ABCMdb

PMID: 12364426

Huopio H, Jaaskelainen J, Komulainen J, Miettinen R, Karkkainen P, Laakso M, Tapanainen P, Voutilainen R, Otonkoski T
Acute insulin response tests for the differential diagnosis of congenital hyperinsulinism.
J Clin Endocrinol Metab. 2002 Oct;87(10):4502-7., [PubMed]

Sentences

No. Mutations Sentence Comment

4 ABCC8 p.Glu1506Lys C-peptide and insulin responses to calcium were significantly higher in the patients with SUR1-E1506K mutation, compared with patients without KATP channel mutations. Login to comment 5 ABCC8 p.Val187Asp The patients with SUR1-V187D mutation showed a reduced response to tolbutamide but unexpectedly did not show any response to calcium stimulation. Login to comment 20 ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp Indeed, the previously reported SUR1 mutations V187D (3) and E1506K (14) are the cause of most genetically characterized CHI cases. Login to comment 21 ABCC8 p.Val187Asp The mutation SUR1-V187D leads to total loss of function of KATP channels and severe drug-resistant phenotype. Login to comment 22 ABCC8 p.Glu1506Lys In contrast, the dominantly inherited mutation SUR1-E1506K associates with milder diazoxide-responsive form of CHI. Login to comment 37 ABCC8 p.Glu1506Lys The third group consisted of six patients (aged 6-27 yr) carrying the dominant SUR1-E1506K mutation. Login to comment 39 ABCC8 p.Val187Asp The fourth group was composed of one homozygous and five compound heterozygote patients with the mutation SUR1-V187D (aged 1-14 yr). Login to comment 41 ABCC8 p.Val187Asp ABCC8 p.Val1550Asp ABCC8 p.Ala1457Thr The patients with paternal SUR1-V187D and maternal SUR1-A1457T (n ϭ 1) or SUR1-V1550D (n ϭ 1) were excluded from AIR tests because of the requirement of insulin more than 0.5 U/kg per day. Login to comment 42 ABCC8 p.Leu1551Val The two compound heterozygotes with paternal L1551V were not willing to participate in the study. Login to comment 43 ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp All pancreatectomized patients who were included in AIR tests had the diffuse form of CHI as judged by histopathological examination (no KATP channel mutation, n ϭ 1; Kir6.2-(-54)/K67N, n ϭ 1; SUR1-E1506K, n ϭ 1; SUR1-V187D, n ϭ 5). Login to comment 58 ABCC8 p.Glu1506Lys ABCC8 p.Glu1506Lys ABCC8 p.Glu1506Lys ABCC8 p.Glu1506Lys ABCC8 p.Glu1506Lys ABCC8 p.Glu1506Lys ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val1550Asp ABCC8 p.Ala1457Thr ABCC8 p.Leu1551Val ABCC8 p.Leu1551Val ABCC8 p.Leu1551Val Clinical characteristics of the patients Case Sex Age Cause of hyperinsulinism Previous treatment of hyperinsulinism No KATP channel mutation 1 M 2 Unknown Diazoxide 2 F 3 Unknown Octreotide 3 M 5 Unknown Diazoxide 4 M 20 Unknown Diazoxide, subtotal pancreatectomy 5 F 26 Unknown Diazoxide Kir6.2-(-54)/K67N 6 M 8 Paternal Kir6.2-K67N, maternal Kir6.2-(-54) Octreotide, subtotal pancreatectomy SUR1-E1506K 7 F 6 Dominant maternal SUR1-E1506K Diazoxide 8 F 9 Dominant maternal SUR1-E1506K Diazoxide 9 F 15 Dominant maternal SUR1-E1506K Frequent feeds 10 F 16 Dominant maternal SUR1-E1506K Diazoxide 11 F 19 Dominant maternal SUR1-E1506K Frequent feeds 12 M 27 Dominant maternal SUR1-E1506K Diazoxide, subtotal pancreatectomy SUR1-V187D 13 F 1 Paternal SUR1-V187D, maternal genotype pending Octreotide 14 F 6 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 15 M 8 Paternal SUR1-V187D, maternal genotype pending Subtotal pancreatectomy 16 F 8 Homozygous SUR1-V187D Subtotal pancreatectomy 17 F 9 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 18 F 14 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 19 M 11 Paternal SUR1-V187D, maternal SUR1-A1457T Subtotal pancreatectomy 20 F 13 Paternal SUR1-V187D, maternal SUR1-V1550D Subtotal pancreatectomy SUR1-L1551V 21 M 2 Paternal SUR1-L1551V, maternal genotype pending Diazoxide 22 F 0.2 Paternal SUR1-L1551V, maternal genotype pending Diazoxide Diabetic patients are shown in italics. Login to comment 82 ABCC8 p.Val187Asp ABCC8 p.Ala1457Thr The mutation A1457T in exon 36 was found to be maternally inherited in one compound heterozygote patient with the paternally inherited mutation SUR1-V187D (case 19). Login to comment 83 ABCC8 p.Val187Asp ABCC8 p.Val1550Asp The mutation V1550D in exon 39 of SUR1 was maternally inherited in one individual who also had paternally inherited SUR1-V187D (case 20). Login to comment 84 ABCC8 p.Leu1551Val The SUR1 mutation L1551V in exon 39 was detected heterozygously in two sisters, and we were unable to detect any mutation in the other SUR1 allele (cases 21 and 22). Login to comment 87 ABCC8 p.Val187Asp Despite two separate screening processes of the KATP channel genes, we were not able to identify another SUR1 mutation in the five SUR1-V187D compound heterozygote patients who were tested with the AIR tests. Login to comment 90 ABCC8 p.Val187Asp First, three of the patients (cases 14, 17, and 18) had inherited the V187D mutation from their mother, which is inconsistent with focal disease. Login to comment 94 ABCC8 p.Val1550Asp ABCC8 p.Ala1457Thr ABCC8 p.Leu1551Val Primers, PCR conditions, and restriction endonucleases used in the detection of novel KATP channel mutations Substitution Primers (5Ј33Ј) PCR program (C/cycles) Size of the PCR product (bp) Restriction endonucleasea SUR1-A1457T ACCCTGCTCCCTCCTACTG 94-64-72/30 192 HphI GTCCTTGAGTGCCCAACC SUR1-V1550D GGGTGGTATTCCCACCATC 94-65-72/30 230 GTATGGGCAGGGTCCGAAT SUR1-L1551V GGGTGGTATTCCCACCATC 94-65-72/30 230 BseLI GTATGGGCAGGGTCCGAAT Kir6.2-(-54) ACCGAGAGGACTCTGCAGTGA 94-65-72/35 216 NlaIII GTTGCAGTTGCCTTTCTTGGA Kir6.2-K67N GAAAGGCAACTGCAACGTGG 94-58-72/30 278 BseNI TAGTCACTTGGACCTCAATG a The restriction endonuclease recognizing the mutation. Login to comment 95 ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp in all study groups: 0.19 mmol/liter in CHI patients without KATP mutations, 0.23 mmol/liter in the patient with both Kir6.2 mutations, 0.17 mmol/liter in SUR1-E1506K patients, and 0.23 mmol/liter in SUR1-V187D patients. Login to comment 96 ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp The acute plasma C-peptide response to calcium was significantly increased in patients with SUR1-E1506K (159 Ϯ 28 pmol/liter), compared with either patients without KATP channel mutations (33 Ϯ 25 pmol/liter) (P Ͻ 0.05) or SUR1-V187D carriers (41 Ϯ 15 pmol/liter) (P Ͻ 0.05). Login to comment 97 ABCC8 p.Val187Asp The response to calcium was not significantly different between the SUR1-V187D carriers and patients without KATP channel mutations. Login to comment 98 ABCC8 p.Val187Asp It is obvious that the subjects with SUR1-V187D have very little remaining beta-cell function after the subtotal pancreatectomy and that this is maximally stimulated even under basal conditions. Login to comment 101 ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp The plasma insulin and C-peptide responses to tolbutamide appeared to be lower in subjects with SUR-V187D and SUR-E1506K channel mutations, compared with the subjects without KATP channel mutations, but the differences were not statistically significant because of the small number of observations. Login to comment 102 ABCC8 p.Glu1506Lys One of four patients with SUR1-E1506K showed a clear response to tolbutamide, but the response was low in all other cases. Login to comment 105 ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp It was clearly subnormal in the prepubertal SUR1-V187D homozygous patient (case 16) and in the postpubertal SUR1-E1506K heterozygotes. Login to comment 108 ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp The two previously reported founder SUR1 mutations, V187D (3) and E1506K (14), account for 88% of the genetically characterized cases. Login to comment 110 ABCC8 p.Val187Asp ABCC8 p.Val187Asp ABCC8 p.Val1550Asp ABCC8 p.Ala1457Thr Correlation between genotype and phenotype The verified compound heterozygote subjects (A1457T/ V187D and V1550D/V187D) show a very severe and drug-resistant disease phenotype. Login to comment 111 ABCC8 p.Val187Asp This is likely to be due to the total loss of channel activity by both of the novel mutations because we have shown that the mutation V187D alone does not cause any impairment of insulin secretion in heterozygous carriers (22). Login to comment 113 ABCC8 p.Leu1551Val The two subjects who were heterozygous for the SUR1 mutation L1551V had a milder form of CHI, which was responsive to diazoxide. Login to comment 115 ABCC8 p.Glu1506Lys Because no other mutations were detected in this family, the possibility remains that this diazoxide-responsive mutation could be inherited dominantly, analogous with the E1506K mutation (14). Login to comment 118 ABCC8 p.Glu1506Lys ABCC8 p.Val187Asp AIRs in nondiabetic patients shown as the means of the increments at 1 and 3 min Case Insulin response to calcium C-peptide response to calcium Insulin response to tolbutamide C-peptide response to tolbutamide Insulin response to glucose No KATP channel mutation 1 37 62 175 727 299 2 0 0 392 1099 607 3 20 49 139 5 38 101 906 1413 1438 Median 29 55 450 1132 453 Kir6.2-(-54)/K67N 6 284 652 491 1136 1083 SUR1-E1506K 7 62 147 127 306 197 8 55 171 476 1148 1001 9 36 77 34 36 105 10 83 265 34 93 75 11 42 200 26 33 74 Median 55 171 34 93 105 SUR1-V187D 13 10 80 166 550 216 16 5 30 1 8 42 Median 8 55 84 279 129 Reference values 1 Ϯ 4a 318 Ϯ 72b 252 Ϯ 54b (-12-25) (158-478) The individual results and median values are shown for each group, expressed as picomoles per liter. Login to comment 143 ABCC8 p.Glu1506Lys Consistent with this idea, subjects with SUR1-E1506K and the Kir6.2 mutations showed a significant response to calcium. Login to comment 147 ABCC8 p.Val187Asp Unexpectedly, subjects with SUR1-V187D did not respond to calcium stimulation. Login to comment 154 ABCC8 p.Val187Asp The C-peptide response to tolbutamide was severely decreased in SUR1-V187D subjects. Login to comment 155 ABCC8 p.Val187Asp This finding is in agreement with the previous results of ion channel recordings of beta-cells isolated from a SUR1-V187D homozygous patient. Login to comment 156 ABCC8 p.Val187Asp Unlike control cells that were activated by diazoxide and inhibited by tolbutamide, no actions of KATP channel agonists diazoxide or octreotide were seen in the cells with SUR1-V187D mutation (3). Login to comment 157 ABCC8 p.Glu1506Lys ABCC8 p.Glu1506Lys A diminished response to tolbutamide was also seen in the oldest SUR1-E1506K subjects, which may at least partly be explained by the natural course of E1506K- associated CHI. Login to comment 159 ABCC8 p.Glu1506Lys According to the recombinant KATP channel studies of the dominant SUR1-E1506K, the mutated channels were partially activated by diazoxide and further blocked by tolbutamide (14). Login to comment 161 ABCC8 p.Glu1506Lys However, the high response in our single case with Kir6.2 mutations and the variable response of SUR1-E1506K cases suggest that these patients would not be detected by this test alone. Login to comment 163 ABCC8 p.Val187Asp The results show, however, that a negative response to calcium stimulation does not exclude the possibility that a subject has a KATP channel mutation, as clearly demonstrated by the major Finnish SUR1 mutation V187D. Login to comment