ABCMdb

ABCB1 p.Ile849Met

Predicted by SNAP2:	A: N (57%), C: N (72%), D: D (80%), E: D (75%), F: N (53%), G: D (75%), H: D (71%), K: D (80%), L: N (87%), M: N (72%), N: D (75%), P: D (80%), Q: D (71%), R: D (75%), S: D (66%), T: D (59%), V: N (93%), W: D (71%), Y: D (59%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, K: D, L: N, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]

Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
126 In addition to the possible decrease in expression levels, ATPase activity in the ABCG2 +24 Intron 20 G A +40 Intron 20 C T 2547 Exon 21 A G 849 Ile to Met 2650 Exon 21 C T 884 Syn 2677 Exon 21 G T 893 Ala to Ser 2677# Exon 21 G A 893 Ala to Thr +31 Intron 22 G A 2956 Exon 24 A G 986 Met to Val 2995 Exon 24 G A 999 Ala to Thr 3151 Exon 25 C G 1051 Pro to Ala 3320 Exon 26 A C 1107 Gln to Pro 3322 Exon 26 T C 1108 Trp to Arg 3396 Exon 26 C T 1132 Syn 3421 Exon 26 T A 1141 Ser to Thr 3435** Exon 26 C T 1145 Syn 3751 Exon 28 G A 1251 Val to Ile 3767 Exon 28 C A 1256 Thr to Lys 4030 Exon 28 G C Non-coding 4036 Exon 28 A G Non-coding +21 Intron 28 T C Table 2. Summary of common genetic variants in the ABCB1 gene (continued) *cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758 with an A as the reference at position 43. Login to comment

[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % 61 A G 21 Asn 21 Asp 799 89.7 10.3 193 100 0 100 97.5 2.5 266 T C 89 Met 89 Thr 100 99.5 0.5 145 100 0 100 100 0 307 T C 103 Phe 103 Leu 546 99.9 0.1 48 100 0 ND ND ND 325 G A 108 Glu 108 Lys ND ND ND 37 95.9 4.1 ND ND ND 781 A G 261 Ile 261 Val 100 100 0 145 100 0 100 98.5 1.5 1199 G A 400 Ser 400 Asn 696 95.0 5.0 193 100 0 100 99 1 1985 T G 662 Leu 662 Arg 100 99.5 0.5 145 100 0 100 100 0 2005 C T 669 Arg 669 Cys 100 100 0 145 100 0 100 99 1 2485 A G 829 Ile 829 Val 185 99.2 0.8 ND ND ND ND ND ND 2547 A G 849 Ile 849 Met 100 99.5 0.5 145 100 0 100 100 0 2677 G T A 893 Ala 893 Ser 893 Thr 611 55.1 42.1 2.8 241 40.0 41.1 18.9 100 90 10 0.5 2956 A G 986 Met 986 Val ND ND ND 100 99.5 0.5 ND ND ND 3151 C G 1051 Pro 1051 Ala 100 100 0 145 100 0 100 99.5 0.5 3320 A C 1107 Gln 1107 Pro 461 99.8 0.2 ND ND ND ND ND ND 3322 T C 1108 Trp 1108 Arg 100 100 0 145 100 0 100 99.5 0.5 3421 T A 1141 Ser 1141 Thr 100 100 0 145 100 0 100 88.9 11.1 3751 G A 1251 Val 1251 Ile 100 100 0 145 99 1 100 100 0 3767 C A 1256 Thr 1256 Lys 100 99.5 0.5 145 100 0 100 100 0 Data from [31-38, 203]. Login to comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis. Login to comment
124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity. Login to comment
129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2. Login to comment
137 40 30 20 10 0 140 120 100 80 60 40 20 0 W T S 400N G 1063A P 1051A A 999T M 986V A 893T I849M R 669C R 492C N 183S Km(µM) Km Vmax Vmax(nmolPi/min/mgprotein) * * * * * * * * * * * verapamil differed slightly among those variants. Login to comment
139 The I849M and A999T variants had Km values lower than that of wild-type ABCB1, whereas the Km value of the N183S variant was higher. Login to comment

[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]

Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis. Login to comment

[hide] Clinical pharmacogenetics and potential applicatio... Curr Drug Metab. 2008 Oct;9(8):738-84. Zhou SF, Di YM, Chan E, Du YM, Chow VD, Xue CC, Lai X, Wang JC, Li CG, Tian M, Duan W
Clinical pharmacogenetics and potential application in personalized medicine.
Curr Drug Metab. 2008 Oct;9(8):738-84., [PMID:18855611]

Abstract [show]
The current 'fixed-dosage strategy' approach to medicine, means there is much inter-individual variation in drug response. Pharmacogenetics is the study of how inter-individual variations in the DNA sequence of specific genes affect drug responses. This article will highlight current pharmacogenetic knowledge on important drug metabolizing enzymes, drug transporters and drug targets to understand interindividual variability in drug clearance and responses in clinical practice and potential use in personalized medicine. Polymorphisms in the cytochrome P450 (CYP) family may have had the most impact on the fate of pharmaceutical drugs. CYP2D6, CYP2C19 and CYP2C9 gene polymorphisms and gene duplications account for the most frequent variations in phase I metabolism of drugs since nearly 80% of drugs in use today are metabolised by these enzymes. Approximately 5% of Europeans and 1% of Asians lack CYP2D6 activity, and these individuals are known as poor metabolizers. CYP2C9 is another clinically significant drug metabolising enzyme that demonstrates genetic variants. Studies into CYP2C9 polymorphism have highlighted the importance of the CYP2C9*2 and CYP2C9*3 alleles. Extensive polymorphism also occurs in a majority of Phase II drug metabolizing enzymes. One of the most important polymorphisms is thiopurine S-methyl transferases (TPMT) that catalyzes the S-methylation of thiopurine drugs. With respect to drug transport polymorphism, the most extensively studied drug transporter is P-glycoprotein (P-gp/MDR1), but the current data on the clinical impact is limited. Polymorphisms in drug transporters may change drug's distribution, excretion and response. Recent advances in molecular research have revealed many of the genes that encode drug targets demonstrate genetic polymorphism. These variations, in many cases, have altered the targets sensitivity to the specific drug molecule and thus have a profound effect on drug efficacy and toxicity. For example, the beta (2)-adrenoreceptor, which is encoded by the ADRB2 gene, illustrates a clinically significant genetic variation in drug targets. The variable number tandem repeat polymorphisms in serotonin transporter (SERT/SLC6A4) gene are associated with response to antidepressants. The distribution of the common variant alleles of genes that encode drug metabolizing enzymes, drug transporters and drug targets has been found to vary among different populations. The promise of pharmacogenetics lies in its potential to identify the right drug at the right dose for the right individual. Drugs with a narrow therapeutic index are thought to benefit more from pharmacogenetic studies. For example, warfarin serves as a good practical example of how pharmacogenetics can be utilized prior to commencement of therapy in order to achieve maximum efficacy and minimum toxicity. As such, pharmacogenetics has the potential to achieve optimal quality use of medicines, and to improve the efficacy and safety of both prospective and licensed drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
532 Nucleotide change rs number Amino acid change 49T>C rs28381804 F17L 61A>G rs61615398; rs9282564 N21D 131A>G rs1202183 N44S 178A>C rs41315618 I60L 239C>A rs9282565 A80E 266T>C Rs35810889 M89T 431T>C rs61607171 I144T 502G>A rs61122623 V168I 548A>G rs60419673 N183S 554G>T rs1128501 G185V 781A>G rs36008564 I261V 1199G>A rs2229109 S400N 1696G>A rs28381902 E566K 1777C>T rs28381914 R593C 1778G>A rs56107566 R593H 1795G>A rs2235036 A599T 1837G>T rs57001392 D613Y 1985T>G rs61762047 L662R 2005C>T rs35023033 R669C 2207A>T rs41316450 I736K 2398G>A rs41305517 D800N 2401G>A rs2235039 V801M 2485A>G rs2032581 I829V 2506A>G rs28381967 I836V 2547A>G rs36105130 I849M 2677T>A/G rs2032582 S893A/T 2975G>A rs56849127 S992N 3151C>G rs28401798 P1051A 3188G>C rs2707944 G1063A 3262G>A rs57521326 D1088N 3295A>G rs41309225 K1099E 3320A>C rs55852620 Q1107P 3322T>C rs35730308 W1108R 3410G>T rs41309228 S1137I 3421T>A rs2229107 S1141T 3502A>G rs59241388 K1168E 3669A>T rs41309231 E1223D 3751G>A rs28364274 V1251I 3767C>A r35721439 T1256K Data are from NCBI dbSNP (access date: 2 August 2008). Login to comment

[hide] Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplot... Pharmacogenet Genomics. 2005 Sep;15(9):599-608. Colombo S, Soranzo N, Rotger M, Sprenger R, Bleiber G, Furrer H, Buclin T, Goldstein D, Decosterd L, Telenti A
Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo.
Pharmacogenet Genomics. 2005 Sep;15(9):599-608., [PMID:16041239]

Abstract [show]
OBJECTIVES: The human immunodeficiency virus protease inhibitor nelfinavir is substrate of polyspecific drug transporters encoded by ABCB1 (P-glycoprotein), ABCC1 (MRP1) and ABCC2 (MRP2), and an inhibitor of BCRP, encoded by ABCG2. Genetic polymorphism in these genes may be associated with changes in transport function. METHODS: A comprehensive evaluation of single nucleotide polymorphisms (39 SNPs in ABCB1, 7 in ABCC1, 27 in ABCC2, and 16 in ABCG2), and inferred haplotypes was done to assess possible associations of genetic variants with cellular exposure of nelfinavir in vivo. Analysis used peripheral mononuclear cells from individuals receiving nelfinavir (n=28). Key results were re-examined in a larger sample size (n=129) contributing data on plasma drug levels. RESULTS AND CONCLUSIONS: There was no significant association between cellular nelfinavir area under the curve (AUC) and SNPs or haplotypes at ABCC1, ABCC2, ABCG2. There was an association with cellular exposure for two loci in strong linkage disequilibrium: ABCB1 3435C>T; AUCTT>AUCCT>AUCCC (ratio 2.1, 1.4, 1, Ptrend=0.01), and intron 26 +80T>C; AUCCC> AUCCT > AUCTT (ratio 2.4, 1.3, 1, Ptrend=0.006). Haplotypic analysis using tagging SNPs did not improve the single SNP association values.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 - 4 C > T exon 2 (50 UTR) Epidauros md-v-177 c.61A > G exon 2 p.N21D Hoffmeyer et al., 2000 md-v-017 rs9282564 IVS 2 + 23 T > C intron 2 Epidauros md-v-057 Tag 1 intron 3 Soranzo et al., 2004 rs3789243 IVS 11 - 40 T > G intron 10 Epidauros md-v-078 rs2235029 c.1137 C > G exon 11 p.P373A Epidauros md-v-079 c.1149 C > T exon 11 synonymous (p.H383H) Epidauros md-v-080 c.1199G > A exon 11 p.S400N Hoffmeyer et al., 2000 md-v-025 rs2229109 IVS11 + 48 T > A intron 11 Epidauros md-v-081 Tag 5 exon 12 Soranzo et al., 2004 rs1128503 Tag 6 intron 16 Soranzo et al., 2004 rs2235046 IVS 21 - 78 G > A intron 20 Epidauros md-v-228 IVS 21 - 43 A > T intron 20 Epidauros md-v-160 c.2547A > G exon 21 p.I849M Kroetz et al., 2003 md-v-222 c. Login to comment

[hide] Sequence diversity and haplotype structure in the ... Pharmacogenetics. 2003 Aug;13(8):481-94. Kroetz DL, Pauli-Magnus C, Hodges LM, Huang CC, Kawamoto M, Johns SJ, Stryke D, Ferrin TE, DeYoung J, Taylor T, Carlson EJ, Herskowitz I, Giacomini KM, Clark AG
Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene.
Pharmacogenetics. 2003 Aug;13(8):481-94., [PMID:12893986]

Abstract [show]
OBJECTIVES: There is increasing evidence that polymorphism of the ABCB1 (MDR1) gene contributes to interindividual variability in bioavailability and tissue distribution of P-glycoprotein substrates. The aim of the present study was to (1) identify and describe novel variants in the ABCB1 gene, (2) understand the extent of variation in ABCB1 at the population level, (3) analyze how variation in ABCB1 is structured in haplotypes, and (4) functionally characterize the effect of the most common amino acid change in P-glycoprotein. METHODS AND RESULTS: Forty-eight variant sites, including 30 novel variants and 13 coding for amino acid changes, were identified in a collection of 247 ethnically diverse DNA samples. These variants comprised 64 statistically inferred haplotypes, 33 of which accounted for 92% of chromosomes analyzed. The two most common haplotypes, ABCB1*1 and ABCB1*13, differed at six sites (three intronic, two synonymous, and one non-synonymous) and were present in 36% of all chromosomes. Significant population substructure was detected at both the nucleotide and haplotype level. Linkage disequilibrium was significant across the entire ABCB1 gene, especially between the variant sites found in ABCB1*13, and recombination was inferred. The Ala893Ser change found in the common ABCB1*13 haplotype did not affect P-glycoprotein function. CONCLUSION: This study represents a comprehensive analysis of ABCB1 nucleotide diversity and haplotype structure in different populations and illustrates the importance of haplotype considerations in characterizing the functional consequences of ABCB1 polymorphisms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 A total of 30 segregating sites have not been previously described, including eight non-synonymous changes coding for the following amino acid changes: Met89Thr, Leu662Arg, Arg669Cys, Ile849Met, Pro1051Ala, Trp1108Arg, Val1251Ile, and Thr1256Lys. Login to comment
113 An additional five coding variants occurred at sites that were conserved in six of the seven species, including those resulting in the Arg669Cys, Ile849Met, Trp1108Arg, and Val1251Ile changes. Login to comment
141 Unauthorized reproduction of this article is prohibited. Table 1 Genetic variation in ABCB1 Allele frequencyd Variant cDNA NT DNA/AA AA Total CA AA AS ME PA No.a positionb changec position change (n ¼ 494) (n ¼ 200) (n ¼ 200) (n ¼ 60) (n ¼ 20) (n ¼ 14) 1.1Ã (À274) G to A Intron À1 0.006 0 0.016 0 0 0 1.2Ã (À223) C to T Intron À1 0.002 0.005 0 0 0 0 1.3Ã (À146) T to C Intron À1 0.002 0 0.005 0 0 0 1.4Ã (À60) A to T Intron À1 0.004 0 0.010 0 0 0 1.5 (À41) A to G Intron À1 0.002 0 0 0.017 0 0 1.6Ã À241 G to A Non-coding 0.002 0 0 0.017 0 0 1.7 À145 C to G Non-coding 0.002 0 0 0.017 0 0 1.8 À129 T to C Non-coding 0.060 0.051 0.071 0.036 0.100 0.071 1.9 À43 A to G Non-coding 0.012 0 0.020 0.036 0 0 1.10Ã (+140) C to A Intron 1 0.013 0.005 0.021 0 0 0.071 1.11Ã (+237) G to A Intron 1 0.004 0 0.010 0 0 0 2.1 À4 C to T Non-coding 0.004 0 0.010 0 0 0 2.2 À1 G to A Non-coding 0.036 0.080 0.005 0 0.050 0 2.3 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 4.1Ã (À8) C to G Intron 3 0.002 0.005 0 0 0 0 4.2Ã 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 5.1 (À25) G to T Intron 4 0.210 0.158 0.300 0.067 0.200 0.286 8.1 729 A to G 243 Syn 0.002 0.005 0 0 0 0 8.2Ã 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 10.1Ã (À44) A to G Intron 9 0.400 0.450 0.255 0.685 0.450 0.571 11.1Ã (À41) T to G Intron 10 0.002 0 0 0.017 0 0 11.2 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 12.1Ã (À4) G to A Intron 11 0.002 0 0.005 0 0 0 12.2 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 12.3Ã 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 12.4Ã (+17) G to A Intron 12 0.008 0 0.020 0 0 0 12.5 (+44) C to T Intron 12 0.088 0.046 0.168 0 0 0 13.1 (+24) C to T Intron 13 0.530 0.521 0.542 0.540 0.450 0.571 14.1 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 14.2 (+38) A to G Intron 14 0.540 0.505 0.540 0.683 0.450 0.500 15.1 (+38) G to A Intron 15 0.004 0.005 0.005 0 0 0 16.1Ã 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 16.2Ã 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 18.1Ã (À27) A to G Intron 17 0.008 0.010 0.005 0 0.050 0 20.1Ã (+8) C to G Intron 20 0.002 0 0.005 0 0 0 20.2 (+24) G to A Intron 20 0.126 0.121 0.150 0.067 0.200 0 20.3Ã (+40) C to T Intron 20 0.014 0 0.035 0 0 0 21.1Ã 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 21.2 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 21.3a 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 21.3b 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 22.1 (+31) G to A Intron 22 0.002 0 0.005 0 0 0 25.1Ã 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 26.1Ã 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 26.2 3421 T to A 1141 Ser toThr 0.047 0 0.111 0 0.050 0 26.3 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 28.1 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 28.2 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 28.3 (+21) T to C Intron 28 0.031 0 0.077 0 0 0 a Variants are numbered sequentially by exon. Login to comment
164 M89T I849M V1251I T1256K S1141TW1108R P1052AR669C A893S/T L662R Cytoplasm S400N I261V N21D Extracellular Fig. 1. Login to comment

[hide] Functional implications of genetic polymorphisms i... Pharm Res. 2004 Jun;21(6):904-13. Pauli-Magnus C, Kroetz DL
Functional implications of genetic polymorphisms in the multidrug resistance gene MDR1 (ABCB1).
Pharm Res. 2004 Jun;21(6):904-13., [PMID:15212152]

Abstract [show]
The multidrug resistance (MDR1) gene product P-glycoprotein is a membrane protein that functions as an ATP-dependent efflux pump, transporting exogenous and endogenous substrates from the inside of cells to the outside. Physiological expression of P-glycoprotein in tissues with excretory or protective function is a major determinant of drug disposition and provides a cellular defense mechanism against potentially harmful compounds. Therefore, P-glycoprotein has significant impact on therapeutic efficacy and toxicity as it plays a key role in absorption of oral medications from the intestinal tract, excretion into bile and urine, and distribution into protected tissues such as the brain and testes. There is increasing interest in the possible role of genetic variation in MDR1 in drug therapy. Numerous genetic polymorphisms in MDR1 have been described, some of which have been shown to determine P-glycoprotein expression levels and substrate transport. Furthermore, some of these polymorphisms have an impact on pharmacokinetic and pharmacodynamic profiles of drug substrates and directly influence outcome and prognosis of certain diseases. This review will focus on the impact of genetic variation in MDR1 on expression and function of P-glycoprotein and the implications of this variation for drug therapy and disease risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 6, June 2004 ((c) 2004) 9040724-8741/04/0600-0904/0 (c) 2004 Plenum Publishing Corporation Table I. MDR1 Coding Variants cDNA positiona NT change DNA/AA position AA change Allele frequencyb Total (n ‫ס‬ 494) CA (n ‫ס‬ 200) AA (n ‫ס‬ 200) AS (n ‫ס‬ 60) ME (n ‫ס‬ 20) PA (n ‫ס‬ 14) 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 729 A to G 243 Syn 0.002 0.005 0 0 0 0 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 3421 T to A 1141 Ser to Thr 0.047 0 0.111 0 0.050 0 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 a cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758. Login to comment

[hide] Ethnic differences in genetic polymorphisms of CYP... Drug Metab Pharmacokinet. 2004 Apr;19(2):83-95. Ozawa S, Soyama A, Saeki M, Fukushima-Uesaka H, Itoda M, Koyano S, Sai K, Ohno Y, Saito Y, Sawada J
Ethnic differences in genetic polymorphisms of CYP2D6, CYP2C19, CYP3As and MDR1/ABCB1.
Drug Metab Pharmacokinet. 2004 Apr;19(2):83-95., [PMID:15499174]

Abstract [show]
Metabolic capacities for debrisoquin, sparteine, mephenytoin, nifedipine, and midazolam, which are substrates of polymorphic CYP2D6, CYP2C19, and CYP3A, have been reported to exhibit, in many cases, remarkable interindividual and ethnic differences. These ethnic differences are partly associated with genetic differences. In the case of the drug transporter ABCB1/MDR1, interindividual differences in its transporter activities toward various clinical drugs are also attributed to several ABCB1/MDR1 genetic polymorphisms. In this review, the existence and frequency of various low-activity alleles of drug metabolizing enzymes as well as populational drug metabolic capacities are compared among several different races or ethnicities. Distribution of nonsynonymous ABCB1/MDR1 SNPs and haplotype frequency in various races are summarized, with the association of nonsynonymous SNPs with large functional alterations as a rare event.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Ethnic dierences in nonsynonymous SNPs of ABCB1W MDR1 cDNA positiona Position and amino acid change C AA AS J 61AÀG N21D 0.080 0.025 0.017 0 266TÀC M89T 0.005 0 0 0 781AÀG I261V 0 0.015 0 0 1199GÀA S400N 0.025 0.010 0 0 1985TÀG L662R 0.005 0 0 0 2005CÀT R669C 0 0.010 0 0 2547AÀG I849M 0.005 0 0 0 2677GÀT A893S 0.464 0.100 0.450 0.403 2677GÀA A893T 0.036 0.005 0.067 0.200 3151CÀG P1051A 0 0.005 0 0 3322TÀC W1108R 0 0.005 0 0 3421TÀA S1141T 0 0.111 0 0 3751GÀA V1251I 0 0 0 0.010 3767CÀA T1256K 0.005 0 0 0 C, 100 Caucasians; AA, 100 African-Americans; AS, 30 Asians; J, 145 Japanese (our study 116) ). Login to comment

[hide] Quantitative structure--activity relationship anal... Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9. Sakurai A, Onishi Y, Hirano H, Seigneuret M, Obanayama K, Kim G, Liew EL, Sakaeda T, Yoshiura K, Niikawa N, Sakurai M, Ishikawa T
Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1).
Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9., 2007-07-03 [PMID:17559192]

Abstract [show]
Several preclinical and clinical studies suggest the importance of naturally occurring polymorphisms of drug transporters in the individual difference of drug response. To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. The kinetic properties (Km and Vmax) of those variants were analyzed by measuring the ATPase activity to obtain the ATPase profile for each variant toward structurally unrelated substrates. On the basis of the experimental data, we determined the substrate specificity of ABCB1 WT and its variants by the quantitative structure-activity relationship (QSAR) analysis method. While several SNP variants appeared to influence the substrate specificity of ABCB1, the nonsynonymous polymorphisms of 2677G > T, A, or C at amino acid position 893 (Ala > Ser, Thr, or Pro) have great impacts on both the activity and the substrate specificity of ABCB1. The A893P variant (2677G > C), a rare mutation, exhibited markedly high activity of ATPase toward different test compounds. Molecular dynamics (MD) simulation based on a three-dimensional structural model of human ABCB1 revealed that multiple kinks are formed in the intracellular loop between transmembrane domains 10 and 11 of the A893P variant (2677G > C) protein. The polymorphisms of 2677G, 2677T, and 2677A exhibit wide ethnic differences in the allele frequency, and these nonsynonymous polymorphisms are suggested to be clinically important because of their altered ATPase activity and substrate specificity toward different drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. Login to comment
38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis. Login to comment
53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944). Login to comment
80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse. Login to comment
142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures. Login to comment
180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts. Login to comment
184 A893P, I849M, A893T, M986V, and G1063A variants showed higher Vmax values than did the WT, whereas the Vmax value of A893S was lower than that of WT. Login to comment
186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6). Login to comment
187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6. Login to comment
189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6. Login to comment
239 For example, the presence of one substituted carbon atom in an unfused aromatic ring (CFC ) G010) negatively contributed the drug-stimulated ATPase activity of the I849M variants, whereas this structural component did not affect the other variants or WT. Login to comment
269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function. Login to comment
273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance). Login to comment
293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5. Login to comment
316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1. Login to comment
340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined. Login to comment

[hide] Pharmacogenetics of drug transporters in the enter... Pharmacogenomics. 2011 May;12(5):611-31. Stieger B, Meier PJ
Pharmacogenetics of drug transporters in the enterohepatic circulation.
Pharmacogenomics. 2011 May;12(5):611-31., [PMID:21619426]

Abstract [show]
This article summarizes the impact of the pharmacogenetics of drug transporters expressed in the enterohepatic circulation on the pharmacokinetics and pharmacodynamics of drugs. The role of pharmacogenetics in the function of drug transporter proteins in vitro is now well established and evidence is rapidly accumulating from in vivo pharmacokinetic studies, which suggests that genetic variants of drug transporter proteins can translate into clinically relevant phenotypes. However, a large amount of conflicting information on the clinical relevance of drug transporter proteins has so far precluded the emergence of a clear picture regarding the role of drug transporter pharmacogenetics in medical practice. This is very well exemplified by the case of P-glycoprotein (MDR1, ABCB1). The challenge is now to develop pharmacogenetic models with sufficient predictive power to allow for translation into drug therapy. This will require a combination of pharmacogenetics of drug transporters, drug metabolism and pharmacodynamics of the respective drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 Gene name Transporter SNP Protein Population size (n) Invitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transportactivity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transportactivity [202] c.3151C>G p.P1051A N/A Increased transport activity (substratedependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression invitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells invitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPaseactivity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment
94 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transport activity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transport activity [202] c.3151C>G p.P1051A N/A Increased transport activity (substrate dependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression in vitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells in vitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPase activity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment

[hide] Emerging new technologies in Pharmacogenomics: rap... Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4. Ishikawa T, Sakurai A, Hirano H, Lezhava A, Sakurai M, Hayashizaki Y
Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1).
Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4., [PMID:20138191]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters as well as drug-metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and, by extension, their overall pharmacological effects. There are an increasing number of reports addressing genetic polymorphisms of drug transporters. A key requirement for the development of individualized medicine or personalized therapy is the ability to rapidly and conveniently test patients for genetic polymorphisms and/or mutations. We have recently developed a rapid and cost-effective method for single nucleotide polymorphism (SNP) detection, named Smart Amplification Process 2 (SmartAmp2), which enables us to detect genetic polymorphisms or mutations in 30 to 45min under isothermal conditions without DNA isolation and PCR amplification. Furthermore, high-speed functional screening, quantitative structure-activity relationship (QSAR) analysis, and molecular dynamic (MD) simulation methods have been developed to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function and substrate specificity. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. This review addresses such new methods for validating genetic polymorphisms of human ABC transporter ABCB1 (P-gp/MDR1) which is critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6. Login to comment
533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment
476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6. Login to comment
502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const. Login to comment
534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment

[hide] A synonymous polymorphism in a common MDR1 (ABCB1)... Biochim Biophys Acta. 2009 May;1794(5):860-71. Epub 2009 Mar 11. Fung KL, Gottesman MM
A synonymous polymorphism in a common MDR1 (ABCB1) haplotype shapes protein function.
Biochim Biophys Acta. 2009 May;1794(5):860-71. Epub 2009 Mar 11., [PMID:19285158]

Abstract [show]
The MDR1 (ABCB1) gene encodes a membrane-bound transporter that actively effluxes a wide range of compounds from cells. The overexpression of MDR1 by multidrug-resistant cancer cells is a serious impediment to chemotherapy. MDR1 is expressed in various tissues to protect them from the adverse effect of toxins. The pharmacokinetics of drugs that are also MDR1 substrates also influence disease outcome and treatment efficacy. Although MDR1 is a well-conserved gene, there is increasing evidence that its polymorphisms affect substrate specificity. Three single nucleotide polymorphisms (SNPs) occur frequently and have strong linkage, creating a common haplotype at positions 1236C>T (G412G), 2677G>T (A893S) and 3435C>T (I1145I). The frequency of the synonymous 3435C>T polymorphism has been shown to vary significantly according to ethnicity. Existing literature suggests that the haplotype plays a role in response to drugs and disease susceptibility. This review summarizes recent findings on the 3435C>T polymorphism of MDR1 and the haplotype to which it belongs. A possible molecular mechanism of action by ribosome stalling that can change protein structure and function by altering protein folding is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
352 Nevertheless, mutation studies have identified several amino acids (G830V, I849M) that could change the kinetics of drug-induced ATPase activity [42,116]. Login to comment
351 Nevertheless, mutation studies have identified several amino acids (G830V, I849M) that could change the kinetics of drug-induced ATPase activity [42,116]. Login to comment