ABCMdb

ABCB1 p.Gly534Asp

Predicted by SNAP2:	A: D (85%), C: D (85%), D: D (95%), E: D (95%), F: D (91%), H: D (95%), I: D (91%), K: D (95%), L: D (91%), M: D (91%), N: D (91%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), T: D (91%), V: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
226 However, some mutations in the ABC signature such as G534D and I541R abolished drug-stimulated ATPase activity. Login to comment

[hide] Role of glycine-534 and glycine-1179 of human mult... Biochem J. 2001 May 15;356(Pt 1):71-5. Szakacs G, Ozvegy C, Bakos E, Sarkadi B, Varadi A
Role of glycine-534 and glycine-1179 of human multidrug resistance protein (MDR1) in drug-mediated control of ATP hydrolysis.
Biochem J. 2001 May 15;356(Pt 1):71-5., 2001-05-15 [PMID:11336637]

Abstract [show]
The human multidrug resistance protein (MDR1) (P-glycoprotein), a member of the ATP-binding cassette (ABC) family, causes multidrug resistance by an active transport mechanism, which keeps the intracellular level of hydrophobic compounds below a cell-killing threshold. Human MDR1 variants with mutations affecting a conserved glycine residue within the ABC signature of either or both ABC units (G534D, G534V, G1179D and G534D/G1179D) were expressed and characterized in Spodoptera frugiperda (Sf9) cell membranes. These mutations caused a loss of measurable ATPase activity but still allowed ATP binding and the formation of a transition-state intermediate (nucleotide trapping). In contrast with the wild-type protein, in which substrate drugs accelerate nucleotide trapping, in the ABC signature mutants nucleotide trapping was inhibited by MDR1-substrate drugs, suggesting a miscommunication between the drug-binding site(s) and the catalytic domains. Equivalent mutations of the two catalytic sites resulted in a similar effect, indicating the functional equivalence of the two sites. On the basis of these results and recent structural information on an ABC-ABC dimer [Hopfner, Karcher, Shin, Craig, Arthur, Carney and Tainer (2000) Cell 101, 789-800], we propose a key role of these glycine residues in the interdomain communication regulating drug-induced ATP hydrolysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Human MDR1 variants with mutations affecting a conserved glycine residue within the ABC signature of either or both ABC units (G534D, G534V, G1179D and G534D\G1179D) were expressed and characterized in Spodoptera frugiperda (Sf9) cell membranes. Login to comment
43 MATERIALS AND METHODS Construction of the recombinant transfer vectors The recombinant baculovirus transfer vector carrying the G534D-MDR1 variant was constructed previously [19]. Login to comment
59 The pAcUW21-G534D\G1179D construct was engineered by replacing the 1177-3372 EcoRI-PstI fragment of pAcUW21-G534D with that of pAcUW21-L- G1179D. Login to comment
79 In the same study we found that the MDR1 variant G534D was expressed at a level comparable with the wild-type protein, whereas the expression of a similar variant (G534V-MDR1) was not detected. Login to comment
81 Figure 1 also shows that both the G1179D mutant (affecting the equipositional glycine in the C-terminal ABC unit) and the variant containing aspartic residues at both sides (G534D\ Figure 1 Expression of the MDR1 signature mutants Isolated Sf9 cell membranes (10 µg) expressing G534D-MDR1 (lane 1), G1179D-MDR1 (lane 2), G534D/G1179D-MDR1 (lane 3), G534V-MDR1 (lane 4) or wild-type MDR1 (lane 5) were run on SDS/7.5% (w/v) PAGE gels. Login to comment
96 We observed nucleotide trapping in mutants G534D, Figure 2 Binding of [α-32 P]8-azido-ATP by the MDR1 signature mutants ATP-binding was performed with isolated Sf9 cell membranes (100 µg) expressing G534V-MDR1 (lane 1), wild-type MDR1 (lanes 2 and 8), G534D-MDR1 (lanes 3 and 4), β- galactosidase (lane 5), G534D/G1179D-MDR1 (lane 6) or G1179D-MDR1 (lane 7). Login to comment
100 Membranes expressing G534D/G1179D-MDR1 (lanes 1 and 2), G534V-MDR1 (lanes 3-5), G534D-MDR1 (lanes 6-8) or G1179D-MDR1 (lanes 9-11) were incubated at 37 mC for 10 min in the presence of 20 µM [α-32 P]8-azido-Mg-ATP as described in the Materials and methods section. Login to comment
107 Interestingly, neither G534D-MDR1 nor G1179D-MDR1 was labelled in the presence of vanadate, not even at higher azido-ATP concentrations and longer incubation times (up to 100 µM and 10 min respectively), whereas G534V showed vanadate-induced nucleotide trapping activity (results not shown). Login to comment
114 Conversely, the same reaction with the ABC signature mutants G534D (ratio 0.32), G534V (ratio 0.41) and G1179D (ratio 0.48) was inhibited by verapamil (36 µM). Login to comment
116 Inhibition persisted over a wide range of azido-ATP concentration (5-50 µM) and was observed in the presence of other drugs (calcein-AM, vincristine, cyclosporin A; results not Figure 4 Effect of verapamil on transition-state formation (nucleotide trapping) in the presence of AlF4 - Labelling was performed with isolated Sf9 cell membranes (100 µg) expressing wild-type MDR1 (lanes 1 and 2), G534V-MDR1 (lanes 3 and 4), G534D-MDR1 (lanes 5 and 6) or G1179D-MDR1 (lanes 7 and 8) as described in the Materials and methods section. Login to comment
119 The positions of molecular-mass markers are indicated (in kDa) at the right. Figure 5 Limited proteolysis of the ABC signature mutants after nucleotide trapping in the presence of AlF4 - Labelling was performed with isolated Sf9 cell membranes (200 µg) expressing wild-type MDR1 (lane 1), G534D-MDR1 (lane 2), G534V-MDR1 (lane 3), G1179D-MDR1 (lane 4) or β- galactosidase (lane 5). Login to comment
130 Nevertheless, as shown in Figure 5, catalytic intermediates stabilized by AlF % - were formed in both ABC domains of the G534D, G534V and the G1179D mutants (BeFx gave similar results; results not shown). Login to comment

[hide] Functional implications of genetic polymorphisms i... Pharm Res. 2004 Jun;21(6):904-13. Pauli-Magnus C, Kroetz DL
Functional implications of genetic polymorphisms in the multidrug resistance gene MDR1 (ABCB1).
Pharm Res. 2004 Jun;21(6):904-13., [PMID:15212152]

Abstract [show]
The multidrug resistance (MDR1) gene product P-glycoprotein is a membrane protein that functions as an ATP-dependent efflux pump, transporting exogenous and endogenous substrates from the inside of cells to the outside. Physiological expression of P-glycoprotein in tissues with excretory or protective function is a major determinant of drug disposition and provides a cellular defense mechanism against potentially harmful compounds. Therefore, P-glycoprotein has significant impact on therapeutic efficacy and toxicity as it plays a key role in absorption of oral medications from the intestinal tract, excretion into bile and urine, and distribution into protected tissues such as the brain and testes. There is increasing interest in the possible role of genetic variation in MDR1 in drug therapy. Numerous genetic polymorphisms in MDR1 have been described, some of which have been shown to determine P-glycoprotein expression levels and substrate transport. Furthermore, some of these polymorphisms have an impact on pharmacokinetic and pharmacodynamic profiles of drug substrates and directly influence outcome and prognosis of certain diseases. This review will focus on the impact of genetic variation in MDR1 on expression and function of P-glycoprotein and the implications of this variation for drug therapy and disease risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 Functional Impact in vitro of MDR1 Variants Amino acid change Functional effect of the variant allele Reference Val185Ser Increased colchicine resistance [30] ⌬Phe335 Decreased resistance to vinca alkaloids; no resistance to dactinomycin [31] Lys536Gln, Gly534Asp, Lys536Arg, Ser532Arg, ⌬Tyr490 Defective RNA processing [33] Ala893Ser Acquired overexpression of one allele in drug-resistant cells [20] Ala893Ser Decreased digoxin efflux [19] Asn21Asp, Phe103Leu, Ser400Ala, Ala893Ser, Ala893Thr No effect on P-glycoprotein cell surface expression and substrate specificity [69] Ala893Ser No difference in calcein-AM transport [27] Ala893Ser/Thr No difference in transport of verapamil, digoxin, viblastine and cyclosporine A [35] 3435 polymorphisms were analyzed separately, with AUC values being highest for individuals carrying the reference alleles. Login to comment

[hide] Cystic fibrosis-type mutational analysis in the AT... J Biol Chem. 1994 Aug 12;269(32):20575-83. Hoof T, Demmer A, Hadam MR, Riordan JR, Tummler B
Cystic fibrosis-type mutational analysis in the ATP-binding cassette transporter signature of human P-glycoprotein MDR1.
J Biol Chem. 1994 Aug 12;269(32):20575-83., 1994-08-12 [PMID:7914197]

Abstract [show]
Members of the ATP-binding cassette transporter superfamily such as the P-glycoproteins (MDR) and the cystic fibrosis transmembrane conductance regulator (CFTR) share conserved sequence motifs in their nucleotide binding fold that are the major targets for CFTR mutations in patients with cystic fibrosis. Cystic fibrosis-type mutations were introduced at analogous positions into the human MDR1 gene. Heterologous expression of wild-type or mutated MDR1 revealed similar mRNA transcript levels in Chinese hamster ovary K1 recipients, but the subsequent processing was defective for all mutations that give rise to severe cystic fibrosis in the case of CFTR. Functional multidrug transporter MDR1, however, was obtained when amino acid substitutions were introduced into a less conserved position of the ATP-binding cassette transporter signature (codon 536 in MDR1). The profile of cross-resistance and chemosensitization was modulated in these codon 536 variants, which suggests that this region is involved in the drug transport function of P-glycoprotein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 20575 CF-type Mutations in MDRl TABLEI Oligonucleotides used in RTIPCR assays, mutagenesis,and sequencing Sequence Primer' Applicationb 5'-GAGGTGAAGAAGGGCCAGACG-3' mdrlP3175s* P 5'-TTCTGGATGGTGGACAGGCGGTGA-3' mdrlP3716a*P 5'-GTGCAGAGTGGGCAGACGGTG-3' mdrl-1249s 5'-TTACGAACTGTAGACAAACGATGAG-3' 5'-GAGGAGCAGCTTATG-3' 5'-GTGGTTCAGGTGGCT-3' mdrl-1702s S 5'-GAAAACATTCGCTATGGCCGTGAAAATG-3' mdrl-1456s S 5'-GCAGCTGATGAATCC-3' mdrl-1918s S 5"GTGGTGGGCAGgaCAGAGGATCGC-3' mdrl-1595sM (K536Q) 5'-GTTGAGTGGTGuCAGAAGCAGAG-3' mdrl-1590sM (G534D) 5'-GTGGTGGGCAGwCAGAGGATCGC-3' mdrl-1595sM (K536R) 5"CCAGTTGAGGGGTGGGCAG-3' mdrl-1587sM(S532R) 5'-GAAAACATTCGsGCCGTGAAAATG-3' mdrl-1486sM (AY490) 5'-GGCAAGGGCATCCTGGCTGCAGA-3' alh79s* P 5'-TAACGGGCCAGAACATTGGCATT-3' alh521a* P p, s p, s S mdrl-1781a mdrl-1076s The number indicates the positionof the first primer nucleotide in thecorresponding EMBL file cDNA sequences of rabbit aldolase A (ald), human MDRl (mdrl),or CHOMDRl (mdrlc);s, sense direction; a, antisense direction tocDNA sequence. Login to comment
90 The localization ofAY490, S532R, G534D, K536R, K536Q, and AY490-K536Q in the N-terminal half of MDRl is shown in Fig. 1. Login to comment
110 MRK16 recognizes external epitopes of human MDRl without cross-reactions with rodent P-glycoproteins (Hamada and Tsuruo, 1991).The AY490 and AY490-K536Q transfectants were negative for MRK16 like the parentcontrol line CHO K1 (Fig. 4A).In the S532R and G534D MDRls recombinant cell lines, mixed populations of MRK16 immunoreactive cells were observed (Fig. 4A).Subsequentexposure to colchicine(100,125, 150,or 175ng/ml) increased the proportion of cells with higher antigen density with increasing colchicine concentration (Fig. 4B). Login to comment
111 However, the MRK16 signals on these cells were still 15-fold (S532R) or &fold (G534D)lower than in the K1clone that had been transfected with MDRls wild-type sequence (Table11). Login to comment
113 Phenotype of Multidrug Resistance and Collateral Sensitiuity-Transfection withMDRl vector constructsren- AY490 G534D K536Q 1 ". Login to comment
123 MDRlcell lines with low (S532R, G534D) or no expression of human P- log Fluorescence Intensity ( 3 Decades) B S532R G534D log Fluorescence Intensity ( 3 Decades ) FIG.4. Login to comment
128 B, FACS analysis of the S532R and G534D MDRls mutant cell lines TABLEI1 Cell surface expression of human P-glycoprotein inMDRls recombinant CHO K1 cells 5 x lo5freshly trypsinized cells in the exponential phase of growth were incubated with 3 pg of anti-human-MDR1 monoclonal antibody MRK16 and then with fluorescein isothiocyanate-labeled rabbit anti-mouse I&. Immunofluorescence of cells was recorded on a FACS. Login to comment
130 Cell line Fluorescence Signalnormalized to CHO K1 control CHO K1 8.6 x 10' CHO K1 (MDR1) 1.0 CHO K1 (AY490 MDR1) 6.3 x 10' 0.7 CHO K1 (S532R MDR1)" 4.4 x 104 51 CHO K1 (G534D MDR1)" 2.1 x 105 240 CHO K1 (K536R MDR1) 5.6 x 105 650 CHO K1 (K536Q MDR1) 9.4 x 105 CHO K1 (AY490-K536QMDR1) 2.1 x lo3 1,100 6.5 x 105 750 2.4 a The datarefer to the MRK16-positive subpopulation. Login to comment
147 Opentriangles, wild-type MDRls CHO K1; closed cycles, K536R MDRls K1; closed triangles, K536Q MDRls K1; stars, S532R MDRls K1; opencircles, AY490 MDRls K1; closed squares, G534D MDRls K1; bars, AY490-K536QMDRls K1; open squares,CHO K1. Login to comment
165 Forthe MDRl system, thecorresponding mutations S532R and G534D conferred only a subtle increase of multidrugresistanceto CHO K1 cells with low amounts of S532R MDRl and G534D MDRl being expressed on the surface of the recombinant host cell. Login to comment

[hide] Characterization of the human multidrug resistance... Biochem J. 1997 May 1;323 ( Pt 3):777-83. Bakos E, Klein I, Welker E, Szabo K, Muller M, Sarkadi B, Varadi A
Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region.
Biochem J. 1997 May 1;323 ( Pt 3):777-83., 1997-05-01 [PMID:9169612]

Abstract [show]
A number of mutants with single amino acid replacements were generated in the highly conserved ATP-binding cassette (ABC)-signature region (amino acids 531-543) of the N-terminal half of the human multidrug resistance (MDR1) protein. The cDNA variants were inserted into recombinant baculoviruses and the MDR1 proteins were expressed in Spodoptera frugiperda (Sf9) insect cells. The level of expression and membrane insertion of the MDR1 variants was examined by immunostaining, and MDR1 function was followed by measuring drug-stimulated ATPase activity. We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure. The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity. Increasing the ATP concentration did not restore MDR1 ATPase activity in these variants. Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1. We found no alteration in the drug-sensitivity of ATP cleavage in any of the MDR1 variants that had measurable ATPase activity. These observations suggest that the ABC-signature region is essential for MDR1 protein stability and function, but alterations in this region do not seem to modulate MDR1-drug interactions directly.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane INTRODUCTION The multidrug resistance phenotype in cancer cells is often caused by the overexpression of special membrane transport proteins, the P-glycoprotein [also known as the multidrug resistance protein (MDR1)] and\or the multidrug resistance-associated protein. Login to comment
25 They found that the MDR1 mutants containing a Ser Arg (S532R) or a Gly Asp (G534D) substitution were present at very low levels in the plasma membrane, and thus did not confer drug resistance. Login to comment
38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT. Login to comment
64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19]. Login to comment
73 In immunoflow cytometry experiments, the mutant MDR1 proteins G534D, R538M and I541R were recognized by both monoclonal antibodies, in a manner indistinguishable from that of the wild-type protein (Figure 3). Login to comment
88 On the other hand, when the isolated membranes contained similar amounts of the MDR1 proteins harbouring the mutation G534D or I541R (Table 1), none of the drugs examined was able to stimulate ATPase activity. Login to comment
100 Mutants G534D and I541R were unable to catalyse ATP hydrolysis, even when high concentrations of ATP were present in the incubation medium (Figure 5). Login to comment
125 In the case of the mutants G534D and I541R, we found full MDR1 protein expression but a complete loss of drug-stimulated ATPase activity. Login to comment
130 Mutation G534D in MDR1 is equipositional with the G551D mutant of the human CFTR, which causes severe cystic fibrosis and is the second most frequently observed mutation in this disease [26]. Login to comment
133 In the experiments of Hoof et al. [13] the G534D MDR1 mutant was found to be expressed only in very low amounts at the surface of the recombinant mammalian host cells; thus this mutation may also affect the maturation of MDR1. Login to comment
134 Since in our studies the human MDR1 ATPase activity was measured in isolated insect cell membranes, the present experiments confirm that the G534D mutant, although expressed normally, is non-functional. Login to comment
154 The (fully expressed) R538M mutant had decreased maximum MDR1 ATPase activity, while the G534D and I541R mutants showed a complete loss of activity despite retaining a wild-type ABC signature region in the C-terminal half of the protein. Login to comment

[hide] The power of the pump: mechanisms of action of P-g... Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13. Ambudkar SV, Kim IW, Sauna ZE
The power of the pump: mechanisms of action of P-glycoprotein (ABCB1).
Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13., [PMID:16352426]

Abstract [show]
Members of the superfamily of ATP-binding cassette (ABC) transporters mediate the movement of a variety of substrates including simple ions, complex lipids and xenobiotics. At least 18 ABC transport proteins are associated with disease conditions. P-glycoprotein (Pgp, ABCB1) is the archetypical mammalian ABC transport protein and its mechanism of action has received considerable attention. There is strong biochemical evidence that Pgp moves molecular cargo against a concentration gradient using the energy of ATP hydrolysis. However, the molecular details of how the energy of ATP hydrolysis is coupled to transport remain in dispute and it has not been possible to reconcile the data from various laboratories into a single model. The functional unit of Pgp consists of two nucleotide binding domains (NBDs) and two trans-membrane domains which are involved in the transport of drug substrates. Considerable progress has been made in recent years in characterizing these functionally and spatially distinct domains of Pgp. In addition, our understanding of the domains has been augmented by the resolution of structures of several non-mammalian ABC proteins. This review considers: (i) the role of specific conserved amino acids in ATP hydrolysis mediated by Pgp; (ii) emerging insights into the dimensions of the drug binding pocket and the interactions between Pgp and the transport substrates and (iii) our current understanding of the mechanisms of coupling between energy derived from ATP binding and/or hydrolysis and efflux of drug substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Between the Walker A and B sequences is found a linker peptide with the sequence LSGGQ, also known as the C-region or ABC signature sequence, as it is the hallmark of Table 1 - Summary of mutational analysis of conserved residues in nucleotide-binding domains of Pgp Domain Source Residue number Function Reference NBD1 NBD2 A-loop Human Y401A Y1044A No ATP binding/hydrolysis Kim et al. (submitted for publication) Walker A Mouse K429N K1072N Normal ATP binding but no hydrolysis Azzaria et al. (1989) G431A G1073A Human C431 C1074 ATP protects from modification by N-ethylmaleimide Loo and Clarke (1995) Disulfide bond formation between Walker A domains of both NBDs Urbatsch et al. (2001) Human K433M K1076M Decreased ATP-binding Muller et al. (1996) No ATP hydrolysis Szakacs et al. (2000) No vanadate-trapping, but aluminum and beryllium fluoride-induced trapping normal Q-loop Mouse Q471 Q1114 Not essential for ATP hydrolysis but may be involved in communication with drug-substrate sites Urbatsch et al. (2000a) LSGGQ or linker peptide or signature motif Mouse S528A S1173A Normal ATP binding but no hydrolysis Tombline et al. (2004a) Human S532R Decreased cell surface expression Hoof et al. (1994) Human G534C G1179C No ATP hydrolysis Loo et al. (2002) Human G534D Decreased cell surface expression Hoof et al. (1994) No drug resistance Normal cell surface expression Bakos et al. (1997) No ATP hydrolysis Human G534D/V G1179D Interdomain communication Szakacs et al. (2001) Human Q535C Q1180C No ATP hydrolysis Loo et al. (2002) Human K536Q Decreased drug resistance Hoof et al. (1994) LSGGQ or linker peptide or signature motif Human K536R Increased colchicine resistance (normal ATP hydrolysis?) Login to comment

[hide] A multi-system approach assessing the interaction ... PLoS One. 2013 May 31;8(5):e64854. doi: 10.1371/journal.pone.0064854. Print 2013. Dickens D, Yusof SR, Abbott NJ, Weksler B, Romero IA, Couraud PO, Alfirevic A, Pirmohamed M, Owen A
A multi-system approach assessing the interaction of anticonvulsants with P-gp.
PLoS One. 2013 May 31;8(5):e64854. doi: 10.1371/journal.pone.0064854. Print 2013., [PMID:23741405]

Abstract [show]
30% of epilepsy patients receiving antiepileptic drugs (AEDs) are not fully controlled by therapy. The drug transporter hypothesis for refractory epilepsy proposes that P-gp is over expressed at the epileptic focus with a role of P-gp in extruding AEDs from the brain. However, there is controversy regarding whether all AEDs are substrates for this transporter. Our aim was to investigate transport of phenytoin, lamotrigine and carbamazepine by using seven in-vitro transport models. Uptake assays in CEM/VBL cell lines, oocytes expressing human P-gp and an immortalised human brain endothelial cell line (hCMEC/D3) were carried out. Concentration equilibrium transport assays were performed in Caco-2, MDCKII +/-P-gp and LLC-PK1+/-P-gp in the absence or presence of tariquidar, an inhibitor of P-gp. Finally, primary porcine brain endothelial cells were used to determine the apparent permeability (Papp) of the three AEDs in the absence or presence of P-gp inhibitors. We detected weak transport of phenytoin in two of the transport systems (MDCK and LLC-PK1 cells transfected with human P-gp) but not in the remaining five. No P-gp interaction was observed for lamotrigine or carbamazepine in any of the seven validated in-vitro transport models. Neither lamotrigine nor carbamazepine was a substrate for P-gp in any of the model systems tested. Our data suggest that P-gp is unlikely to contribute to the pathogenesis of refractory epilepsy through transport of carbamazepine or lamotrigine.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 The ATPase deficient mutant encodes for a transporter with an amino acid change (G534D) that has previously been ectopically expressed and shown to be expressed at equivalent levels as the wild type protein and with normal membrane insertion but has a complete loss of drug-stimulated ATPase activity [31]. Login to comment