ABCC8 p.Leu1551Val
| Predicted by SNAP2: | A: D (59%), C: N (57%), D: D (85%), E: D (80%), F: N (82%), G: D (66%), H: D (71%), I: N (57%), K: D (75%), M: N (93%), N: D (75%), P: D (75%), Q: D (71%), R: D (71%), S: D (66%), T: D (53%), V: N (57%), W: D (75%), Y: D (71%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: N, G: D, H: D, I: N, K: D, M: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Sulfonylureas correct trafficking defects of ATP-s... J Biol Chem. 2004 Mar 19;279(12):11096-105. Epub 2004 Jan 5. Yan F, Lin CW, Weisiger E, Cartier EA, Taschenberger G, Shyng SL
Sulfonylureas correct trafficking defects of ATP-sensitive potassium channels caused by mutations in the sulfonylurea receptor.
J Biol Chem. 2004 Mar 19;279(12):11096-105. Epub 2004 Jan 5., [PMID:14707124]
Abstract [show]
The pancreatic ATP-sensitive potassium (K(ATP)) channel, a complex of four sulfonylurea receptor 1 (SUR1) and four potassium channel Kir6.2 subunits, regulates insulin secretion by linking metabolic changes to beta-cell membrane potential. Sulfonylureas inhibit K(ATP) channel activities by binding to SUR1 and are widely used to treat type II diabetes. We report here that sulfonylureas also function as chemical chaperones to rescue K(ATP) channel trafficking defects caused by two SUR1 mutations, A116P and V187D, identified in patients with congenital hyperinsulinism. Sulfonylureas markedly increased cell surface expression of the A116P and V187D mutants by stabilizing the mutant SUR1 proteins and promoting their maturation. By contrast, diazoxide, a potassium channel opener that also binds SUR1, had no effect on surface expression of either mutant. Importantly, both mutant channels rescued to the cell surface have normal ATP, MgADP, and diazoxide sensitivities, demonstrating that SUR1 harboring either the A116P or the V187D mutation is capable of associating with Kir6.2 to form functional K(ATP) channels. Thus, sulfonylureas may be used to treat congenital hyperinsulinism caused by certain K(ATP) channel trafficking mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
293 Comparison with Other Trafficking Mutants-A number of missense or point deletion mutations in SUR1 have been reported to reduce or prevent cell surface expression of KATP channels, including ⌬F1388, R1394H, L1544P, A1457T, V1550D, and L1551V (34-36, 50).
X
ABCC8 p.Leu1551Val 14707124:293:242
status: NEW290 Comparison with Other Trafficking Mutants-A number of missense or point deletion mutations in SUR1 have been reported to reduce or prevent cell surface expression of KATP channels, including èc;F1388, R1394H, L1544P, A1457T, V1550D, and L1551V (34-36, 50).
X
ABCC8 p.Leu1551Val 14707124:290:241
status: NEW[hide] Acute insulin response tests for the differential ... J Clin Endocrinol Metab. 2002 Oct;87(10):4502-7. Huopio H, Jaaskelainen J, Komulainen J, Miettinen R, Karkkainen P, Laakso M, Tapanainen P, Voutilainen R, Otonkoski T
Acute insulin response tests for the differential diagnosis of congenital hyperinsulinism.
J Clin Endocrinol Metab. 2002 Oct;87(10):4502-7., [PMID:12364426]
Abstract [show]
Mutations in genes encoding the two subunits of the beta-cell ATP-sensitive potassium channel (K(ATP)) channel (SUR1 and Kir6.2) are the major cause of congenital hyperinsulinism (CHI). In this study, the K(ATP) channel genes were screened in a population-based study that included all verified Finnish CHI patients (n = 43) in a 27-yr period. Seven different mutations were identified, which accounted for 60% of all cases. The functional consequences of the major missense mutations were studied in vivo by determining acute (1-3 min) plasma insulin and C-peptide responses to calcium (n = 18), glucose (n = 12), and tolbutamide (n = 11) in those CHI patients who were able to take part in these studies. C-peptide and insulin responses to calcium were significantly higher in the patients with SUR1-E1506K mutation, compared with patients without K(ATP) channel mutations. The patients with SUR1-V187D mutation showed a reduced response to tolbutamide but unexpectedly did not show any response to calcium stimulation. A compound heterozygous patient with Kir6.2-(-54)/K67N mutations responded to calcium but also to tolbutamide. In conclusion, our results show that a positive response in the calcium test is indicative of a K(ATP) channel mutation, but all mutations cannot be identified with this method. The insulin response to tolbutamide in patients with SUR1 mutations is impaired to different extents, depending on the genotype. The combination of calcium and tolbutamide tests is a useful tool for the detection of CHI patients with K(ATP) channel dysfunction. Our results, however, also demonstrate the complexity of these responses and the difficulties in their interpretation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 The two compound heterozygotes with paternal L1551V were not willing to participate in the study.
X
ABCC8 p.Leu1551Val 12364426:42:45
status: NEW58 Clinical characteristics of the patients Case Sex Age Cause of hyperinsulinism Previous treatment of hyperinsulinism No KATP channel mutation 1 M 2 Unknown Diazoxide 2 F 3 Unknown Octreotide 3 M 5 Unknown Diazoxide 4 M 20 Unknown Diazoxide, subtotal pancreatectomy 5 F 26 Unknown Diazoxide Kir6.2-(-54)/K67N 6 M 8 Paternal Kir6.2-K67N, maternal Kir6.2-(-54) Octreotide, subtotal pancreatectomy SUR1-E1506K 7 F 6 Dominant maternal SUR1-E1506K Diazoxide 8 F 9 Dominant maternal SUR1-E1506K Diazoxide 9 F 15 Dominant maternal SUR1-E1506K Frequent feeds 10 F 16 Dominant maternal SUR1-E1506K Diazoxide 11 F 19 Dominant maternal SUR1-E1506K Frequent feeds 12 M 27 Dominant maternal SUR1-E1506K Diazoxide, subtotal pancreatectomy SUR1-V187D 13 F 1 Paternal SUR1-V187D, maternal genotype pending Octreotide 14 F 6 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 15 M 8 Paternal SUR1-V187D, maternal genotype pending Subtotal pancreatectomy 16 F 8 Homozygous SUR1-V187D Subtotal pancreatectomy 17 F 9 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 18 F 14 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 19 M 11 Paternal SUR1-V187D, maternal SUR1-A1457T Subtotal pancreatectomy 20 F 13 Paternal SUR1-V187D, maternal SUR1-V1550D Subtotal pancreatectomy SUR1-L1551V 21 M 2 Paternal SUR1-L1551V, maternal genotype pending Diazoxide 22 F 0.2 Paternal SUR1-L1551V, maternal genotype pending Diazoxide Diabetic patients are shown in italics.
X
ABCC8 p.Leu1551Val 12364426:58:1319
status: NEWX
ABCC8 p.Leu1551Val 12364426:58:1347
status: NEWX
ABCC8 p.Leu1551Val 12364426:58:1414
status: NEW84 The SUR1 mutation L1551V in exon 39 was detected heterozygously in two sisters, and we were unable to detect any mutation in the other SUR1 allele (cases 21 and 22).
X
ABCC8 p.Leu1551Val 12364426:84:18
status: NEW94 Primers, PCR conditions, and restriction endonucleases used in the detection of novel KATP channel mutations Substitution Primers (5Ј33Ј) PCR program (C/cycles) Size of the PCR product (bp) Restriction endonucleasea SUR1-A1457T ACCCTGCTCCCTCCTACTG 94-64-72/30 192 HphI GTCCTTGAGTGCCCAACC SUR1-V1550D GGGTGGTATTCCCACCATC 94-65-72/30 230 GTATGGGCAGGGTCCGAAT SUR1-L1551V GGGTGGTATTCCCACCATC 94-65-72/30 230 BseLI GTATGGGCAGGGTCCGAAT Kir6.2-(-54) ACCGAGAGGACTCTGCAGTGA 94-65-72/35 216 NlaIII GTTGCAGTTGCCTTTCTTGGA Kir6.2-K67N GAAAGGCAACTGCAACGTGG 94-58-72/30 278 BseNI TAGTCACTTGGACCTCAATG a The restriction endonuclease recognizing the mutation.
X
ABCC8 p.Leu1551Val 12364426:94:373
status: NEW113 The two subjects who were heterozygous for the SUR1 mutation L1551V had a milder form of CHI, which was responsive to diazoxide.
X
ABCC8 p.Leu1551Val 12364426:113:61
status: NEW[hide] Potassium channel regulation. EMBO Rep. 2003 Nov;4(11):1038-42. Campbell JD, Sansom MS, Ashcroft FM
Potassium channel regulation.
EMBO Rep. 2003 Nov;4(11):1038-42., [PMID:14593442]
Abstract [show]
The sulphonylurea receptor (SUR) is a member of the ATP-binding cassette (ABC) family of membrane proteins. It functions as the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which comprises SUR and Kir6.x proteins. Here, we review data demonstrating functional differences between the two nucleotide binding domains (NBDs) of SUR1. In addition, to explain the structural basis of these functional differences, we have constructed a molecular model of the NBD dimer of human SUR1. We discuss the experimental data in the context of this model, and show how the model can be used to design experiments aimed at elucidating the relationship between the structure and function of the KATP channel.
Comments [show]
None has been submitted yet.
No. Sentence Comment
107 Although some of these mutations prevent targeting of the protein to the plasma membrane, others, such as G1381S, R1420C, E1506K and L1551V (Fig. 3) cause CHI by impairing KATP channel activation in response to metabolic inhibition or MgADP (Huopio et al., 2000).
X
ABCC8 p.Leu1551Val 14593442:107:133
status: NEW111 In the absence of structural information, it was difficult to envisage why the L1551V mutation abolished KATP channel activation by MgATP and MgADP (Reimann et al., 2003), because in the primary sequence, L1551 is not positioned close to any functionally important conserved motifs.
X
ABCC8 p.Leu1551Val 14593442:111:79
status: NEW117 Site 1 Site 2 NDB1 NDB2 G1381S E1506K L1551V R1402C Fig. 3 | Location of congenital hyperinsulinism mutations in the nucleotide-binding domains of sulphonylurea receptor SUR1.
X
ABCC8 p.Leu1551Val 14593442:117:38
status: NEW[hide] Characterisation of new KATP-channel mutations ass... Diabetologia. 2003 Feb;46(2):241-9. Epub 2003 Jan 9. Reimann F, Huopio H, Dabrowski M, Proks P, Gribble FM, Laakso M, Otonkoski T, Ashcroft FM
Characterisation of new KATP-channel mutations associated with congenital hyperinsulinism in the Finnish population.
Diabetologia. 2003 Feb;46(2):241-9. Epub 2003 Jan 9., [PMID:12627323]
Abstract [show]
AIMS/HYPOTHESIS: ATP-sensitive potassium (K(ATP)) channels are crucial for the regulation of insulin secretion from pancreatic beta cells and mutations in either the Kir6.2 or SUR1 subunit of this channel can cause congenital hyperinsulinism (CHI). The aim of this study was to analyse the functional consequences of four CHI mutations (A1457T, V1550D and L1551V in SUR1, and K67N in Kir6.2) recently identified in the Finnish population. METHODS: Wild type or mutant Kir6.2 and SUR1 subunits were coexpressed in Xenopus oocytes. The functional properties of the channels were examined by measuring currents in intact oocytes or giant inside-out membrane patches. Surface expression was measured by enzyme-linked immunosorbance assay, using HA-epitope-tagged subunits. RESULTS: Two mutations (A1457T and V1550D) prevented trafficking of the channel to the plasma membrane. The L1551V mutation reduced surface expression 40-fold, and caused loss of MgADP and diazoxide activation. Both these factors will contribute to the lack of K(ATP) current activation observed in response to metabolic inhibition in intact oocytes. The L1551V mutation also increased the channel open probability, thereby producing a reduction in ATP-sensitivity (from 10 micro mol/l to 120 micro mol/l). The fourth mutation (K67N mutation in Kir6.2) did not affect surface expression nor alter the properties of K(ATP) channels in excised patches, but resulted in a reduced K(ATP) current amplitude in intact cells on metabolic inhibition, through an unidentified mechanism. CONCLUSION/INTERPRETATION: The four CHI mutations disrupted K(ATP) channel activity by different mechanisms. Our results are discussed in relation to the CHI phenotype observed in patients with these mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 The aim of this study was to analyse the functional consequences of four CHI mutations (A1457T, V1550D and L1551V in SUR1, and K67N in Kir6.2) recently identified in the Finnish population.
X
ABCC8 p.Leu1551Val 12627323:2:107
status: NEW9 The L1551V mutation reduced surface expression 40-fold, and caused loss of MgADP and diazoxide activation. Both these factors will contribute to the lack of KATP current activation observed in response to metabolic inhibition in intact oocytes.
X
ABCC8 p.Leu1551Val 12627323:9:4
status: NEW10 The L1551V mutation also increased the channel open probability, thereby producing a reduction in ATP-sensitivity (from 10 µmol/l to 120 µmol/l).
X
ABCC8 p.Leu1551Val 12627323:10:4
status: NEW40 Three of these mutations are found in the C-terminal domain of SUR1 (L1551V, A1457T and V1550D), and one is found in the N-terminus of Kir6.2 (K67N).
X
ABCC8 p.Leu1551Val 12627323:40:69
status: NEW94 Metabolic poisoning with 3 mmol/l azide induced a large increase in Kir6.2/SUR1 currents, a smaller increase in Kir6.2-K67N/SUR1 and Kir6.2/SUR1-L1551V currents, and no significant change in Kir6.2/SUR1-A1457T or Kir6.2/SUR1-V1550D currents.
X
ABCC8 p.Leu1551Val 12627323:94:145
status: NEW95 The increase in Kir6.2/ SUR1-L1551V current (3.1±0.7 fold, n=8) was comparable to that observed for Kir6.2∆C36 expressed in the absence of SUR (5.9±1.1 fold, n=5), but much smaller than that found for Kir6.2/SUR1 currents (89±15 fold, n=19).
X
ABCC8 p.Leu1551Val 12627323:95:29
status: NEW98 Kir6.2/SUR1 currents started to increase about 200 s after azide addition, and reached a steady state at about 700 s. Kir6.2/SUR1-L1551V currents showed a similar latency, but a very much slower rate of current increase.
X
ABCC8 p.Leu1551Val 12627323:98:130
status: NEW101 Addition of 340 µmol/l diazoxide, in the continued presence of azide, increased Kir6.2/SUR1 and Kir6.2-K67N/SUR1 currents but did not activate Kir6.2/ SUR1-L1551V, Kir6.2/SUR1-A1457T or Kir6.2/SUR1-V1550D currents.
X
ABCC8 p.Leu1551Val 12627323:101:161
status: NEW105 Latencies and times to steady state of azide-activated currents Latency (s) Time to steady n state (s) Kir6.2/SUR1 209±10 712±26 33 Kir6.2-K67N/SUR1 259±20 a 916±54 c 11 Kir6.2/SUR1-L1551V 203±40 NS 1430±30 c, d 6 Kir6.2∆C36 30±3 c 1890±90 c, d 6 Statistical significance is shown for comparison with wild type Kir6.2/SUR1: NS, non significant; a p<0.05, b p<0.01, c p<0.001.
X
ABCC8 p.Leu1551Val 12627323:105:202
status: NEW111 The L1551V mutation caused a tenfold reduction in current.
X
ABCC8 p.Leu1551Val 12627323:111:4
status: NEW116 Although coexpression of SUR1-L1551V resulted in detectable surface expression of Kir6.2-HA, the signal was about 40-fold lower than that found for wild-type SUR1.
X
ABCC8 p.Leu1551Val 12627323:116:30
status: NEW117 Thus, these mutations prevent (A1457T, V1550D) or reduce (L1551V) plasma membrane targeting of KATP channels expressed in oocytes.
X
ABCC8 p.Leu1551Val 12627323:117:58
status: NEW121 Pharmacological and nucleotide sensitivity of mutant channels. We next investigated the properties of Kir6.2-K67N/SUR1 and Kir6.2/SUR1-L1551V channels in detail.
X
ABCC8 p.Leu1551Val 12627323:121:135
status: NEW123 Kir6.2/SUR1-L1551V currents were inhibited by ATP with an IC50 of 119±12 µmol/l, and a Hill coeffi- 244 F. Reimann et al.: Characterisation of new KATP-channel mutations associated with congenital hyperinsulinism Fig. 2.
X
ABCC8 p.Leu1551Val 12627323:123:12
status: NEW125 Oocytes were co-injected (as indicated) with mRNAs encoding Kir6.2 plus either SUR1, SUR1-A1457T, SUR1-V1550D or SUR1-L1551V, or with Kir6.2-K67N plus SUR1, or with Kir6.2∆36 alone.
X
ABCC8 p.Leu1551Val 12627323:125:118
status: NEW127 Inset: mean whole-cell current amplitudes for Kir6.2-L1551V measured at -100 mV shown on an expanded scale cient of 0.99±0.10 (n=8; Fig. 4A).
X
ABCC8 p.Leu1551Val 12627323:127:53
status: NEW130 The block of Kir6.2/ SUR1-L1551V produced by MgADP reflects the inhibitory action of ADP on Kir6.2, which becomes evident when the stimulatory action of the nucleotide (mediated via SUR1) is abolished.
X
ABCC8 p.Leu1551Val 12627323:130:26
status: NEW131 Kir6.2/SUR1-L1551V channels were also unaffected by diazoxide and inhibited by tolbutamide to a lesser extent than wild type Kir6.2/SUR1 currents (Fig. 4B).
X
ABCC8 p.Leu1551Val 12627323:131:12
status: NEW132 The altered properties of Kir6.2/SUR1-L1551V channels might be attributable either to an increase in the channel open probability [25], or to a functional uncoupling of Kir6.2 from mutant SUR1.
X
ABCC8 p.Leu1551Val 12627323:132:38
status: NEW133 To distinguish between these possibilities, we measured the single-channel properties of Kir6.2/SUR1-L1551V expressed in oocytes.
X
ABCC8 p.Leu1551Val 12627323:133:101
status: NEW134 The L1551V mutation did not significantly affect the single-channel conductance, but increased the channel open probability (Po) from 0.22 [25] to 0.65.
X
ABCC8 p.Leu1551Val 12627323:134:4
status: NEW136 As discussed below, these effects probably explain the observed reduction in the inhibitory effects of both ATP and tolbutamide on Kir6.2/SUR1-L1551V currents.
X
ABCC8 p.Leu1551Val 12627323:136:143
status: NEW148 The number of oocytes is given above the bars. Statistical significance (t test) was tested against uninjected oocytes for Kir6.2HA coinjected with SUR1, SUR1-A1457T, SUR1-V1550D or SUR1-L1551V.
X
ABCC8 p.Leu1551Val 12627323:148:187
status: NEW151 Single-channel kinetics of Kir6.2/SUR1 and Kir6.2/ SUR1-L1551V channels Kir6.2/SUR1a Kir6.2/SUR1-L1551V Open probability (Po) 0.22 0.65±0.05 Mean open time (τo) (ms) 1.69 2.05±0.09 Mean short closed time (τf) (ms) 0.33 0.41±0.02 Mean long closed time (τs) (ms) 16.1 15.6±2.8 Percentage <s 18 2.2±0.4 Mean burst duration (ms) 13.5 109±22 a Kinetic parameters of single Kir6.2/SUR1 [24] and Kir6.2/ SUR1-L1551V channels (n=6) 246 F. Reimann et al.: Characterisation of new KATP-channel mutations associated with congenital hyperinsulinism Fig. 4A-C.
X
ABCC8 p.Leu1551Val 12627323:151:56
status: NEWX
ABCC8 p.Leu1551Val 12627323:151:97
status: NEWX
ABCC8 p.Leu1551Val 12627323:151:455
status: NEW152 (A) ATP-sensitivity of Kir6.2/SUR1-L1551V and Kir6.2-K67N/SUR1 currents. Mean ATP concentration-response relations for Kir6.2/SUR1 (n=5), Kir6.2/SUR1-L1551V (n=8), Kir6.2-K67N/SUR1 (n=4) and Kir6.2∆C36 (n=5) currents.
X
ABCC8 p.Leu1551Val 12627323:152:35
status: NEWX
ABCC8 p.Leu1551Val 12627323:152:150
status: NEW154 The line is the best fit of the data to the Hill equation for Kir6.2/SUR1-L1551V (IC50= 119±12 µmol/l, h=1.0±0.1) and Kir6.2-K67N/SUR1 (IC50= 6.9±0.8 µmol/l, h=0.9±0.1).
X
ABCC8 p.Leu1551Val 12627323:154:74
status: NEW156 (B) Effects of MgADP, tolbutamide and diazoxide on Kir6.2/SUR1, Kir6.2/ SUR1-L1551V and Kir6.2-K67N/SUR1 currents. Mean macroscopic slope conductance recorded in the presence of ADP (100 µmol/l), ATP (100 µmol/l), ATP plus diazoxide (100 and 340 µmol/l, respectively), or ATP plus ADP (100 µmol/l each), or tolbutamide (100 µmol/l), expressed as percentage of the slope conductance in control solution, for Kir6.2/SUR1, Kir6.2/ SUR1-L1551V and Kir6.2-K67N/SUR1 currents.
X
ABCC8 p.Leu1551Val 12627323:156:77
status: NEWX
ABCC8 p.Leu1551Val 12627323:156:458
status: NEW171 KATP channels containing the L1551V mutation in SUR1 had impaired surface expression and altered channel properties, including loss of MgADP activation. Both these factors are likely to reduce KATP channel activity in pancreatic beta cells.
X
ABCC8 p.Leu1551Val 12627323:171:29
status: NEW174 Kir6.2/SUR1-L1551V currents showed reduced sensitivity to ATP-inhibition, loss of activation by MgADP and diazoxide and impaired block by tolbutamide.
X
ABCC8 p.Leu1551Val 12627323:174:12
status: NEW176 The inhibitory effect of MgADP on Kir6.2/SUR1-L1551V currents was less than that observed when MgADP activation was abolished by mutation of the Walker A lysines in SUR1 [32, 33].
X
ABCC8 p.Leu1551Val 12627323:176:46
status: NEW179 The lower ATP sensitivity, loss of MgADP activation, and reduced surface expression probably all contribute to the smaller magnitude and slower activation of Kir6.2/SUR1-L1551V channels on metabolic poisoning in intact oocytes.
X
ABCC8 p.Leu1551Val 12627323:179:170
status: NEW188 The third mutation in SUR1 (L1551V) was found in two siblings, who had a milder form of CHI, which was responsive to diazoxide [23].
X
ABCC8 p.Leu1551Val 12627323:188:28
status: NEW189 The mild phenotype and diazoxide-sensitivity of these subjects is consistent with the finding that both siblings were heterozygous for the L1551V mutation and had an apparently normal second SUR1 allele.
X
ABCC8 p.Leu1551Val 12627323:189:139
status: NEW191 The subjects in this study inherited the L1551V mutation from their father, who is not known to have had CHI [23].
X
ABCC8 p.Leu1551Val 12627323:191:41
status: NEW193 However, if this were the case for the L1551V family, the hyperinsulinaemia should not have been sensitive to diazoxide, as the hyperplastic tissue would express only diazoxide-insensitive SUR1-L1551V subunits.
X
ABCC8 p.Leu1551Val 12627323:193:39
status: NEWX
ABCC8 p.Leu1551Val 12627323:193:194
status: NEW195 An alternative idea is that the phenotypic effect of the L1551V mutation depends on the genetic background of the individual, and that it produces CHI only in those people who carry polymorphisms in other genes that predispose towards enhanced insulin secretion.
X
ABCC8 p.Leu1551Val 12627323:195:57
status: NEW