ABCMdb

ABCB1 p.Ile849Met

None has been submitted yet.

Publications

PMID: 15882131 [PubMed] Lepper ER et al: "Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2."

No. Sentence Comment

126 In addition to the possible decrease in expression levels, ATPase activity in the ABCG2 +24 Intron 20 G A +40 Intron 20 C T 2547 Exon 21 A G 849 Ile to Met 2650 Exon 21 C T 884 Syn 2677 Exon 21 G T 893 Ala to Ser 2677# Exon 21 G A 893 Ala to Thr +31 Intron 22 G A 2956 Exon 24 A G 986 Met to Val 2995 Exon 24 G A 999 Ala to Thr 3151 Exon 25 C G 1051 Pro to Ala 3320 Exon 26 A C 1107 Gln to Pro 3322 Exon 26 T C 1108 Trp to Arg 3396 Exon 26 C T 1132 Syn 3421 Exon 26 T A 1141 Ser to Thr 3435** Exon 26 C T 1145 Syn 3751 Exon 28 G A 1251 Val to Ile 3767 Exon 28 C A 1256 Thr to Lys 4030 Exon 28 G C Non-coding 4036 Exon 28 A G Non-coding +21 Intron 28 T C Table 2. Summary of common genetic variants in the ABCB1 gene (continued) *cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758 with an A as the reference at position 43. Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."

No. Sentence Comment

106 Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % 61 A G 21 Asn 21 Asp 799 89.7 10.3 193 100 0 100 97.5 2.5 266 T C 89 Met 89 Thr 100 99.5 0.5 145 100 0 100 100 0 307 T C 103 Phe 103 Leu 546 99.9 0.1 48 100 0 ND ND ND 325 G A 108 Glu 108 Lys ND ND ND 37 95.9 4.1 ND ND ND 781 A G 261 Ile 261 Val 100 100 0 145 100 0 100 98.5 1.5 1199 G A 400 Ser 400 Asn 696 95.0 5.0 193 100 0 100 99 1 1985 T G 662 Leu 662 Arg 100 99.5 0.5 145 100 0 100 100 0 2005 C T 669 Arg 669 Cys 100 100 0 145 100 0 100 99 1 2485 A G 829 Ile 829 Val 185 99.2 0.8 ND ND ND ND ND ND 2547 A G 849 Ile 849 Met 100 99.5 0.5 145 100 0 100 100 0 2677 G T A 893 Ala 893 Ser 893 Thr 611 55.1 42.1 2.8 241 40.0 41.1 18.9 100 90 10 0.5 2956 A G 986 Met 986 Val ND ND ND 100 99.5 0.5 ND ND ND 3151 C G 1051 Pro 1051 Ala 100 100 0 145 100 0 100 99.5 0.5 3320 A C 1107 Gln 1107 Pro 461 99.8 0.2 ND ND ND ND ND ND 3322 T C 1108 Trp 1108 Arg 100 100 0 145 100 0 100 99.5 0.5 3421 T A 1141 Ser 1141 Thr 100 100 0 145 100 0 100 88.9 11.1 3751 G A 1251 Val 1251 Ile 100 100 0 145 99 1 100 100 0 3767 C A 1256 Thr 1256 Lys 100 99.5 0.5 145 100 0 100 100 0 Data from [31-38, 203]. Login to comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis. Login to comment
124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity. Login to comment
129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2. Login to comment
137 40 30 20 10 0 140 120 100 80 60 40 20 0 W T S 400N G 1063A P 1051A A 999T M 986V A 893T I849M R 669C R 492C N 183S Km(µM) Km Vmax Vmax(nmolPi/min/mgprotein) * * * * * * * * * * * verapamil differed slightly among those variants. Login to comment
139 The I849M and A999T variants had Km values lower than that of wild-type ABCB1, whereas the Km value of the N183S variant was higher. Login to comment

PMID: 16399366 [PubMed] Ishikawa T et al: "High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics."

No. Sentence Comment

167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis. Login to comment

PMID: 18855611 [PubMed] Zhou SF et al: "Clinical pharmacogenetics and potential application in personalized medicine."

No. Sentence Comment

532 Nucleotide change rs number Amino acid change 49T>C rs28381804 F17L 61A>G rs61615398; rs9282564 N21D 131A>G rs1202183 N44S 178A>C rs41315618 I60L 239C>A rs9282565 A80E 266T>C Rs35810889 M89T 431T>C rs61607171 I144T 502G>A rs61122623 V168I 548A>G rs60419673 N183S 554G>T rs1128501 G185V 781A>G rs36008564 I261V 1199G>A rs2229109 S400N 1696G>A rs28381902 E566K 1777C>T rs28381914 R593C 1778G>A rs56107566 R593H 1795G>A rs2235036 A599T 1837G>T rs57001392 D613Y 1985T>G rs61762047 L662R 2005C>T rs35023033 R669C 2207A>T rs41316450 I736K 2398G>A rs41305517 D800N 2401G>A rs2235039 V801M 2485A>G rs2032581 I829V 2506A>G rs28381967 I836V 2547A>G rs36105130 I849M 2677T>A/G rs2032582 S893A/T 2975G>A rs56849127 S992N 3151C>G rs28401798 P1051A 3188G>C rs2707944 G1063A 3262G>A rs57521326 D1088N 3295A>G rs41309225 K1099E 3320A>C rs55852620 Q1107P 3322T>C rs35730308 W1108R 3410G>T rs41309228 S1137I 3421T>A rs2229107 S1141T 3502A>G rs59241388 K1168E 3669A>T rs41309231 E1223D 3751G>A rs28364274 V1251I 3767C>A r35721439 T1256K Data are from NCBI dbSNP (access date: 2 August 2008). Login to comment

PMID: 16041239 [PubMed] Colombo S et al: "Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo."

No. Sentence Comment

69 - 4 C > T exon 2 (50 UTR) Epidauros md-v-177 c.61A > G exon 2 p.N21D Hoffmeyer et al., 2000 md-v-017 rs9282564 IVS 2 + 23 T > C intron 2 Epidauros md-v-057 Tag 1 intron 3 Soranzo et al., 2004 rs3789243 IVS 11 - 40 T > G intron 10 Epidauros md-v-078 rs2235029 c.1137 C > G exon 11 p.P373A Epidauros md-v-079 c.1149 C > T exon 11 synonymous (p.H383H) Epidauros md-v-080 c.1199G > A exon 11 p.S400N Hoffmeyer et al., 2000 md-v-025 rs2229109 IVS11 + 48 T > A intron 11 Epidauros md-v-081 Tag 5 exon 12 Soranzo et al., 2004 rs1128503 Tag 6 intron 16 Soranzo et al., 2004 rs2235046 IVS 21 - 78 G > A intron 20 Epidauros md-v-228 IVS 21 - 43 A > T intron 20 Epidauros md-v-160 c.2547A > G exon 21 p.I849M Kroetz et al., 2003 md-v-222 c. Login to comment

PMID: 12893986 [PubMed] Kroetz DL et al: "Sequence diversity and haplotype structure in the human ABCB1 (MDR1, multidrug resistance transporter) gene."

No. Sentence Comment

103 A total of 30 segregating sites have not been previously described, including eight non-synonymous changes coding for the following amino acid changes: Met89Thr, Leu662Arg, Arg669Cys, Ile849Met, Pro1051Ala, Trp1108Arg, Val1251Ile, and Thr1256Lys. Login to comment
113 An additional five coding variants occurred at sites that were conserved in six of the seven species, including those resulting in the Arg669Cys, Ile849Met, Trp1108Arg, and Val1251Ile changes. Login to comment
141 Unauthorized reproduction of this article is prohibited. Table 1 Genetic variation in ABCB1 Allele frequencyd Variant cDNA NT DNA/AA AA Total CA AA AS ME PA No.a positionb changec position change (n ¼ 494) (n ¼ 200) (n ¼ 200) (n ¼ 60) (n ¼ 20) (n ¼ 14) 1.1Ã (À274) G to A Intron À1 0.006 0 0.016 0 0 0 1.2Ã (À223) C to T Intron À1 0.002 0.005 0 0 0 0 1.3Ã (À146) T to C Intron À1 0.002 0 0.005 0 0 0 1.4Ã (À60) A to T Intron À1 0.004 0 0.010 0 0 0 1.5 (À41) A to G Intron À1 0.002 0 0 0.017 0 0 1.6Ã À241 G to A Non-coding 0.002 0 0 0.017 0 0 1.7 À145 C to G Non-coding 0.002 0 0 0.017 0 0 1.8 À129 T to C Non-coding 0.060 0.051 0.071 0.036 0.100 0.071 1.9 À43 A to G Non-coding 0.012 0 0.020 0.036 0 0 1.10Ã (+140) C to A Intron 1 0.013 0.005 0.021 0 0 0.071 1.11Ã (+237) G to A Intron 1 0.004 0 0.010 0 0 0 2.1 À4 C to T Non-coding 0.004 0 0.010 0 0 0 2.2 À1 G to A Non-coding 0.036 0.080 0.005 0 0.050 0 2.3 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 4.1Ã (À8) C to G Intron 3 0.002 0.005 0 0 0 0 4.2Ã 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 5.1 (À25) G to T Intron 4 0.210 0.158 0.300 0.067 0.200 0.286 8.1 729 A to G 243 Syn 0.002 0.005 0 0 0 0 8.2Ã 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 10.1Ã (À44) A to G Intron 9 0.400 0.450 0.255 0.685 0.450 0.571 11.1Ã (À41) T to G Intron 10 0.002 0 0 0.017 0 0 11.2 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 12.1Ã (À4) G to A Intron 11 0.002 0 0.005 0 0 0 12.2 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 12.3Ã 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 12.4Ã (+17) G to A Intron 12 0.008 0 0.020 0 0 0 12.5 (+44) C to T Intron 12 0.088 0.046 0.168 0 0 0 13.1 (+24) C to T Intron 13 0.530 0.521 0.542 0.540 0.450 0.571 14.1 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 14.2 (+38) A to G Intron 14 0.540 0.505 0.540 0.683 0.450 0.500 15.1 (+38) G to A Intron 15 0.004 0.005 0.005 0 0 0 16.1Ã 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 16.2Ã 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 18.1Ã (À27) A to G Intron 17 0.008 0.010 0.005 0 0.050 0 20.1Ã (+8) C to G Intron 20 0.002 0 0.005 0 0 0 20.2 (+24) G to A Intron 20 0.126 0.121 0.150 0.067 0.200 0 20.3Ã (+40) C to T Intron 20 0.014 0 0.035 0 0 0 21.1Ã 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 21.2 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 21.3a 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 21.3b 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 22.1 (+31) G to A Intron 22 0.002 0 0.005 0 0 0 25.1Ã 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 26.1Ã 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 26.2 3421 T to A 1141 Ser toThr 0.047 0 0.111 0 0.050 0 26.3 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 28.1 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 28.2 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 28.3 (+21) T to C Intron 28 0.031 0 0.077 0 0 0 a Variants are numbered sequentially by exon. Login to comment
164 M89T I849M V1251I T1256K S1141TW1108R P1052AR669C A893S/T L662R Cytoplasm S400N I261V N21D Extracellular Fig. 1. Login to comment

PMID: 15212152 [PubMed] Pauli-Magnus C et al: "Functional implications of genetic polymorphisms in the multidrug resistance gene MDR1 (ABCB1)."

No. Sentence Comment

28 6, June 2004 ((c) 2004) 9040724-8741/04/0600-0904/0 (c) 2004 Plenum Publishing Corporation Table I. MDR1 Coding Variants cDNA positiona NT change DNA/AA position AA change Allele frequencyb Total (n ‫ס‬ 494) CA (n ‫ס‬ 200) AA (n ‫ס‬ 200) AS (n ‫ס‬ 60) ME (n ‫ס‬ 20) PA (n ‫ס‬ 14) 61 A to G 21 Asn to Asp 0.045 0.080 0.025 0.017 0 0 266 T to C 89 Met to Thr 0.002 0.005 0 0 0 0 729 A to G 243 Syn 0.002 0.005 0 0 0 0 781 A to G 261 Ile to Val 0.006 0 0.015 0 0 0 1199 G to A 400 Ser to Asn 0.014 0.025 0.010 0 0 0 1236 C to T 412 Syn 0.385 0.459 0.209 0.685 0.450 0.571 1308 A to G 436 Syn 0.002 0 0.005 0 0 0 1617 C to T 539 Syn 0.002 0.005 0 0 0 0 1985 T to G 662 Leu to Arg 0.002 0.005 0 0 0 0 2005 C to T 669 Arg to Cys 0.004 0 0.010 0 0 0 2547 A to G 849 Ile to Met 0.002 0.005 0 0 0 0 2650 C to T 884 Syn 0.004 0.005 0.005 0 0 0 2677 G to T 893 Ala to Ser 0.308 0.464 0.100 0.450 0.400 0.357 2677 G to A 893 Ala to Thr 0.035 0.036 0.005 0.067 0 0.357 3151 C to G 1051 Pro to Ala 0.002 0 0.005 0 0 0 3322 T to C 1108 Trp to Arg 0.002 0 0.005 0 0 0 3421 T to A 1141 Ser to Thr 0.047 0 0.111 0 0.050 0 3435 C to T 1145 Syn 0.392 0.561 0.202 0.400 0.500 0.500 3751 G to A 1251 Val to Ile 0.002 0 0 0 0.050 0 3767 C to A 1256 Thr to Lys 0.002 0.005 0 0 0 0 a cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758. Login to comment

PMID: 15499174 [PubMed] Ozawa S et al: "Ethnic differences in genetic polymorphisms of CYP2D6, CYP2C19, CYP3As and MDR1/ABCB1."

No. Sentence Comment

85 Ethnic dierences in nonsynonymous SNPs of ABCB1W MDR1 cDNA positiona Position and amino acid change C AA AS J 61AÀG N21D 0.080 0.025 0.017 0 266TÀC M89T 0.005 0 0 0 781AÀG I261V 0 0.015 0 0 1199GÀA S400N 0.025 0.010 0 0 1985TÀG L662R 0.005 0 0 0 2005CÀT R669C 0 0.010 0 0 2547AÀG I849M 0.005 0 0 0 2677GÀT A893S 0.464 0.100 0.450 0.403 2677GÀA A893T 0.036 0.005 0.067 0.200 3151CÀG P1051A 0 0.005 0 0 3322TÀC W1108R 0 0.005 0 0 3421TÀA S1141T 0 0.111 0 0 3751GÀA V1251I 0 0 0 0.010 3767CÀA T1256K 0.005 0 0 0 C, 100 Caucasians; AA, 100 African-Americans; AS, 30 Asians; J, 145 Japanese (our study 116) ). Login to comment

PMID: 17559192 [PubMed] Sakurai A et al: "Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1)."

No. Sentence Comment

1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. Login to comment
38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis. Login to comment
53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944). Login to comment
80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse. Login to comment
142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures. Login to comment
180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts. Login to comment
184 A893P, I849M, A893T, M986V, and G1063A variants showed higher Vmax values than did the WT, whereas the Vmax value of A893S was lower than that of WT. Login to comment
186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6). Login to comment
187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6. Login to comment
189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6. Login to comment
239 For example, the presence of one substituted carbon atom in an unfused aromatic ring (CFC ) G010) negatively contributed the drug-stimulated ATPase activity of the I849M variants, whereas this structural component did not affect the other variants or WT. Login to comment
269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function. Login to comment
273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance). Login to comment
293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5. Login to comment
316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1. Login to comment
340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined. Login to comment

PMID: 21619426 [PubMed] Stieger B et al: "Pharmacogenetics of drug transporters in the enterohepatic circulation."

No. Sentence Comment

91 Gene name Transporter SNP Protein Population size (n) Invitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transportactivity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transportactivity [202] c.3151C>G p.P1051A N/A Increased transport activity (substratedependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression invitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells invitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPaseactivity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment
94 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transport activity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transport activity [202] c.3151C>G p.P1051A N/A Increased transport activity (substrate dependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression in vitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells in vitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPase activity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment

PMID: 20138191 [PubMed] Ishikawa T et al: "Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1)."

No. Sentence Comment

478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6. Login to comment
533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment
476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6. Login to comment
502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const. Login to comment
534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment

PMID: 19285158 [PubMed] Fung KL et al: "A synonymous polymorphism in a common MDR1 (ABCB1) haplotype shapes protein function."

No. Sentence Comment

352 Nevertheless, mutation studies have identified several amino acids (G830V, I849M) that could change the kinetics of drug-induced ATPase activity [42,116]. Login to comment
351 Nevertheless, mutation studies have identified several amino acids (G830V, I849M) that could change the kinetics of drug-induced ATPase activity [42,116]. Login to comment