.1002/cncr.26472. Epub 2011 Sep 1., [PMID:21887680]

Abstract [show]
BACKGROUND: Osteosarcoma is the most common malignant bone tumor in children and young people. Efficacy of multiagent MAP (methotrexate, doxorubicin [Adriamycin], cisplatin) chemotherapy may be influenced by multiple cellular pathways. This pilot study aimed to investigate the association of 36 candidate genetic polymorphisms in MAP pathway genes with histological response, survival, and grade 3-4 chemotherapy toxicity in osteosarcoma. METHODS: Blood samples were obtained from 60 patients who had completed MAP chemotherapy. All patients were manually genotyped for 5 polymorphisms. The remaining 31 polymorphisms were genotyped in 50 patients using the Illumina 610-Quad microarray. Associations between candidate polymorphisms and histological response, progression-free survival, and toxicity were estimated using Pearson chi-square and Fisher exact tests, the Kaplan-Meier method, the log-rank test, and the Cox proportional hazards model. RESULTS: Poor histological response was increased in variants of ABCC2 c.24C>T (P = .011) and GSTP1 c.313A>G p.Ile(105)Val (P = .009), whereas MTHFD1 c.1958G>A p.Arg(653)Gln was protective (P = .03). Methotrexate toxicity was increased in variants of MTHFR c.1298A>C p.Glu(429)Ala (P = .038), ABCB1 c.3435T>C Ile(145)Ile (P = .027), and ABCC2 c.3563T>A p.Val(1188)Glu (P = .028). Variants of GSTP1 c.313A>G p.Ile(105)Val were at increased risk of myelosuppression (P = .024) and cardiac damage (P = .008). CONCLUSIONS: This pilot study represents the most comprehensive study to date examining the role of genetic polymorphisms in osteosarcoma. Although small and retrospective, it shows that several polymorphisms appear to significantly influence toxicity and clinical outcome. These deserve prospective validation in the hope of optimizing treatment for resistant disease and reducing the late effects burden.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 3R adverse prognosis in ALL.45 ABC efflux ABCB1 (MDR1) 7q21.12 MAP 1128503 1236C>T Gly412 Gly T allele : exposure to doxorubicin in breast cancer patients.4 No association in platinum-treated ovarian cancer.5 1045642 3435C>T Ile145 Ile CC : response to platinum chemotherapy in NSCLC.6 No association in platinum-treated ovarian cancer.5 ABCG2 (BCRP) 4q22.1 MAP 2231142 421C>A Gln141 Lys A ; OS in platinum-treated lung cancer.7 No association in platinum-treated ovarian cancer.5 ABCC1 (MRP1) 6p13.11 M 246240 A>G G ; methotrexate toxicity in psoriasis.8 3784862 A>G ABCC2 10q24.2 M 717620 24C>T T : response to platinum chemotherapy in NSCLC.9 No association in ovarian cancer.5 2273697 1249G>A Val417 Ile No association with response to platinum chemotherapy in NSCLC.9 17222723 3563T>A Val1188 Glu A : acute ACT, in 100% LD with Cis1515 Tyr.10 8087710 4544G>A Cis1515 Tyr DNA repair ERCC1 19q13.32 A, P 3212986 1510C>A (8092C>A)* Clinical effects conflicting. Login to comment
140 Significant Genotypic Associations With Grade 3-4 Chemotherapy Toxicity Cycle Pathway Toxicity Polymorphism Genotype OR (95% CI) P Methotrexate Folate pathway Anemia MTHFD1 c.1958G>A p.Arg653 Gln GG Reference AG 3.6 (0.6-20.9) .15 AA 10.2 (1.5-67.2) .016 AG/AA 5.4 (1-27.5) .044 MTHFR c.1298A>C p.Glu429 Ala AA Reference AC 3.8 (0.8-16.9) .08 CC 10 (1.1-86.9) .037 AC/AA 4.6 (1.1-19.2) .038 Recurrent [any] MTHFR c.1298A>C p.Glu429 Ala AA Reference AC 4.9 (1.3-19.1) .022 CC 4.4 (0.4-45.3) .2 AC/AA 4.8 (1.3-17.1) .015 ABC efflux Leucopenia ABCC2 3563T>A Val1188 Glu [wild-type AA] AA Reference AT 4 (0.96-17.1) .057 TT 9.9 (0.4-265) .17 AT/TT 5.2 (1.2-22.4) .028 Mucositis ABCB1 c.3435T>C p.Ile145 Ile TT Reference CT 5.2 (0.9-30.6) .06 CC 7.5 (1.3-44) .026 CT/CC 6.2 (1.2-31.8) .027 Recurrent [any] ABCG2 c.421C>A p.Gln141 Lys CC Reference AC 0.1 (0.01-1) .05 AA Nil Doxorubicin/cisplatin A metabolism Anemia CYBA c.242C>T p.His72 Tyr CC Reference CT 0.2 (0.06-0.9) .029 TT 0.5 (0.9-2.7) .4 CT/TT 0.3 (0.09-0.9) .038 Mucositis CYBA c.242C>T p.His72 Tyr CC Reference CT 0.2 (0.5-0.75) .018 TT 0.5 (0.1-2.9) .47 CT/TT 0.3 (0.08-0.9) .028 DNA repair Mucositis ERCC1 c.354T>C p.Asn118 Asn [wild-type CC] CC Reference CT 1.1 (0.3-3.9) .9 TT 0.1 (0.01-0.9) .045 CT/TT 0.6 (0.2-1.9) .4 Doxorubicin DNA repair Infection XPC 2886A>C Lys939 Gln AA Reference AC 0.2 (0.04-0.8) .03 CC 0.3 (0.04-2) .2 AC/CC 0.2 (0.06-0.8) .024 ERCC1 c.1510C>A p.Gln504 Lys CC Reference AC 3.7 (0.9-15.2) .06 AA 3.7 (0.5-28.4) .2 AC/AA 3.7 (1-13.7) .047 Leucopenia ERCC1 c.1510C>A p.Gln504 Lys CC Reference AC 5.4 (1-29.6) .05 AA 5.4 (0.4-66.7) .19 AC/AA 5.4 (1.1-26) .036 GST enzymes Treatment delay GSTM1 Non-null Reference Null 9.4 (1.9-46.9) .006 Leucopenia GSTP1 c.313A>G p.Ile105 Val AA Reference AG 6.8 (1.5-31.2) .013 GG 4 (0.2-91) .39 AG/GG 7.8 (1.3-47) .024 Abbreviations: CI, confidence interval; GST, glutathione-S-transferase; OR, odds ratio. Login to comment

[hide] Functional characterization of protein variants of... Hum Mutat. 2012 Apr;33(4):750-62. doi: 10.1002/humu.22041. Epub 2012 Feb 28. Arlanov R, Porter A, Strand D, Brough R, Karpova D, Kerb R, Wojnowski L, Schwab M, Lang T
Functional characterization of protein variants of the human multidrug transporter ABCC2 by a novel targeted expression system in fibrosarcoma cells.
Hum Mutat. 2012 Apr;33(4):750-62. doi: 10.1002/humu.22041. Epub 2012 Feb 28., [PMID:22290738]

Abstract [show]
The multidrug resistance-associated protein 2 (MRP2/ABCC2) is involved in the efflux of endogenous and xenobiotic substrates, including several anticancer and antiviral drugs. The functional consequences of ABCC2 protein variants remain inconsistent, which may be due to shortcomings of the in vitro assays used. To study systematically the functional consequences of nonsynonymous ABCC2 variants, we used a novel "Screen and Insert" (ScIn) technology to achieve stable and highly reproducible expression of 13 ABCC2 variants in HT1080 cells. Western blotting revealed lower (30-65%) ABCC2 expression for D333G, R1174H, and R1181L as compared with wild type (WT; 100%), whereas the linked variant V1188E/C1515Y resulted in higher expression (150%). R1174H caused mislocalization of ABCC2 to the cytoplasm with an endoplasmic reticulum-like distribution. Variants N1244K and R1174H decreased transport of glutathione-methylfluorescein (GS-MF) and glutathione-monochlorobimane (GS-MCB) by 80% and 50%, respectively, whereas R1181L and P1291L reduced only GS-MCB transport by 50% as compared with WT. Contrary to protein data, the double variant V1188E/C1515Y decreased specific transport activity for GS-MF and GS-MCB by 40%. The ScIn approach is a feasible and reliable method to functionally characterize systematically ABCC2 variants. D333G, R1174H, R1181L, N1244K, P1291L, and double variant V1188E/C1515Y have been identified as most promising for further clinical evaluation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Western blotting revealed lower (30-65%) ABCC2 expression for D333G, R1174H, and R1181L as compared with wild type (WT; 100%), whereas the linked variant V1188E/C1515Y resulted in higher expression (150%). Login to comment
8 Contrary to protein data, the double variant V1188E/ C1515Y decreased specific transport activity for GS-MF and GS-MCB by 40%. Login to comment
10 D333G, R1174H, R1181L, N1244K, P1291L, and double variant V1188E/C1515Y have been identified as most promising for further clinical evaluation. Login to comment
42 Materials and Methods Construction of Enhanced Green Fluorescent Protein (EGFP) Tagged and Untagged hABCC2(V1188E/C1515Y) Expression Plasmids A 5.3-kB cDNA encoding the human ABCC2 variant V1188E/C1515Y (GenBank accession number U49248.1) was subcloned into the vector pGEM3 provided by Professor Dr Piet Borst, The Netherlands Cancer Institute, Amsterdam, The Netherlands [Evers et al., 1998]. Login to comment
46 The resulting plasmid was ABCC2(V1188E/C1515Y)- EGFP.pEGFP-N1. Login to comment
48 The PCR fragment was cloned into the SpeI/NotI site of ABCC2(V1188E/C1515Y)-EGFP.pEGFP-N1 obtaining ABCC2(V1188E/C1515Y).pEGFP-N1 without an EGFP tag. Login to comment
169 Computational comparative genomic studies using PolyPhen 2 predicted that nine of these ABCC2 variants (F39Y, D333G, I670T, I1036T, R1174H, R1181L, V1188E, N1244K, and P1291L) would be located within the transmembrane regions, close to the ATP-binding domain of ABCC2 or close to two missense variants (I1173F, R1150H) causing Dubin-Johnson syndrome [Keitel et al., 2003; Mor-Cohen et al., 2001]. Login to comment
173 Because V1188E and C1515Y are linked, only the double variant V1188E/C1515Y was investigated. Login to comment
178 ABCC2 Missense Variants Selected for Study on Expression, Localization, and Function rs# NCBI Genetic variationa Amino acid Ethnicity Allele frequency (%) Nb Data source Predicted phenotypec rs927344 c.116T>A F39Y AA 2.3 86 Current study Benign AA 2 200 pharmGKB KO 0 94 Current study rs17222674 c.998A>G D333G AA 0 88 Current study Probably damaging AA 1 200 pharmGKB KO 0 94 Current study rs7080681 c.1058G>A R353H AA 6.7 90 Current study Benign AA 3.5 200 pharmGKB KO 0 94 Current study rs17222589 c.1457C>T T486I AA 0 84 Current study Benign KO 3.7 82 Current study JA 5 20 pharmGKB JA 2.3 144 Itoda et al. (2002) rs17222632 c.2009T>C I670T AA 1.1 92 Current study Benign AA 1.5 200 pharmGKB KO 0 92 Current study rs41318029 c.2761G>A G921S AA 0 84 Current study Benign KO 0 92 Current study CA 1 120 NCBI dbSNP rs45441199 c.3107T>C I1036T AA 0 96 Current study Benign AA 0.5 200 pharmGKB KO 0 94 Current study CA 0.5 198 pharmGKB CA 1 120 NCBI dbSNP rs139188247 c.3521G>A R1174H AA 2.3 86 Current study Probably damaging KO 0 94 Current study JA 1 144 Itoda et al. (2002) rs8187692 c.3542G>T R1181L AA 5.8 86 Current study Probably damaging AA 8.5 200 pharmGKB KO 0 96 Current study rs17222723 c.3563T>A V1188E AA 5.8 86 Current study Benign AA 6.5 200 pharmGKB KO 0 96 Current study CA 7.5 200 pharmGKB c.3732T>G N1244K JA 1.5 144 Itoda et al. (2002) Possibly damaging rs17216317 c.3872C>T P1291L AA 4.7 86 Current study Probably damaging AA 2 86 pharmGKB KO 0 86 Current study CA 0.5 196 pharmGKB rs8187710 c.4544G>A C1515Y AA 13 92 Current study Benign AA 19.6 194 pharmGKB KO 0 94 Current study CA 8 198 pharmGKB AA, African-American; CA, Caucasian; KO, Korean; JA, Japanese. Login to comment
182 R1181L (range 30-55% of WT, P < 0.01), whereas higher expression was found for the double variant V1188E/C1515Y (150% of WT, P < 0.01) (Supp. Fig. S5). Login to comment
183 Cellular Localization of ABCC2 WT and Variants in HEK 293 Cells The variable ABCC2 expression in HEK 293 cells carrying the D333G, R1174H, R1181L, and V1188E/C1515Y variants suggests that processing or protein stability of ABCC2 could be affected by these variants. Login to comment
204 Interestingly, the variable noninhibited EGFP value measured by the peak channel was approximately 800-fold for ABCC2 (WT) and approximately 500-fold (R1174H) and 1500- fold (V1188E/C1515Y) for ABCC2 variants compared with nonfluorescing cells (HT1080). Login to comment
205 With the exception of V1188E/C1515Y, the degree of downregulation after 72 hr did not seem to depend upon the type of variant construct used and the particular clone analyzed. Login to comment
206 The EGFP value was approximately 10-fold for ABCC2 (WT and 11 variants) compared with 20-fold for the ABCC2 double variant V1188E/C1515Y. Login to comment
210 D333G, R1174H, and R1181L exhibited a 40%, 70%, and 35% reduction in protein expression, respectively, whereas the double variant V1188E/C1515Y resulted in a 150% increase in protein expression compared with WT (P < 0.01). Login to comment
217 The D333G, R353H, T486I, G921S, and P1291L variants showed a lower transport activity for GS-MCB (71%, 60%, 75%, 63%, and 51% of WT, P < 0.01) but not for GS-MF, whereas the variants F39Y, I1036T, and V1188E/C1515Y did not alter ABCC2-mediated transport for either substrate. Login to comment
236 EGFP Kinetics of the ABCC2 Variants D333G, R1174H, R1181L, and V1188E/C1515Y To elucidate whether protein stability will affect degradation of ABCC2 after adding of doxycycline (1 μg/ml), we investigated EGFP kinetics of the ABCC2 D333G, R1174H, R1181L, and V1188E/C1515Y variants expressed by Rht14-10 cells. Login to comment
238 No differences in EGFP kinetics for the ABCC2 variants D333G, R1174H, R1181L, and V1188E/C1515Y were detected, indicating no changes in protein stability (Supp. Fig. S11). Login to comment
252 Compared with the ABCC2 reference sequence, the expression of ABCC2wasreducedforthethreemissensevariantsD333G,R1174H, and R1181L (range 30-65% of WT), whereas the double variant V1188E/C1515Y revealed a significantly higher expression (150% of WT). Login to comment
253 Altered protein expression of the ABCC2 variants D333G, R1174H, R1181L, and V1188E/C1515Y seems not to be the direct consequence of impaired or increased protein stability (Supp. Fig. S11), thereby suggesting alteration in synthesis or stability of the mutant ABCC2 mRNA. Login to comment
266 Interestingly, although the double variant V1188E/C1515Y showed the greatest expression of ABCC2 protein (150% of WT), this did not result in an increased specific efflux of GS-MF and GS-MCB because transport activities were virtually similar to WT. Login to comment
272 The selected variants R1174H, R1181L, and V1188E (linked to C1515Y) from the present study, in addition to two recently identified variants that cause Dubin-Johnson syndrome (R1150H, I1173F), are located at the same gene region between the transmembrane helices TM15 and TM16. Login to comment
279 The total allele frequency for all functionally relevant ABCC2 protein variants (D333G, R1174H, R1181L, V1188E/C1515Y, and P1291L) was highest in the African-American subjects, at approximately 20%. Login to comment
281 The double variant V1188E/C1515Y has been associated with differences in tissue expression by several in vivo studies, resulting in possible consequences for disease susceptibility and/or drug response, underscoring the clinical importance of ABCC2 V1188E/C1515Y [Elens et al., 2009; Grisk et al., 2009; Meier et al., 2005; Ni et al., 2010; Sookoian et al., 2009; Wojnowski et al., 2005]. Login to comment
300 Conservation of the ABCC2 Missense Variants Among Other ABCC Orthologs and Homologs Protein Speciesa F39Y D333G R353H T486I I670T G921S I1036T R1174H R1181L V1188E N1244K P1291L C1515Y ABCC2 Human F D R T I G I R R V N P C Mouse F D P K V S I R R K N P Y Rat F D S N V S I R R K N P Y Rabbit F D P N V G L R R I N P Y Rhesus F D R T M S I R R V N P Y ABCC1 Human Y D T T V G I R R L Y P Y Mouse Y D R T V G A R R L Y P C Rat Y D R T V V V R R L Y P C Macaque Y D T T V G I R R L Y P Y Dog Y D K T V G I R R L Y P C ABCC3 Human Y D P A V G F R D T Y E F Mouse Y N P T V V L R D T Y P F Rat Y D P T V G L R D A Y P F ABCC4 Human - E Y S V R L R R A Y P Y ABCC5 Human - Q A Y C P I H E E Y P E ABCC6 Human Y D P H V K I R P A A P S ABCC11 Human - C E K C T C H D R I Q F Multiple sequence alignment was performed using ClustalW (www.ebi.ac.uk/clustalw). Login to comment
303 V1188E/C1515Y variants showed the greatest alterations in function and/or expression in the ScIn in vitro system. Login to comment

[hide] Flavopiridol pharmacogenetics: clinical and functi... PLoS One. 2010 Nov 1;5(11):e13792. Ni W, Ji J, Dai Z, Papp A, Johnson AJ, Ahn S, Farley KL, Lin TS, Dalton JT, Li X, Jarjoura D, Byrd JC, Sadee W, Grever MR, Phelps MA
Flavopiridol pharmacogenetics: clinical and functional evidence for the role of SLCO1B1/OATP1B1 in flavopiridol disposition.
PLoS One. 2010 Nov 1;5(11):e13792., [PMID:21072184]

Abstract [show]
BACKGROUND: Flavopiridol is a cyclin-dependent kinase inhibitor in phase II clinical development for treatment of various forms of cancer. When administered with a pharmacokinetically (PK)-directed dosing schedule, flavopiridol exhibited striking activity in patients with refractory chronic lymphocytic leukemia. This study aimed to evaluate pharmacogenetic factors associated with inter-individual variability in pharmacokinetics and outcomes associated with flavopiridol therapy. METHODOLOGY/PRINCIPAL FINDINGS: Thirty-five patients who received single-agent flavopiridol via the PK-directed schedule were genotyped for 189 polymorphisms in genes encoding 56 drug metabolizing enzymes and transporters. Genotypes were evaluated in univariate and multivariate analyses as covariates in a population PK model. Transport of flavopiridol and its glucuronide metabolite was evaluated in uptake assays in HEK-293 and MDCK-II cells transiently transfected with SLCO1B1. Polymorphisms in ABCC2, ABCG2, UGT1A1, UGT1A9, and SLCO1B1 were found to significantly correlate with flavopiridol PK in univariate analysis. Transport assay results indicated both flavopiridol and flavopiridol-glucuronide are substrates of the SLCO1B1/OATP1B1 transporter. Covariates incorporated into the final population PK model included bilirubin, SLCO1B1 rs11045819 and ABCC2 rs8187710. Associations were also observed between genotype and response. To validate these findings, a second set of data with 51 patients was evaluated, and overall trends for associations between PK and PGx were found to be consistent. CONCLUSIONS/SIGNIFICANCE: Polymorphisms in transport genes were found to be associated with flavopiridol disposition and outcomes. Observed clinical associations with SLCO1B1 were functionally validated indicating for the first time its relevance as a transporter of flavopiridol and its glucuronide metabolite. A second 51-patient dataset indicated similar trends between genotype in the SLCO1B1 and other candidate genes, thus providing support for these findings. Further study in larger patient populations will be necessary to fully characterize and validate the clinical impact of polymorphisms in SLCO1B1 and other transporter and metabolizing enzyme genes on outcomes from flavopiridol therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
214 This is a non-synonymous SNP resulting in a C1515Y alteration and is part of a haplotype with the rs17222723 SNP (also a non-synonymous SNP with a V1188E residue change). Login to comment

[hide] ABCC2/Abcc2: a multispecific transporter with domi... Drug Metab Rev. 2010 Aug;42(3):402-36. Jemnitz K, Heredi-Szabo K, Janossy J, Ioja E, Vereczkey L, Krajcsi P
ABCC2/Abcc2: a multispecific transporter with dominant excretory functions.
Drug Metab Rev. 2010 Aug;42(3):402-36., [PMID:20082599]

Abstract [show]
ABCC2/Abcc2 (MRP2/Mrp2) is expressed at major physiological barriers, such as the canalicular membrane of liver cells, kidney proximal tubule epithelial cells, enterocytes of the small and large intestine, and syncytiotrophoblast of the placenta. ABCC2/Abcc2 always localizes in the apical membranes. Although ABCC2/Abcc2 transports a variety of amphiphilic anions that belong to different classes of molecules, such as endogenous compounds (e.g., bilirubin-glucuronides), drugs, toxic chemicals, nutraceuticals, and their conjugates, it displays a preference for phase II conjugates. Phenotypically, the most obvious consequence of mutations in ABCC2 that lead to Dubin-Johnson syndrome is conjugate hyperbilirubinemia. ABCC2/Abcc2 harbors multiple binding sites and displays complex transport kinetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
396 Finally, the effect Table 5. Pharmacokinetics of substrates affected by ABCC2/Abcc2. Compound Assay Data References Endogenous compounds E2-17-beta-Gluc In vitro (CMV) and in vivo (biliary excretion after i.v.) experiments Impaired in EHBR rats Morikawa et al., 2000 Hydroxy-nonenal-gluc Biliary clearance No detectable excretion in EHBR rats Ji et al., 2002 Drugs and drug metabolites Acetaminophen sulfate IPL Rate constant of biliary excretion was decreased by 90% in TR- rats, a further 50% decrease upon GF admin Zamek-Gliszczynski et al., 2005 Acetaminophen, sulfate, and glucuronide IPL A- sulf 20-30% in TRA- Gluc; A-GS negligible in TR- Xiong et al., 2000 Acetaminophen, glutathione, -mercapturate, and glucuronide Biliary excretion after i.v. administration Biliary conc of A-GSH negligible; A-Gluc; A-NAC significantly reduced in TR- Chen et al., 2003a Acetaminophene glucuronide Single-pass liver perfusion (wild type vs. TR- ) 500-fold lower excretion rate in TR- liversXiong et al., 2002 Azithromycin Bolus injection, biliary excretion 60% lower in EHBR rats (0.7 vs. 1.2% in SD) Sugie et al., 2004 Cefoperazone Biliary and urinary excretion Biliary excretion decreased by 90% in EHBR rats Kato et al., 2008 Cisplatin In vitro and i.p. in vivo xenograft experiments Lentiviral RNAi adm knocked down ABCC2 exp to cca 20%; cisp accumulation 3-4-fold incr; reduced IC50 4-5-fold; worked in vivo Xie et al., 2008 Diclofenac glucuronide Liver perfusion (wild type vs. TR- ) 30-fold lower excretion in TR- livers Seitz et al., 1998 [D-penicillamine2,5]enkephalin (DPDPE) Sandwich hepatocytes Biliary clearance decreased by 83% Hoffmaster et al., 2005 Doxorubicin IPL Biliary excretion decreased by 30% in TR- rats Gaugg et al., 2001 In vitro (K562/ADR) and in vivo (biliary clearance) Biliary excretion reduced in EHBR rats Asakura et al., 2004 Clinical Val1188Glu-Cys1515Tyr haplotype associated with acute anthracycline cardiotoxicity (ACT) Wojnowski et al., 2005 E3040 (6-hydroxy-5,7-dimethyl-2- methylamino-4-(3-pyridylmethyl) benzothiazole) and glucuronide IPL and VT In EHBR biliary clearance of E3040G was 1/30 of wild type Takenaka et al., 1995 Enalapril; enalaprilate IPL Biliary excretion reduced to almost zero in EHBR rat Liu et al., 2006 Ezetimibe and glucuronide Intestinal secretion upon rifampicin treatm. Login to comment

[hide] Application of multivariate statistical procedures... Xenobiotica. 2009 Jul;39(7):514-22. Aleksunes LM, Yeager RL, Klaassen CD
Application of multivariate statistical procedures to identify transcription factors that correlate with MRP2, 3, and 4 mRNA in adult human livers.
Xenobiotica. 2009 Jul;39(7):514-22., [PMID:19480556]

Abstract [show]
Multidrug resistance-associated proteins 2-4 (MRP2-4) are membrane efflux transporters critical for the hepatic clearance of pharmaceuticals and endogenous chemicals. Little is known about the constitutive regulation of MRP2-4 mRNA in normal human liver. The purpose of this study was to identify transcription factors whose expression significantly correlates with MRP2-4 mRNA in human liver specimens. Ninety adult human livers were profiled for mRNA expression of MRP2-4 as well as aryl hydrocarbon receptor (AhR), constitutive androstane receptor (CAR), pregnane X receptor (PXR), peroxisome proliferator-activated receptor alpha (PPAR alpha) and gamma (gamma), liver X receptor alpha (LXR alpha), farnesoid X receptor (FXR), glucocorticoid receptor (GR), retinoid X receptor alpha (RXR alpha), hepatocyte nuclear factor 1 alpha (HNF1 alpha) and 4 alpha (4 alpha), and nuclear factor E2-related factor 2 (Nrf2) transcription factors. Using linear regression and stepwise selection of partial R(2)-values, CAR, HNF1 alpha, and PPAR alpha mRNA exhibited the greatest correlation with MRP2, 3, and 4, respectively. Interindividual variation in the expression of the identified transcription factors may account for the variability in constitutive mRNA levels of MRP2-4. The multivariate approach presented in this study should aid in predicting signalling pathways that participate either directly or indirectly in regulating hepatic drug disposition.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
189 For example, two polymorphisms in MRP2 (V1188E, C1515Y) are associated with increased expression of MRP2 in human liver (Meier et al. 2006). Login to comment

[hide] Multidrug resistance-related protein 2 genotype of... Pharmacogenet Genomics. 2009 Apr;19(4):276-88. Grisk O, Steinbach AC, Ciecholewski S, Schluter T, Kloting I, Schmidt H, Dazert E, Schaeffeler E, Steil L, Gauer S, Jedlitschky G, Schwab M, Geisslinger G, Hauser IA, Volker U, Kroemer HK, Rettig R
Multidrug resistance-related protein 2 genotype of the donor affects kidney graft function.
Pharmacogenet Genomics. 2009 Apr;19(4):276-88., [PMID:19214140]

Abstract [show]
OBJECTIVES: We tested the effect of kidney-specific multidrug resistance-related protein (MRP2, ABCC2) deficiency on renal organic solute disposition as well as on renal protein and gene expression. Furthermore, we investigated whether a particular kidney donor ABCC2 genotype is associated with delayed graft function in patients. METHODS: A new MRP2-deficient rat strain was established. Renal cross-transplantations were performed between congenic MRP2-deficient and wild-type rats. Renal disposition of MRP2 substrates was investigated in native and transplanted rats. Proteomic analyses and transcriptional profiling were performed in rat kidney graft cortices. Ninety-eight human kidney donor-recipient pairs were genotyped for five ABCC2 polymorphisms. The relationship between delayed graft function and ABCC2 genetic variants in donors and recipients was analyzed by backward stepwise logistic regression. RESULTS: In rats, the absence of renal MRP2 reduced renal bilirubin glucuronide excretion at pathologic plasma concentrations, modified renal p-aminohippurate excretion and did not affect renal morphine-6-glucuronide excretion. Renal MRP2 deficiency led to renal cortical protein or mRNA upregulation of glutathione transferase isoenzymes, glutaredoxin 2, and heme oxygenase-1. In patients, a particular donor ABCC2 genotype was associated with an increased incidence of delayed graft function. CONCLUSION: Kidney graft-specific MRP2 deficiency has mild effects on the renal excretion of some organic solutes under experimental conditions and induces a protein and gene expression pattern indicative of activated antioxidant defense mechanisms. This suggests that MRP2 is a determinant of the redox status in tubular epithelial cells and thus of the susceptibility to renal damage under conditions of treatment with multiple drugs and increased oxygen radical formation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
187 Genetic analyses All samples were genotyped for five ABCC2 variants ( - 24C > T, 1249G > A [V417I], 3972C > T, 4544G > A [C1515Y], 3563T > A [V1188E]). Login to comment
189 In line with previous data [16], there was complete linkage disequilibrium between polymorphisms 3563T > A [V1188E] and 4544G > A [C1515Y]. Login to comment

[hide] Pharmacokinetics of mycophenolate mofetil and its ... Pharmacogenomics. 2008 Jul;9(7):869-79. Levesque E, Benoit-Biancamano MO, Delage R, Couture F, Guillemette C
Pharmacokinetics of mycophenolate mofetil and its glucuronide metabolites in healthy volunteers.
Pharmacogenomics. 2008 Jul;9(7):869-79., [PMID:18597651]

Abstract [show]
We previously reported that polymorphisms in the UGT2B7 and UGT1A9 genes are associated with significant alteration in the disposition of mycophenolic acid (MPA) in healthy volunteers. AIM: This study further evaluates the impact of genetic polymorphisms at the UGT1A1, UGT1A7 and ABCC2 loci. METHODS: Genetic analyses of five UGT candidate genes and ABCC2 were completed on 47 healthy subjects who received a single dose of 1.5 g mycophenolate mofetil and completed a 12-h pharmacokinetic profile. RESULTS: Multivariate analyses indicate that the ABCC2 -24T promoter polymorphism is associated with a 25% increase in acyl mycophenolic acid phenolic glucuronide level. Subjects with combined ABCC2 -24T and UGT1A9*3 genotypes present a 169% increased exposure to AcMPAG. Homozygosity for UGT1A7 387G/391A (129Lys/131Lys) is associated with a modest but significant 7% reduction in MPA level. When these additional genetic factors are considered in the model, the effects of previously described UGT1A9 and UGT2B7 variations remain significant. No significant effect is observed for UGT1A1*28, UGT1A7 622T/C (Trp208Arg), UGT1A9 -440TC/-331CT, UGT1A9 -118 TA(9/10) and seven other ABCC2 SNPs. CONCLUSION: We demonstrate that MPA disposition is a multigenic process, and that additional studies are required to ascertain the relationship between UGT, ABCC2 genotypes and MPA pharmacokinetics in transplant recipients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Nucleotide position Polymorphism Amino acid Reported impact Present study Ref. Observed frequency PK effect* Promoter -24C>T ↓ mRNA expression 0.24 25% ↑ AcMPAG [28] Exon 10 1219C>T Leu407Leu ‡ 0.01 - 1234A>G Arg412Gly ↓ Activity 0 - [33] 1249G>A Val417Ile ↓ or = expression 0.21 NS [29,30] 1289A>G Lys430Arg Unknown 0 - [32] 1446C>G Thr482Thr ↑ mRNA expression 0.01 - [32] Exons 25/32 3563T>A/ 4544G>A Val1188Glu/ Cys1515Tyr ↑ Expression 0.04 NS [31] Exon 28 3972C>T Ile1324Ile Altered mRNA stability 0.43 NS [34] *Multivariate analysis ‡In-vitro functional impact not evaluated The PK parameters of the ABCC2 codon 482 variant are presented in Figure 1C. Login to comment

[hide] Influence of genetic polymorphisms on intestinal e... Pharmacogenet Genomics. 2008 Apr;18(4):357-65. Haenisch S, May K, Wegner D, Caliebe A, Cascorbi I, Siegmund W
Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol.
Pharmacogenet Genomics. 2008 Apr;18(4):357-65., [PMID:18334920]

Abstract [show]
OBJECTIVES: To evaluate whether ABCC2 gene polymorphisms are associated with expression and/or function of the efflux pump. METHODS: We investigated the allele frequency of ABCC2 -24C>T, -23G>A, c.1249G>A, c.1446C>G, c.1457C>T, c.2302C>T, c.2366C>T, c.3542G>T, c.3561G>A, c.3563T>A, c.3972C>T, c.4348G>A, and 4544G>A in 374 nonrelated German healthy volunteers and determined the impact on duodenal mRNA and protein content of ABCC2. For functional analysis, the disposition of intravenously (30 mg) and orally administered talinolol (100 mg) was measured among 31 individuals. Moreover, the effects of rifampicin-type induction (600 mg, 8 days) of duodenal ABCC2 were quantified in 22 participants with regard to genetic polymorphisms. RESULTS: The allele frequencies were 18.3% (-24T), 21.1% (1249A), 1.4% (1446G), 0.1% (3542T), 4.5% (3563A), 34.2% (3972T), and 4.4% (4544A); carriers of -23G>A, 1457C>T, 2302C>T, 2366C>T, 3561G>A, and 4348G>A were not identified. The -24T allele was in strong linkage with 3972T, and 3563A with 4544A, whereas 1249A was weakly linked with other variant alleles. None of the single nucleotide polymorphisms investigated influenced significantly intestinal ABCC2 mRNA and protein content. The variant ABCC2 1249G>A (V417I), however, was associated with lower oral bioavailability (P=0.001), and increased residual clearance of intravenous talinolol (P=0.021). Intestinal ABCC2 mRNA and protein expression were upregulated by rifampicin treatment, a genetic influence could be detected in only four cases heterozygote for 3563T>A or 4544G>A. CONCLUSION: The 1249G>A (V417I) polymorphism is obviously associated with higher activity of the intestinal transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 So far, the polymorphism -24C > T in the 50 -untranslated region, the nonsynonymous single nucleotide polymorphisms (SNPs) c.1249G > A (V417I), c.3563T > A (V1188E), c.4544G > A (C1515Y), and the synonymous SNPs 1446C > G (Thr482Thr) and 3972C > T (I1324I) were subjects of evaluations [15-17]. Login to comment
47 The SNPs -24C > T (rs717620), -23G > A (rs17216156) in the 50 -UTR, c.1446C > G (T482T), recently described by Niemi et al. [17], c.1457C > T (T486I, rs45518933), c.3542G > T (R1181L, rs8187692), c.3561G > A (E1187E, rs45622934), c.3563T>A (V1188E rs17222723), c.4544G>A (C1515Y, rs8187710) were determined by pyrosequencing using the PSQ 96HS system (Biotage, Uppsala, Sweden). Login to comment

[hide] Genetic variations of the ABCC2 gene in the Chines... Drug Metab Pharmacokinet. 2008;23(5):385-91. Ho WF, Koo SH, Yee JY, Lee JD
Genetic variations of the ABCC2 gene in the Chinese, Malay, and Indian populations of Singapore.
Drug Metab Pharmacokinet. 2008;23(5):385-91., [PMID:18974617]

Abstract [show]
MRP2 is a drug transporter that is responsible for the gastrointestinal absorption and biliary excretion of a wide variety of endogenous and xenobiotic compounds, including many clinically used drugs. This study aims to identify genetic variations of ABCC2 gene in three distinct ethnic groups of the Singaporean population (n = 288). The coding region of the gene encoding the transporter protein was screened for genetic variations in the study population by denaturing high-performance liquid chromatography and DNA sequencing. Twenty-two genetic variations of ABCC2, including 8 novel ones, were found: 1 in the 5' untranslated region, 10 in the coding exons (8 nonsynonymous and 2 synonymous variations), and 11 in the introns. Three novel nonsynonymous variations: 2686G > A (Glu896Lys), 4240C > T (His1414Tyr) and 4568A > C (Gln1523Pro) were detected in single heterozygous Malay, Chinese, and Indian subjects, respectively. Among the novel nonsynonymous variations, 4240C > T and 4568A > C were predicted to be functionally significant. These data would provide fundamental and useful information for pharmacogenetic studies on drugs that are substrates of MRP2 in Asians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Among the reported variations, the ones that may be of functional relevance include -24CÀT,7,25) 1249GÀA (Val417Ile),5) 3563TÀA (Val1188Glu),5,26-28) 3972CÀT (Ile1324Ile),25) and 4544GÀA (Cys1515Tyr).26,28) The -24CÀT polymorphism was found to associate with increased plasma methotrexate concentrations in pediatric leukemia patients.7) We have also previously observed a trend for a genotypic-phenotypic correlation between -24CÀT polymorphism and increased irinotecan AUC(0, /).29) -24CÀT and 3972CÀT (Ile1324Ile) were linked to higher response rates to irinotecan and longer progression-free survival in patients with advanced non-small cell lung cancer.25) However, a study on the disposition of nitrocamptothecin and its aminocamptothecin metabolite in relation to the 3972CÀT variation revealed no significant association.30) 3563TÀA (Val1188Glu) and 4544GÀA (Cys1515Tyr) were correlated with high MRP2 expression,28) and increased susceptibility for anthracycline-induced cardiotoxicity.26) 3563TÀA (Val1188Glu) was also significantly associated with pruritus in primary biliary cirrhosis.27) Genetic polymorphisms in ABCC2 might thus constitute a risk factor for the development of acquired forms of cholestatic liver diseases.28) Mutations in the transmembrane domain: 1249GÀA (Val417Ile), 1457CÀT (Thr486Ile), and 3563TÀA (Val1188Glu) could affect their substrate specificities though their transporter activities might not be completely disrupted.5) All reported nonsynonymous variations detected in this study were predicted to be benign using the PolyPhen program. Login to comment

[hide] Intestinal expression of cytochrome P450 enzymes a... Acta Neurol Scand. 2007 Apr;115(4):232-42. Simon C, Stieger B, Kullak-Ublick GA, Fried M, Mueller S, Fritschy JM, Wieser HG, Pauli-Magnus C
Intestinal expression of cytochrome P450 enzymes and ABC transporters and carbamazepine and phenytoin disposition.
Acta Neurol Scand. 2007 Apr;115(4):232-42., [PMID:17376120]

Abstract [show]
OBJECTIVES: Interindividual variability in intestinal absorption and bioavailability might contribute to inadequate control of seizures under treatment with carbamazepine and phenytoin. We therefore correlated intestinal expression levels and genetics of CYP3A4, CYP2C9/19, MDR1 and MRP2 with dose requirement and plasma levels of carbamazepine and phenytoin. MATERIALS AND METHODS: Epileptic patients on carbamazepine (n = 29) or phenytoin (n = 15) were stratified into a 'high'-dose (carbamazepine > or =800 mg/day, phenytoin > or =300 mg/day) and a 'low'-dose group (carbamazepine < or =600 mg/day, phenytoin < or =200 mg/day). Duodenal biopsies and DNA were obtained for Western blotting and genotyping studies. RESULTS: Low carbamazepine plasma levels showed a trend towards higher intestinal MDR1 expression (P = 0.06). Furthermore, carbamazepine dose was positively correlated with MRP2 expression (P = 0.1). Moreover, MDR1 expression and carbamazepine and phenytoin dose requirement was influenced by the genotype in position 2677 and 3435 of the MDR1 gene. CONCLUSION: Differences in intestinal MDR1 and MRP2 expression may influence carbamazepine and phenytoin disposition and may account for interindividual pharmacokinetic variability.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 The role of ABCC2 polymorphisms on MRP2 expression is less well established, but recent data indicate that hepatic MRP2 expression is influenced by two SNPs in positions 1188 (V1188E) and 1515 (C1515Y) of the MRP2 protein. Login to comment

[hide] The apical conjugate efflux pump ABCC2 (MRP2). Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18. Nies AT, Keppler D
The apical conjugate efflux pump ABCC2 (MRP2).
Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18., [PMID:16847695]

Abstract [show]
ABCC2 is a member of the multidrug resistance protein subfamily localized exclusively to the apical membrane domain of polarized cells, such as hepatocytes, renal proximal tubule epithelia, and intestinal epithelia. This localization supports the function of ABCC2 in the terminal excretion and detoxification of endogenous and xenobiotic organic anions, particularly in the unidirectional efflux of substances conjugated with glutathione, glucuronate, or sulfate, as exemplified by leukotriene C(4), bilirubin glucuronosides, and some steroid sulfates. The hepatic ABCC2 pump contributes to the driving forces of bile flow. Acquired or hereditary deficiency of ABCC2, the latter known as Dubin-Johnson syndrome in humans, causes an increased concentration of bilirubin glucuronosides in blood because of their efflux from hepatocytes via the basolateral ABCC3, which compensates for the deficiency in ABCC2-mediated apical efflux. In this article we provide an overview on the molecular characteristics of ABCC2 and its expression in various tissues and species. We discuss the transcriptional and posttranscriptional regulation of ABCC2 and review approaches to the functional analysis providing information on its substrate specificity. A comprehensive list of sequence variants in the human ABCC2 gene summarizes predicted and proven functional consequences, including variants leading to Dubin-Johnson syndrome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment

[hide] Genetic susceptibility to diclofenac-induced hepat... Gastroenterology. 2007 Jan;132(1):272-81. Epub 2006 Nov 17. Daly AK, Aithal GP, Leathart JB, Swainsbury RA, Dang TS, Day CP
Genetic susceptibility to diclofenac-induced hepatotoxicity: contribution of UGT2B7, CYP2C8, and ABCC2 genotypes.
Gastroenterology. 2007 Jan;132(1):272-81. Epub 2006 Nov 17., [PMID:17241877]

Abstract [show]
BACKGROUND & AIMS: Diclofenac is a widely used nonsteroidal anti-inflammatory drug and is among the most common drugs causing idiosyncratic hepatotoxicity in several recent series with up to 20% mortality in jaundiced subjects. We hypothesized that susceptibility to hepatotoxicity would be associated with genetic polymorphisms in the genes encoding the enzymes UGT2B7 and CYP2C8, which determine the formation of reactive diclofenac metabolites and in ABCC2 encoding the transporter MRP2 contributing to the biliary excretion of the reactive metabolite. METHODS: Twenty-four patients (19 female) aged 24-70 (mean, 50.8) years who had suffered diclofenac hepatotoxicity, 48 subjects (35 female) aged 22-77 (mean, 52) years who were taking diclofenac for 0.3-20 (mean, 4) years without developing hepatotoxicity (hospital controls), and 112 healthy controls were investigated. Genotyping for several polymorphisms in the genes encoding UGT2B7, CYP2C8, and ABCC2 was performed and haplotypes assigned. RESULTS: The UGT2B7*2 allele was more common in diclofenac hepatotoxicity patients compared with hospital controls (odds ratio [OR], 8.5, P = .03) and healthy controls (OR, 7.7, P = .03). The ABCC2 C-24T variant was more common in hepatotoxicity patients compared with hospital (OR, 5.0, P = .005) and healthy controls OR: 6.3, P = .0002). Haplotype distributions for CYP2C8 were different in patients compared with hospital controls (P = .04). CONCLUSIONS: Allelic variants of UGT2B7, CYP2C8, and ABCC2, which may predispose to the formation and accumulation of reactive diclofenac metabolites are associated with diclofenac hepatotoxicity. Increased level of reactive metabolites may lead to higher levels of protein-diclofenac adducts and subsequently hepatotoxicity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 PCR-RFLP Assay Primers and Conditions Gene and polymorphism Primers Annealing temperature Restriction enzyme PCR product and digestion pattern UGT2B7 C-161T GTGAACAGATCATTTACCTTCATTTGTCTT 1 min at 53°C BbsI C allele 239 bp and 20 bp (rs17551675) CAATTCCCAGAGCTAAAGCAAAAGCTCAGT T allele 259 bp (not digested) UGT2B7 A-79G GTGAACAGATCATTTACCTTCATTTGTCTT 1 min at 53°C HpyCH4III A allele 210 bp and 49 bp (no rs listed) CAATTCCCAGAGCTAAAGCAAAAGCTCAGT G allele 259 bp (not digested) UGT2B7 C801T ACAATGCGGAAAGCTGACG 1 min at 57°C FokI C allele 126 bp (not digested) (H268Y)(rs7439366) CTTAGGCAGGGGTTTGGCA T allele 84 bp and 24 bp CYP2C8 G416A TTTTTATTAGGAATCATTTC 1 min at 48°C BseRI G allele 110 bp, 40 bp and 20 bp (R139K)(rs11572080) AGTCACCCACCCTTGGTTTT A allele150 bp and 20 bp CYP2C8 C792G AAAAATGTTGCTCTTACACG 1 min at 55°C TaqI C allele 90 bp and 35 bp (I264M)(rs1058930) ATTTTACCTGCTCCATTTTG G allele 125 bp (not digested) CYP2C8 A1196G ACTACTTCTCCTCACTTCTG 1 min at 57°C SSCP assay 277 bp product (K399R)(rs10509681) TGCCATGTAAATTCCAACTA ABCC2 G-1023A TTAGCTAGGATACTGCATGGG 1 min at 62°C StyI G allele 306 bp and 204 bp (rs17216114) GTGGCATCAGTCGCTAGAAA A allele 510 bp (not digested) ABCC2 C-24T TGTCCATCCACTGTTTCAATG 1 min at 58°C TaqI C allele 174 bp and 19 bp (rs717620) CTGGACTGCGTCTGGATC T allele 193 bp (not digested) ABCC2 G1249A TCACTTCCTGAGCTTCCTCTTC 1 min at 62°C HpyCH4III G allele 165 bp, 118 bp, 12 bp (V417I)(rs2273697) TGGGATTACAAGCACCATCA A allele 165 bp, 130 bp ABCC2 T3563A CCCCAGTCTTCTCATTGGTC 1 min at 62°C HphI T allele 216 bp, 120 bp, 23 bp, (V1188E)(rs8187694) CACCTGTTGGAGGTGATCCA A allele 216 bp, 141 bp, 23 bp ABCC2 G4544A TCCTGGTTATTCTTATAAATGCCTA 1 min at 60°C RsaI G allele 307 bp, 71 bp, 22 bp (C1515Y)(rs8187710) ACAATCGAGGGGTTTCTCAA A allele 196 bp, 111 bp, 71 bp, 22 bp A mismatch in the primer sequence is indicated by an underlined nucleotide. Login to comment
99 ABCC2 Genotype Frequencies in Cases and Controls W/W W/M M/M OR for possession of variant P ABCC2 G-1023A Cases (n ϭ 24) 17 (0.71) 7 (0.29) 0 Hospital controls (n ϭ 46) 41 (0.89) 3 (0.07) 2 (0.04) 3.38 (0.94-2.14) .09 Community controls (n ϭ100) 71 (0.71) 25 (0.25) 4 (0.04) 1.0 (0.38-2.69) 1.0 ABCC2 C-24T Cases (n ϭ 24) 7 (0.29) 15 (0.62) 2 (0.08) Hospital controls (n ϭ 46) 31 (0.67) 12 (0.26) 3 (0.13) 5.02 (1.71-14.7) .005 Community controls (n ϭ 100) 72 (0.72) 25 (0.25) 3 (0.03) 6.25 (2.38-16.7) .0002 G1249A (V417I) Cases (n ϭ 24) 19 (0.79) 4 (0.17) 1 (0.04) Hospital controls (n ϭ 46) 31 (0.67) 11 (0.24) 4 (0.08) 0.54 (0.17-1.74) .4 Community controls (n ϭ 100) 69 (0.69) 30 (0.30) 1 (0.01) 0.57 (0.2-1.71) .5 T3563A (V1188E) Cases (n ϭ 24) 22 (0.92) 2 (0.08) 0 Hospital controls (n ϭ 46) 41 (0.91) 5 (0.11) 0 0.75 (0.13-4.16) 1.0 Community controls (n ϭ 100) 88 (0.88) 11 (0.11) 1 (0.01) 0.67 (0.14-3.24) 1.0 Table 8. Login to comment

[hide] Association between ABCC2 gene haplotypes and teno... J Infect Dis. 2006 Dec 1;194(11):1481-91. Epub 2006 Oct 26. Izzedine H, Hulot JS, Villard E, Goyenvalle C, Dominguez S, Ghosn J, Valantin MA, Lechat P, Deray AG
Association between ABCC2 gene haplotypes and tenofovir-induced proximal tubulopathy.
J Infect Dis. 2006 Dec 1;194(11):1481-91. Epub 2006 Oct 26., [PMID:17083032]

Abstract [show]
BACKGROUND: Tenofovir disoproxil fumarate (TDF) may induce renal proximal tubulopathy (rPT). There are no data on pharmacogenomic predictors of rPT in the genes encoding the multidrug-resistance protein (MRP) 2 and MRP4 transporters. METHODS: Mutational screening of the genes for MRP2 (ABCC2) and MRP4 (ABCC4) was performed using genomic DNA from 13 human immunodeficiency virus type 1 (HIV-1)-infected patients (group 1) presenting with TDF-induced rPT. Concomitantly, 17 unrelated HIV-1-infected patients who had received TDF therapy and who did not have rPT (group 2) were included in a case-control analysis, to assess the influence of single-nucleotide polymorphisms (SNPs) identified in ABCC2 and ABCC4. RESULTS: Six SNPs were identified in ABCC2. A significant allelic association between the 1249 G-->A SNP and TDF-induced rPT was observed (odds ratio, 6.11 [95% confidence interval, 1.19-31.15]; P<.02). ABCC2 haplotypes were significantly associated with the onset of TDF-induced rPT--CATC appeared to be a predisposing haplotype, as it was found in 40.9% of the group 1 case patients and in 13.7% of the group 2 control subjects (P<.01), whereas CGAC appeared to be a protective haplotype, as it was not observed in the group 1 case patients but was present in 20.2% of the group 2 control subjects (P<.01). No association was observed between ABCC4 polymorphism and TDF-induced rPT in the present study. CONCLUSION: ABCC2 haplotypes are associated with rPT induced by TDF in HIV-1-infected patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 The 3563 TrA SNP (Val1188Glu; rs8187694) in exon 25 and the 4544 GrA SNP (Cys1515Tyr; rs8187710) in exon 32 of ABCC2 were genotyped by restriction fragment-length Table 2. Login to comment
77 (%) P Group 1 (n p 13) Group 2 (n p 17) ABCC2 Exon 1, -24 CrT (rs717620) … Genotype .29 CC 9 (69) 11 (64) CT 3 (23) 5 (29) TT 1 (8) 1 (6) Allele C 21 (80.8) 27 (79.4) T 5 (19.2) 7 (20.6) Exon 9, 1058 GrA (rs7080681) Arg353His Genotype .43 GG 12 (92) 17 (100) GA 1 (8) 0 AA 0 0 Allele G 25 (96.2) 34 (100) A 1 (3.8) 0 Exon 10, 1249 GrA (rs2273697) Val417Ile Genotype .02 GG 3 (23) 11 (64) GA 9 (69) 6 (35) AA 1 (8) 0 Allele G 15 (57.7) 28 (82.4) A 11 (42.3) 6 (17.6) Exon 25, 3563 TrA (rs8187694) Val1188Glu Genotype .01 TT 13 (100) 10 (59) TA 0 6 (35) AA 0 1 (6) Allele T 26 (100) 26 (76.5) A 0 8 (23.5) Exon 28, 3972 CrT (rs3740066) Ile1324Ile Genotype .96 CC 6 (46) 8 (47) CT 4 (31) 7 (41) TT 3 (23) 2 (12) Allele C 16 (61.5) 23 (67.7) T 10 (38.5) 11 (32.3) Exon 32, 4544 GrA (rs8187710) Cys1515Tyr Genotype .01 GG 13 (100) 10 (59) GA 0 6 (35) AA 0 1 (6) Allele G 26 (100) 26 (76.5) A 0 8 (23.5) ABCC4 Exon 5, 559GrT (rs11568658) Gly187Trp Genotype .07 GG 10 (77) 17 (100) GT 3 (23) 0 TT 0 0 Allele G 23 (88.5) 34 (100) T 3 (11.5) 0 (continued) 1485 Table 2. Login to comment
166 In a study by Wojnowski et al. [39], the 2 missense polymorphisms 3563 TrA (Val1188Glu) and 4544 GrA (Cys1515Tyr) in ABCC2 were associated with anthracycline- induced cardiotoxicity; these SNPs were found at a similar allelic frequency in our study patients (23.5% vs. 15% [39]) but were observed only in group 2 and not in group 1. Login to comment

[hide] Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found... Drug Metab Dispos. 2002 Apr;30(4):363-4. Itoda M, Saito Y, Soyama A, Saeki M, Murayama N, Ishida S, Sai K, Nagano M, Suzuki H, Sugiyama Y, Ozawa S, Sawada Ji J
Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28.
Drug Metab Dispos. 2002 Apr;30(4):363-4., [PMID:11901087]

Abstract [show]
We found nucleotide variability in the 5'-upstream region and exonic sequences of a gene-encoding canalicular multispecific organic anion transporter/multidrug resistance-associated protein 2 (cMOAT/MRP2) by polymerase chain reaction-based sequencing using genomic DNA from 72 established cell lines derived from 72 Japanese individuals. Four single nucleotide polymorphisms (SNPs) were found in the 5'-untranslational region and 21 in the exonic regions. Of them, 14 were nonsynonymous SNPs. One deletion of seven consecutive adenines resulting in a frameshift variant was also found. Four SNPs, c-24t, g1249a (V417I), c2366t (S789F), and c3972t (I1324I), were the same as those recently reported. A strong association was found between c-24t (5'-untranslated region) and c3972t (exon 28), with the promoter activity of the former worth being compared.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region. Login to comment

[hide] Polymorphism in multidrug resistance-associated pr... Pharmacogenomics J. 2012 Oct;12(5):386-94. doi: 10.1038/tpj.2011.17. Epub 2011 May 24. Ansari M, Sauty G, Labuda M, Gagne V, Rousseau J, Moghrabi A, Laverdiere C, Sinnett D, Krajinovic M
Polymorphism in multidrug resistance-associated protein gene 3 is associated with outcomes in childhood acute lymphoblastic leukemia.
Pharmacogenomics J. 2012 Oct;12(5):386-94. doi: 10.1038/tpj.2011.17. Epub 2011 May 24., [PMID:21606946]

Abstract [show]
Multidrug resistance-related proteins (MRPs) 2, 3 and 5 are involved in the efflux of drugs used in acute lymphoblastic leukemia (ALL) treatment. Polymorphisms of these genes were investigated for an association with treatment responses in 273 childhood ALL patients. The MRP3 A-189 allele of the regulatory AT polymorphism was associated with reduced event-free survival (P=0.01). The results remained significant after adjustment for multiple comparisons and in the multivariate analysis. Among patients with an event, the A-189 carriers had significantly higher methotrexate plasma levels (P=0.03). MRP3 A-189 also conferred four times higher risk of a relapse in central nervous system (P=0.01). Patients with this allele tended to have lower frequency of thrombocytopenia grade 2 (P=0.06). Gene reporter assay showed that the haplotype tagged by the A-189 had higher promoter activity (P</=0.01). In conclusion, MRP3 A-189 T polymorphism was associated with treatment responses in ALL, likely due to the change in MRP3 efflux.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 A false discovery rate correction was performed to adjust for multiple comparisons using Q-value Table 1 Identity of polymorphisms, details of PCR and ASO hybridization Polymorphisms PCR ASO Gene dbSNP Position Variation Primers Probes MRP2 rs1885301 À1519 A/G F: 50 -TCATATACCTGTTGGCCATT-30 50 -TATAGTATGTTGTGGATA-30 R: 50 -GTATGGACCTTGTTACTGAT-30 50 -TATAGTATATTGTGGATA-30 rs7910642 À993 G/A F: 50 -TTAGCTAGGATACCGCATGG-30 50 -AGGCCAAGGCAGAAGGA-30 R: 50 -ATGTTTTCTGTAGGGACGGG-30 50 -AGGCCAAGACAGAAGGA-30 rs2804402 À989 C/T F: 50 -ATGTTTTCTGTAGGGACGGG-30 50 -AACAATCCTTCTGCCTTG-30 R: 50 -TTAGCTAGGATACCGCATGG-30 50 -AACAATCCTCCTGCCTTG-30 rs717620 À24 G/A F: 50 -CCACTTGTTCTGAGTCTGAG-30 50 -TCTGGAACGAAGACTC-30 R: 50 -GGTCATCCTTTACGGAGAAC-30 50 -TCTGGAACAAAGACTC-30 rs2273697 1249 G/A (Val417Ile) F: 50 -GTGTCCATATGGAGCACATC-30 50 -AGTACACCGTTGGAGA-30 R: 50 -TACAAGCACCATCACCCCAA-30 50 -AGTACACCATTGGAGA-30 rs17222723 3563 T/A (Val1188Glu) F: 50 -ATGGTGGATGCCTCATGACT-30 50 -CAATGAGGTGAGGATTG-30 R: 50 -GTGTGTGGCCAGAGTGAATT-30 50 -CAATGAGGAGAGGATTG-30 rs8187710 4544 A/G (Cys1515Tyr) F: 50 -TCAGGGTAATGGTCCTAGAC-30 50 -TATAGAGTGCGGCAGCC-30 R: 50 -TCCTTTTCTAACCCATGGGG-30 50 -TATAGAGTACGGCAGCC-30 MRP3 rs1989983 À1696 A/G F: 50 -CATGACCAGGGTCATGGAAG-30 50 -TCCCAGAGGCATCAAGG-30 R: 50 -GCTAATCTGAGAGGTCCCCA-30 50 -TCCCAGAGACATCAAGG-30 rs9895420 À189 A/T F: 50 -GTGGGAGCGCCTGTGTATCC-30 50 -TCCCCCTGGCTTGGCCCA-30 R: 50 -AGTGCCTCTGGGTCCGGTCT-30 50 -TCCCCCTGGCATGGCCCA-30 rs4793665 À140 C/T F: 50 -GTGGGAGCGCCTGTGTATCC-30 50 -AAGGGCCCCCCCACCTCT-30 R: 50 -AGTGCCTCTGGGTCCGGTCT-30 50 -AAGGGCCCCCCTACCTCT-30 rs11568591 3890 G/A (Arg1297His) F: 50 -ATCTGCCCCTCCTGCCAGGC-30 50 -TATTCTGTGCGCTACCG-30 R: 50 -CGCCTACCCCACGCGTACCT-30 50 -TATTCTGTGCACTACCG-30 MRP5 rs7627754 À1629 A/T F: 50 -GAACTTGGGAGTAGGAAAGA-30 50 -GAATAATAAATATTCAAA-30 R: 50 -GGCTGCTCAAGTTTCCTATT-30 50 -GAATAATAATTATTCAAA-30 rs1520195 À1155 T/C F: 50 -TGGATGCACCAGTCTGTTTG-30 50 -ACTAGCTAGCTGTTATAA-30 R: 50 -CTCACCCCGCCGTATTTTTT-30 50 -ACTAGCTAGTTGTTATAA-30 rs562 5638 C/T F: 50 -CACTCCCTTCCCAGAGAATT-30 50 -CCATTCAATTGATGACAG-30 R: 50 -AAGAGACCTACCTCAGGTTG-30 50 -CCATTCAACTGATGACAG-30 Abbreviations: ASO, allele-specific oligonucleotide; F, forward; MRP, multidrug resistance-related protein; R, reverse; SNP, single-nucleotide polymorphism. Login to comment
131 Several polymorphisms have been widely studied in MRP2 gene including 50 UTR C-24 T substitution and non-synonymous G1249A, T3563A and G4544A variations leading to Val417Ile, Val1188Glu and Cys1515Tyr amino-acid replacements, respectively. Login to comment
135 MRP2 Val417Ile was associated with an increased intestinal efflux and a significant decreased bioavailability of the b-blocker talinolol,44,49 in line with the observation of a higher gastrointestinal toxicity of MTX in African Americans treated for rheumatoid arthritis.50 Val1188Glu and Cys1515Tyr correlated with higher mRNA and protein expression in liver51 and with anthracycline-induced cardiotoxicity in non-Hodgkin lymphoma patients.52 We did not find significant association of these polymorphisms with endpoints studied in our ALL patients. Login to comment

[hide] A novel multidrug-resistance protein 2 gene mutati... Hepatology. 2006 May;43(5):1152-4. Floreani A, Carderi I, Variola A, Rizzotto ER, Nicol J, Bergasa NV
A novel multidrug-resistance protein 2 gene mutation identifies a subgroup of patients with primary biliary cirrhosis and pruritus.
Hepatology. 2006 May;43(5):1152-4., [PMID:16628674]

Abstract [show]
A single nucleotide polymorphism characterized by the substitution of valine for glutamate (V1188E) in exon 25 of the multidrug resistance protein 2 gene was found in a group of patients with primary biliary cirrhosis. This heterozygous mutation was significantly associated with the presence of pruritus.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 This mutation resulted from the substitution of valine by glutamate (V1188E) (Fig. 1). Login to comment
34 V1188E was identified in 17 of 87 (19.5%) patients who reported pruritus, and in 7 of 90 patients who did not (7.8%) (P ϭ .02, RR ϭ 2.51, 95% CI: 1.13-5.69). Login to comment
35 In the patients from Italy, the V1188E mutation was present in 13 of 39 (33.3%) patients with pruritus and in 6 of 62 (9.7%) patients without pruritus (P ϭ .003, RR ϭ 3.44, 95% CI: 1.47-8.20). Login to comment
37 Discussion We identified a novel polymorphism in exon 25, in which valine was substituted by glutamate in position 1188 (V1188E) in the gene that codes for MRP2. Login to comment
41 This mutation led to the substitution of valine by glutamate (V1188E). Login to comment
43 Frequency of the V1188E Polymorphism in Patients With PBC From Italy and From the United States (US) and in Controls Wt/Mutation N/Total (%) US PBC 5/76 (6.6%)* Italian PBC 19/101 (18.8%) Italian controls 12/101 (11.9%) *US PBC vs. Italian PBC: P ϭ .02. Login to comment
45 Frequency of the V1188E Polymorphism and Pruritus in Patients With PBC Symptom and Genotype Total PBC Population (N ‫؍‬ 177) PBC Patients From Italy (N ‫؍‬ 101) PBC Patients From the United States (N ‫؍‬ 76) Pruritus wt/m 17 (19.5%) 13 (33.3%) 4 (8.3%) wt/wt 70 (80.5%) 26 (66.7%) 44 (91.7%) Total 87 (100%) 39 (100%) 48 (100%) No pruritus wt/m 7 (7.8%) 6 (9.7%) 1 (3.6%) wt/wt 83 (92.2%) 56 (90.3%) 27 (96.4%) Total 90 (100%) 62 (100%) 28 (100%) RR (95%CI) 2.51 (1.13-5.69) 3.44 (1.47-8.20) 2.33 (0.37-15.4) P value (pruritus vs. no pruritus) .02 .003 .42 HEPATOLOGY, Vol. 43, No. Login to comment
47 V1188E was associated with pruritus in the patients with PBC. Login to comment
48 MRP2 is a membrane protein with 1,545 amino acids and contains 17 transmembrane (TM) segments organized into three membrane-spanning domains (MSD0, MSD1, MSD2).8 The V1188E polymorphism is located in the MSD2 membrane-spanning domain, in the cytoplasmic loop linking TM15 and TM16. Login to comment
50 Although photoaffinity labeling studies have not as yet been reported forMRP2,inferencesaboutsubstratebindingsiteshavebeen made on the basis of site-directed mutagenesis.9 These studies indicate the involvement of several TM segments, including T16 in the human protein and in the rat.10,11 Finally, the novel V1188E mutation located in the cytoplasmic loop between T15 and T16 might reduce the ability of the protein to transport substrates. Login to comment
51 A pathogenic role of this mutation alone is doubtful, as the frequency of V1188E in controls is similar to that of patients with PBC in the Italian group of subjects; however, the development of pruritus in any of these control subjects were they to develop cholestasis is unknown. Login to comment
54 Possible mechanisms by which V1188E affects the development of pruritus of cholestasis include alterations in the transport of pruritogen(s) or its cofactors from the hepatocyte into bile or into the central nervous system. Login to comment

[hide] ABCC1 polymorphisms in anthracycline-induced cardi... Cell Biol Int. 2012 Jan;36(1):79-86. Semsei AF, Erdelyi DJ, Ungvari I, Csagoly E, Hegyi MZ, Kiszel PS, Lautner-Csorba O, Szabolcs J, Masat P, Fekete G, Falus A, Szalai C, Kovacs GT
ABCC1 polymorphisms in anthracycline-induced cardiotoxicity in childhood acute lymphoblastic leukaemia.
Cell Biol Int. 2012 Jan;36(1):79-86., [PMID:21929509]

Abstract [show]
Anthracyclines are potent cytostatic drugs, the correct dosage being critical to avoid possible cardiac side effects. ABCC1 [ATP-binding cassette, sub-family C, member 1; also denoted as MRP1 (multidrug resistance-associated protein 1)] is expressed in the heart and takes part in the detoxification and protection of cells from the toxic effects of xenobiotics, including anthracyclines. Our objective was to search for associations between LV (left ventricular) function and single-nucleotide polymorphisms of the ABCC1 gene in children receiving anthracycline chemotherapy. Data of 235 paediatric patients with acute lymphoblastic leukaemia was analysed. Patients were followed-up by echocardiography (median follow-up 6.3 years). Nine polymorphisms in the ABCC1 gene were genotyped. The ABCC1 rs3743527TT genotype and rs3743527TT-rs246221TC/TT genotype combination were associated with lower LVFS (left ventricular fractional shortening) after chemotherapy. The results suggest that genetic variants in the ABCC1 gene influence anthracycline-induced LV dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 This study found an association between chronic anthracycline-induced cardiotoxicity and a polymorphism in the NAD(P)H oxidase subunit NFC4 (rs1883112), and between: acute anthracycline-induced cardiotoxicity and the NAD(P)H oxidase subunits CYBA (rs4673) and RAC2 (rs1305 8338); and the ABC transporter ABCC1 Gly671Val variant (which is rs45511401) and the Val1188Glu-Cys1515Tyr (rs8187694- rs8187710) haplotype of the ABCC2 gene. Login to comment

[hide] Genetic variability in the multidrug resistance as... Ann Oncol. 2013 Jun;24(6):1513-25. doi: 10.1093/annonc/mdt008. Epub 2013 Feb 7. Vulsteke C, Lambrechts D, Dieudonne A, Hatse S, Brouwers B, van Brussel T, Neven P, Belmans A, Schoffski P, Paridaens R, Wildiers H
Genetic variability in the multidrug resistance associated protein-1 (ABCC1/MRP1) predicts hematological toxicity in breast cancer patients receiving (neo-)adjuvant chemotherapy with 5-fluorouracil, epirubicin and cyclophosphamide (FEC).
Ann Oncol. 2013 Jun;24(6):1513-25. doi: 10.1093/annonc/mdt008. Epub 2013 Feb 7., [PMID:23396606]

Abstract [show]
BACKGROUND: To assess the impact of single-nucleotide polymorphisms (SNPs) on predefined severe adverse events in breast cancer (BC) patients receiving (neo-)adjuvant 5-fluorouracil (FU), epirubicin and cyclophosphamide (FEC) chemotherapy. PATIENTS AND METHODS: Twenty-six SNPs in 16 genes of interest, including the drug transporter gene ABCC1/MRP1, were selected based on a literature survey. An additional 33 SNPs were selected in these genes, as well as in 12 other genes known to be involved in the metabolism of the studied chemotherapeutics. One thousand and twelve female patients treated between 2000 and 2010 with 3-6 cycles of (neo-)adjuvant FEC were genotyped for these SNPs using Sequenom MassARRAY. Severe adverse events were evaluated through an electronic chart review for febrile neutropenia (FN, primary end point), FN first cycle, prolonged grade 4 or deep (<100/microl) neutropenia, anemia grade 3-4, thrombocytopenia grade 3-4 and non-hematological grade 3-4 events (secondary end points). RESULTS: Carriers of the rs4148350 variant T-allele in ABCC1/MRP1 were associated with FN relative to homozygous carriers of the G-allele [P = 0.0006; false discovery rate (FDR) = 0.026]. Strong correlations with secondary end points such as prolonged grade 4 neutropenia (P = 0.002, FDR = 0.046) were also observed. Additionally, two other SNPs in ABCC1/MRP1 (rs45511401 and rs246221) correlated with FN (P = 0.007 and P = 0.01, respectively; FDR = 0.16 and 0.19), as well as two SNPs in UGT2B7 and FGFR4 (P = 0.024 and P = 0.04; FDR = 0.28 and 0.38). CONCLUSION: Genetic variability in ABCC1/MRP1 was associated with severe hematological toxicity of FEC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 rs17222723 c.3563T>A Val1188Glu rs2273697 c.1249G>A Val417Ile DPD Dihydropirymidine dehydrogenase Enzyme involved in the degradation of pyrimidine and uracil analogs during 5-FU chemotherapy rs1801159 c.1627A>G Ile543Val Selected because missense mutations are likely to affect gene function. Login to comment