ABCMdb

ABCC8 p.Leu1551Val

None has been submitted yet.

Publications

PMID: 14707124 [PubMed] Yan F et al: "Sulfonylureas correct trafficking defects of ATP-sensitive potassium channels caused by mutations in the sulfonylurea receptor."

No. Sentence Comment

293 Comparison with Other Trafficking Mutants-A number of missense or point deletion mutations in SUR1 have been reported to reduce or prevent cell surface expression of KATP channels, including ⌬F1388, R1394H, L1544P, A1457T, V1550D, and L1551V (34-36, 50). Login to comment
290 Comparison with Other Trafficking Mutants-A number of missense or point deletion mutations in SUR1 have been reported to reduce or prevent cell surface expression of KATP channels, including èc;F1388, R1394H, L1544P, A1457T, V1550D, and L1551V (34-36, 50). Login to comment

PMID: 12364426 [PubMed] Huopio H et al: "Acute insulin response tests for the differential diagnosis of congenital hyperinsulinism."

No. Sentence Comment

42 The two compound heterozygotes with paternal L1551V were not willing to participate in the study. Login to comment
58 Clinical characteristics of the patients Case Sex Age Cause of hyperinsulinism Previous treatment of hyperinsulinism No KATP channel mutation 1 M 2 Unknown Diazoxide 2 F 3 Unknown Octreotide 3 M 5 Unknown Diazoxide 4 M 20 Unknown Diazoxide, subtotal pancreatectomy 5 F 26 Unknown Diazoxide Kir6.2-(-54)/K67N 6 M 8 Paternal Kir6.2-K67N, maternal Kir6.2-(-54) Octreotide, subtotal pancreatectomy SUR1-E1506K 7 F 6 Dominant maternal SUR1-E1506K Diazoxide 8 F 9 Dominant maternal SUR1-E1506K Diazoxide 9 F 15 Dominant maternal SUR1-E1506K Frequent feeds 10 F 16 Dominant maternal SUR1-E1506K Diazoxide 11 F 19 Dominant maternal SUR1-E1506K Frequent feeds 12 M 27 Dominant maternal SUR1-E1506K Diazoxide, subtotal pancreatectomy SUR1-V187D 13 F 1 Paternal SUR1-V187D, maternal genotype pending Octreotide 14 F 6 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 15 M 8 Paternal SUR1-V187D, maternal genotype pending Subtotal pancreatectomy 16 F 8 Homozygous SUR1-V187D Subtotal pancreatectomy 17 F 9 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 18 F 14 Maternal SUR1-V187D, paternal genotype pending Subtotal pancreatectomy 19 M 11 Paternal SUR1-V187D, maternal SUR1-A1457T Subtotal pancreatectomy 20 F 13 Paternal SUR1-V187D, maternal SUR1-V1550D Subtotal pancreatectomy SUR1-L1551V 21 M 2 Paternal SUR1-L1551V, maternal genotype pending Diazoxide 22 F 0.2 Paternal SUR1-L1551V, maternal genotype pending Diazoxide Diabetic patients are shown in italics. Login to comment
84 The SUR1 mutation L1551V in exon 39 was detected heterozygously in two sisters, and we were unable to detect any mutation in the other SUR1 allele (cases 21 and 22). Login to comment
94 Primers, PCR conditions, and restriction endonucleases used in the detection of novel KATP channel mutations Substitution Primers (5Ј33Ј) PCR program (C/cycles) Size of the PCR product (bp) Restriction endonucleasea SUR1-A1457T ACCCTGCTCCCTCCTACTG 94-64-72/30 192 HphI GTCCTTGAGTGCCCAACC SUR1-V1550D GGGTGGTATTCCCACCATC 94-65-72/30 230 GTATGGGCAGGGTCCGAAT SUR1-L1551V GGGTGGTATTCCCACCATC 94-65-72/30 230 BseLI GTATGGGCAGGGTCCGAAT Kir6.2-(-54) ACCGAGAGGACTCTGCAGTGA 94-65-72/35 216 NlaIII GTTGCAGTTGCCTTTCTTGGA Kir6.2-K67N GAAAGGCAACTGCAACGTGG 94-58-72/30 278 BseNI TAGTCACTTGGACCTCAATG a The restriction endonuclease recognizing the mutation. Login to comment
113 The two subjects who were heterozygous for the SUR1 mutation L1551V had a milder form of CHI, which was responsive to diazoxide. Login to comment

PMID: 14593442 [PubMed] Campbell JD et al: "Potassium channel regulation."

No. Sentence Comment

107 Although some of these mutations prevent targeting of the protein to the plasma membrane, others, such as G1381S, R1420C, E1506K and L1551V (Fig. 3) cause CHI by impairing KATP channel activation in response to metabolic inhibition or MgADP (Huopio et al., 2000). Login to comment
111 In the absence of structural information, it was difficult to envisage why the L1551V mutation abolished KATP channel activation by MgATP and MgADP (Reimann et al., 2003), because in the primary sequence, L1551 is not positioned close to any functionally important conserved motifs. Login to comment
117 Site 1 Site 2 NDB1 NDB2 G1381S E1506K L1551V R1402C Fig. 3 | Location of congenital hyperinsulinism mutations in the nucleotide-binding domains of sulphonylurea receptor SUR1. Login to comment

PMID: 12627323 [PubMed] Reimann F et al: "Characterisation of new KATP-channel mutations associated with congenital hyperinsulinism in the Finnish population."

No. Sentence Comment

2 The aim of this study was to analyse the functional consequences of four CHI mutations (A1457T, V1550D and L1551V in SUR1, and K67N in Kir6.2) recently identified in the Finnish population. Login to comment
9 The L1551V mutation reduced surface expression 40-fold, and caused loss of MgADP and diazoxide activation. Both these factors will contribute to the lack of KATP current activation observed in response to metabolic inhibition in intact oocytes. Login to comment
10 The L1551V mutation also increased the channel open probability, thereby producing a reduction in ATP-sensitivity (from 10 µmol/l to 120 µmol/l). Login to comment
40 Three of these mutations are found in the C-terminal domain of SUR1 (L1551V, A1457T and V1550D), and one is found in the N-terminus of Kir6.2 (K67N). Login to comment
94 Metabolic poisoning with 3 mmol/l azide induced a large increase in Kir6.2/SUR1 currents, a smaller increase in Kir6.2-K67N/SUR1 and Kir6.2/SUR1-L1551V currents, and no significant change in Kir6.2/SUR1-A1457T or Kir6.2/SUR1-V1550D currents. Login to comment
95 The increase in Kir6.2/ SUR1-L1551V current (3.1±0.7 fold, n=8) was comparable to that observed for Kir6.2∆C36 expressed in the absence of SUR (5.9±1.1 fold, n=5), but much smaller than that found for Kir6.2/SUR1 currents (89±15 fold, n=19). Login to comment
98 Kir6.2/SUR1 currents started to increase about 200 s after azide addition, and reached a steady state at about 700 s. Kir6.2/SUR1-L1551V currents showed a similar latency, but a very much slower rate of current increase. Login to comment
101 Addition of 340 µmol/l diazoxide, in the continued presence of azide, increased Kir6.2/SUR1 and Kir6.2-K67N/SUR1 currents but did not activate Kir6.2/ SUR1-L1551V, Kir6.2/SUR1-A1457T or Kir6.2/SUR1-V1550D currents. Login to comment
105 Latencies and times to steady state of azide-activated currents Latency (s) Time to steady n state (s) Kir6.2/SUR1 209±10 712±26 33 Kir6.2-K67N/SUR1 259±20 a 916±54 c 11 Kir6.2/SUR1-L1551V 203±40 NS 1430±30 c, d 6 Kir6.2∆C36 30±3 c 1890±90 c, d 6 Statistical significance is shown for comparison with wild type Kir6.2/SUR1: NS, non significant; a p<0.05, b p<0.01, c p<0.001. Login to comment
111 The L1551V mutation caused a tenfold reduction in current. Login to comment
116 Although coexpression of SUR1-L1551V resulted in detectable surface expression of Kir6.2-HA, the signal was about 40-fold lower than that found for wild-type SUR1. Login to comment
117 Thus, these mutations prevent (A1457T, V1550D) or reduce (L1551V) plasma membrane targeting of KATP channels expressed in oocytes. Login to comment
121 Pharmacological and nucleotide sensitivity of mutant channels. We next investigated the properties of Kir6.2-K67N/SUR1 and Kir6.2/SUR1-L1551V channels in detail. Login to comment
123 Kir6.2/SUR1-L1551V currents were inhibited by ATP with an IC50 of 119±12 µmol/l, and a Hill coeffi- 244 F. Reimann et al.: Characterisation of new KATP-channel mutations associated with congenital hyperinsulinism Fig. 2. Login to comment
125 Oocytes were co-injected (as indicated) with mRNAs encoding Kir6.2 plus either SUR1, SUR1-A1457T, SUR1-V1550D or SUR1-L1551V, or with Kir6.2-K67N plus SUR1, or with Kir6.2∆36 alone. Login to comment
127 Inset: mean whole-cell current amplitudes for Kir6.2-L1551V measured at -100 mV shown on an expanded scale cient of 0.99±0.10 (n=8; Fig. 4A). Login to comment
130 The block of Kir6.2/ SUR1-L1551V produced by MgADP reflects the inhibitory action of ADP on Kir6.2, which becomes evident when the stimulatory action of the nucleotide (mediated via SUR1) is abolished. Login to comment
131 Kir6.2/SUR1-L1551V channels were also unaffected by diazoxide and inhibited by tolbutamide to a lesser extent than wild type Kir6.2/SUR1 currents (Fig. 4B). Login to comment
132 The altered properties of Kir6.2/SUR1-L1551V channels might be attributable either to an increase in the channel open probability [25], or to a functional uncoupling of Kir6.2 from mutant SUR1. Login to comment
133 To distinguish between these possibilities, we measured the single-channel properties of Kir6.2/SUR1-L1551V expressed in oocytes. Login to comment
134 The L1551V mutation did not significantly affect the single-channel conductance, but increased the channel open probability (Po) from 0.22 [25] to 0.65. Login to comment
136 As discussed below, these effects probably explain the observed reduction in the inhibitory effects of both ATP and tolbutamide on Kir6.2/SUR1-L1551V currents. Login to comment
148 The number of oocytes is given above the bars. Statistical significance (t test) was tested against uninjected oocytes for Kir6.2HA coinjected with SUR1, SUR1-A1457T, SUR1-V1550D or SUR1-L1551V. Login to comment
151 Single-channel kinetics of Kir6.2/SUR1 and Kir6.2/ SUR1-L1551V channels Kir6.2/SUR1a Kir6.2/SUR1-L1551V Open probability (Po) 0.22 0.65±0.05 Mean open time (τo) (ms) 1.69 2.05±0.09 Mean short closed time (τf) (ms) 0.33 0.41±0.02 Mean long closed time (τs) (ms) 16.1 15.6±2.8 Percentage <s 18 2.2±0.4 Mean burst duration (ms) 13.5 109±22 a Kinetic parameters of single Kir6.2/SUR1 [24] and Kir6.2/ SUR1-L1551V channels (n=6) 246 F. Reimann et al.: Characterisation of new KATP-channel mutations associated with congenital hyperinsulinism Fig. 4A-C. Login to comment
152 (A) ATP-sensitivity of Kir6.2/SUR1-L1551V and Kir6.2-K67N/SUR1 currents. Mean ATP concentration-response relations for Kir6.2/SUR1 (n=5), Kir6.2/SUR1-L1551V (n=8), Kir6.2-K67N/SUR1 (n=4) and Kir6.2∆C36 (n=5) currents. Login to comment
154 The line is the best fit of the data to the Hill equation for Kir6.2/SUR1-L1551V (IC50= 119±12 µmol/l, h=1.0±0.1) and Kir6.2-K67N/SUR1 (IC50= 6.9±0.8 µmol/l, h=0.9±0.1). Login to comment
156 (B) Effects of MgADP, tolbutamide and diazoxide on Kir6.2/SUR1, Kir6.2/ SUR1-L1551V and Kir6.2-K67N/SUR1 currents. Mean macroscopic slope conductance recorded in the presence of ADP (100 µmol/l), ATP (100 µmol/l), ATP plus diazoxide (100 and 340 µmol/l, respectively), or ATP plus ADP (100 µmol/l each), or tolbutamide (100 µmol/l), expressed as percentage of the slope conductance in control solution, for Kir6.2/SUR1, Kir6.2/ SUR1-L1551V and Kir6.2-K67N/SUR1 currents. Login to comment
171 KATP channels containing the L1551V mutation in SUR1 had impaired surface expression and altered channel properties, including loss of MgADP activation. Both these factors are likely to reduce KATP channel activity in pancreatic beta cells. Login to comment
174 Kir6.2/SUR1-L1551V currents showed reduced sensitivity to ATP-inhibition, loss of activation by MgADP and diazoxide and impaired block by tolbutamide. Login to comment
176 The inhibitory effect of MgADP on Kir6.2/SUR1-L1551V currents was less than that observed when MgADP activation was abolished by mutation of the Walker A lysines in SUR1 [32, 33]. Login to comment
179 The lower ATP sensitivity, loss of MgADP activation, and reduced surface expression probably all contribute to the smaller magnitude and slower activation of Kir6.2/SUR1-L1551V channels on metabolic poisoning in intact oocytes. Login to comment
188 The third mutation in SUR1 (L1551V) was found in two siblings, who had a milder form of CHI, which was responsive to diazoxide [23]. Login to comment
189 The mild phenotype and diazoxide-sensitivity of these subjects is consistent with the finding that both siblings were heterozygous for the L1551V mutation and had an apparently normal second SUR1 allele. Login to comment
191 The subjects in this study inherited the L1551V mutation from their father, who is not known to have had CHI [23]. Login to comment
193 However, if this were the case for the L1551V family, the hyperinsulinaemia should not have been sensitive to diazoxide, as the hyperplastic tissue would express only diazoxide-insensitive SUR1-L1551V subunits. Login to comment
195 An alternative idea is that the phenotypic effect of the L1551V mutation depends on the genetic background of the individual, and that it produces CHI only in those people who carry polymorphisms in other genes that predispose towards enhanced insulin secretion. Login to comment