ABCMdb

ABCB1 p.Gly534Asp

None has been submitted yet.

Publications

PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."

No. Sentence Comment

226 However, some mutations in the ABC signature such as G534D and I541R abolished drug-stimulated ATPase activity. Login to comment

PMID: 11336637 [PubMed] Szakacs G et al: "Role of glycine-534 and glycine-1179 of human multidrug resistance protein (MDR1) in drug-mediated control of ATP hydrolysis."

No. Sentence Comment

6 Human MDR1 variants with mutations affecting a conserved glycine residue within the ABC signature of either or both ABC units (G534D, G534V, G1179D and G534D\G1179D) were expressed and characterized in Spodoptera frugiperda (Sf9) cell membranes. Login to comment
43 MATERIALS AND METHODS Construction of the recombinant transfer vectors The recombinant baculovirus transfer vector carrying the G534D-MDR1 variant was constructed previously [19]. Login to comment
59 The pAcUW21-G534D\G1179D construct was engineered by replacing the 1177-3372 EcoRI-PstI fragment of pAcUW21-G534D with that of pAcUW21-L- G1179D. Login to comment
79 In the same study we found that the MDR1 variant G534D was expressed at a level comparable with the wild-type protein, whereas the expression of a similar variant (G534V-MDR1) was not detected. Login to comment
81 Figure 1 also shows that both the G1179D mutant (affecting the equipositional glycine in the C-terminal ABC unit) and the variant containing aspartic residues at both sides (G534D\ Figure 1 Expression of the MDR1 signature mutants Isolated Sf9 cell membranes (10 µg) expressing G534D-MDR1 (lane 1), G1179D-MDR1 (lane 2), G534D/G1179D-MDR1 (lane 3), G534V-MDR1 (lane 4) or wild-type MDR1 (lane 5) were run on SDS/7.5% (w/v) PAGE gels. Login to comment
96 We observed nucleotide trapping in mutants G534D, Figure 2 Binding of [α-32 P]8-azido-ATP by the MDR1 signature mutants ATP-binding was performed with isolated Sf9 cell membranes (100 µg) expressing G534V-MDR1 (lane 1), wild-type MDR1 (lanes 2 and 8), G534D-MDR1 (lanes 3 and 4), β- galactosidase (lane 5), G534D/G1179D-MDR1 (lane 6) or G1179D-MDR1 (lane 7). Login to comment
100 Membranes expressing G534D/G1179D-MDR1 (lanes 1 and 2), G534V-MDR1 (lanes 3-5), G534D-MDR1 (lanes 6-8) or G1179D-MDR1 (lanes 9-11) were incubated at 37 mC for 10 min in the presence of 20 µM [α-32 P]8-azido-Mg-ATP as described in the Materials and methods section. Login to comment
107 Interestingly, neither G534D-MDR1 nor G1179D-MDR1 was labelled in the presence of vanadate, not even at higher azido-ATP concentrations and longer incubation times (up to 100 µM and 10 min respectively), whereas G534V showed vanadate-induced nucleotide trapping activity (results not shown). Login to comment
114 Conversely, the same reaction with the ABC signature mutants G534D (ratio 0.32), G534V (ratio 0.41) and G1179D (ratio 0.48) was inhibited by verapamil (36 µM). Login to comment
116 Inhibition persisted over a wide range of azido-ATP concentration (5-50 µM) and was observed in the presence of other drugs (calcein-AM, vincristine, cyclosporin A; results not Figure 4 Effect of verapamil on transition-state formation (nucleotide trapping) in the presence of AlF4 - Labelling was performed with isolated Sf9 cell membranes (100 µg) expressing wild-type MDR1 (lanes 1 and 2), G534V-MDR1 (lanes 3 and 4), G534D-MDR1 (lanes 5 and 6) or G1179D-MDR1 (lanes 7 and 8) as described in the Materials and methods section. Login to comment
119 The positions of molecular-mass markers are indicated (in kDa) at the right. Figure 5 Limited proteolysis of the ABC signature mutants after nucleotide trapping in the presence of AlF4 - Labelling was performed with isolated Sf9 cell membranes (200 µg) expressing wild-type MDR1 (lane 1), G534D-MDR1 (lane 2), G534V-MDR1 (lane 3), G1179D-MDR1 (lane 4) or β- galactosidase (lane 5). Login to comment
130 Nevertheless, as shown in Figure 5, catalytic intermediates stabilized by AlF % - were formed in both ABC domains of the G534D, G534V and the G1179D mutants (BeFx gave similar results; results not shown). Login to comment

PMID: 15212152 [PubMed] Pauli-Magnus C et al: "Functional implications of genetic polymorphisms in the multidrug resistance gene MDR1 (ABCB1)."

No. Sentence Comment

118 Functional Impact in vitro of MDR1 Variants Amino acid change Functional effect of the variant allele Reference Val185Ser Increased colchicine resistance [30] ⌬Phe335 Decreased resistance to vinca alkaloids; no resistance to dactinomycin [31] Lys536Gln, Gly534Asp, Lys536Arg, Ser532Arg, ⌬Tyr490 Defective RNA processing [33] Ala893Ser Acquired overexpression of one allele in drug-resistant cells [20] Ala893Ser Decreased digoxin efflux [19] Asn21Asp, Phe103Leu, Ser400Ala, Ala893Ser, Ala893Thr No effect on P-glycoprotein cell surface expression and substrate specificity [69] Ala893Ser No difference in calcein-AM transport [27] Ala893Ser/Thr No difference in transport of verapamil, digoxin, viblastine and cyclosporine A [35] 3435 polymorphisms were analyzed separately, with AUC values being highest for individuals carrying the reference alleles. Login to comment

PMID: 7914197 [PubMed] Hoof T et al: "Cystic fibrosis-type mutational analysis in the ATP-binding cassette transporter signature of human P-glycoprotein MDR1."

No. Sentence Comment

26 20575 CF-type Mutations in MDRl TABLEI Oligonucleotides used in RTIPCR assays, mutagenesis,and sequencing Sequence Primer' Applicationb 5'-GAGGTGAAGAAGGGCCAGACG-3' mdrlP3175s* P 5'-TTCTGGATGGTGGACAGGCGGTGA-3' mdrlP3716a*P 5'-GTGCAGAGTGGGCAGACGGTG-3' mdrl-1249s 5'-TTACGAACTGTAGACAAACGATGAG-3' 5'-GAGGAGCAGCTTATG-3' 5'-GTGGTTCAGGTGGCT-3' mdrl-1702s S 5'-GAAAACATTCGCTATGGCCGTGAAAATG-3' mdrl-1456s S 5'-GCAGCTGATGAATCC-3' mdrl-1918s S 5"GTGGTGGGCAGgaCAGAGGATCGC-3' mdrl-1595sM (K536Q) 5'-GTTGAGTGGTGuCAGAAGCAGAG-3' mdrl-1590sM (G534D) 5'-GTGGTGGGCAGwCAGAGGATCGC-3' mdrl-1595sM (K536R) 5"CCAGTTGAGGGGTGGGCAG-3' mdrl-1587sM(S532R) 5'-GAAAACATTCGsGCCGTGAAAATG-3' mdrl-1486sM (AY490) 5'-GGCAAGGGCATCCTGGCTGCAGA-3' alh79s* P 5'-TAACGGGCCAGAACATTGGCATT-3' alh521a* P p, s p, s S mdrl-1781a mdrl-1076s The number indicates the positionof the first primer nucleotide in thecorresponding EMBL file cDNA sequences of rabbit aldolase A (ald), human MDRl (mdrl),or CHOMDRl (mdrlc);s, sense direction; a, antisense direction tocDNA sequence. Login to comment
90 The localization ofAY490, S532R, G534D, K536R, K536Q, and AY490-K536Q in the N-terminal half of MDRl is shown in Fig. 1. Login to comment
110 MRK16 recognizes external epitopes of human MDRl without cross-reactions with rodent P-glycoproteins (Hamada and Tsuruo, 1991).The AY490 and AY490-K536Q transfectants were negative for MRK16 like the parentcontrol line CHO K1 (Fig. 4A).In the S532R and G534D MDRls recombinant cell lines, mixed populations of MRK16 immunoreactive cells were observed (Fig. 4A).Subsequentexposure to colchicine(100,125, 150,or 175ng/ml) increased the proportion of cells with higher antigen density with increasing colchicine concentration (Fig. 4B). Login to comment
111 However, the MRK16 signals on these cells were still 15-fold (S532R) or &fold (G534D)lower than in the K1clone that had been transfected with MDRls wild-type sequence (Table11). Login to comment
113 Phenotype of Multidrug Resistance and Collateral Sensitiuity-Transfection withMDRl vector constructsren- AY490 G534D K536Q 1 ". Login to comment
123 MDRlcell lines with low (S532R, G534D) or no expression of human P- log Fluorescence Intensity ( 3 Decades) B S532R G534D log Fluorescence Intensity ( 3 Decades ) FIG.4. Login to comment
128 B, FACS analysis of the S532R and G534D MDRls mutant cell lines TABLEI1 Cell surface expression of human P-glycoprotein inMDRls recombinant CHO K1 cells 5 x lo5freshly trypsinized cells in the exponential phase of growth were incubated with 3 pg of anti-human-MDR1 monoclonal antibody MRK16 and then with fluorescein isothiocyanate-labeled rabbit anti-mouse I&. Immunofluorescence of cells was recorded on a FACS. Login to comment
130 Cell line Fluorescence Signalnormalized to CHO K1 control CHO K1 8.6 x 10' CHO K1 (MDR1) 1.0 CHO K1 (AY490 MDR1) 6.3 x 10' 0.7 CHO K1 (S532R MDR1)" 4.4 x 104 51 CHO K1 (G534D MDR1)" 2.1 x 105 240 CHO K1 (K536R MDR1) 5.6 x 105 650 CHO K1 (K536Q MDR1) 9.4 x 105 CHO K1 (AY490-K536QMDR1) 2.1 x lo3 1,100 6.5 x 105 750 2.4 a The datarefer to the MRK16-positive subpopulation. Login to comment
147 Opentriangles, wild-type MDRls CHO K1; closed cycles, K536R MDRls K1; closed triangles, K536Q MDRls K1; stars, S532R MDRls K1; opencircles, AY490 MDRls K1; closed squares, G534D MDRls K1; bars, AY490-K536QMDRls K1; open squares,CHO K1. Login to comment
165 Forthe MDRl system, thecorresponding mutations S532R and G534D conferred only a subtle increase of multidrugresistanceto CHO K1 cells with low amounts of S532R MDRl and G534D MDRl being expressed on the surface of the recombinant host cell. Login to comment

PMID: 9169612 [PubMed] Bakos E et al: "Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region."

No. Sentence Comment

7 The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane INTRODUCTION The multidrug resistance phenotype in cancer cells is often caused by the overexpression of special membrane transport proteins, the P-glycoprotein [also known as the multidrug resistance protein (MDR1)] and\or the multidrug resistance-associated protein. Login to comment
25 They found that the MDR1 mutants containing a Ser Arg (S532R) or a Gly Asp (G534D) substitution were present at very low levels in the plasma membrane, and thus did not confer drug resistance. Login to comment
38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT. Login to comment
64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19]. Login to comment
73 In immunoflow cytometry experiments, the mutant MDR1 proteins G534D, R538M and I541R were recognized by both monoclonal antibodies, in a manner indistinguishable from that of the wild-type protein (Figure 3). Login to comment
88 On the other hand, when the isolated membranes contained similar amounts of the MDR1 proteins harbouring the mutation G534D or I541R (Table 1), none of the drugs examined was able to stimulate ATPase activity. Login to comment
100 Mutants G534D and I541R were unable to catalyse ATP hydrolysis, even when high concentrations of ATP were present in the incubation medium (Figure 5). Login to comment
125 In the case of the mutants G534D and I541R, we found full MDR1 protein expression but a complete loss of drug-stimulated ATPase activity. Login to comment
130 Mutation G534D in MDR1 is equipositional with the G551D mutant of the human CFTR, which causes severe cystic fibrosis and is the second most frequently observed mutation in this disease [26]. Login to comment
133 In the experiments of Hoof et al. [13] the G534D MDR1 mutant was found to be expressed only in very low amounts at the surface of the recombinant mammalian host cells; thus this mutation may also affect the maturation of MDR1. Login to comment
134 Since in our studies the human MDR1 ATPase activity was measured in isolated insect cell membranes, the present experiments confirm that the G534D mutant, although expressed normally, is non-functional. Login to comment
154 The (fully expressed) R538M mutant had decreased maximum MDR1 ATPase activity, while the G534D and I541R mutants showed a complete loss of activity despite retaining a wild-type ABC signature region in the C-terminal half of the protein. Login to comment

PMID: 16352426 [PubMed] Ambudkar SV et al: "The power of the pump: mechanisms of action of P-glycoprotein (ABCB1)."

No. Sentence Comment

52 Between the Walker A and B sequences is found a linker peptide with the sequence LSGGQ, also known as the C-region or ABC signature sequence, as it is the hallmark of Table 1 - Summary of mutational analysis of conserved residues in nucleotide-binding domains of Pgp Domain Source Residue number Function Reference NBD1 NBD2 A-loop Human Y401A Y1044A No ATP binding/hydrolysis Kim et al. (submitted for publication) Walker A Mouse K429N K1072N Normal ATP binding but no hydrolysis Azzaria et al. (1989) G431A G1073A Human C431 C1074 ATP protects from modification by N-ethylmaleimide Loo and Clarke (1995) Disulfide bond formation between Walker A domains of both NBDs Urbatsch et al. (2001) Human K433M K1076M Decreased ATP-binding Muller et al. (1996) No ATP hydrolysis Szakacs et al. (2000) No vanadate-trapping, but aluminum and beryllium fluoride-induced trapping normal Q-loop Mouse Q471 Q1114 Not essential for ATP hydrolysis but may be involved in communication with drug-substrate sites Urbatsch et al. (2000a) LSGGQ or linker peptide or signature motif Mouse S528A S1173A Normal ATP binding but no hydrolysis Tombline et al. (2004a) Human S532R Decreased cell surface expression Hoof et al. (1994) Human G534C G1179C No ATP hydrolysis Loo et al. (2002) Human G534D Decreased cell surface expression Hoof et al. (1994) No drug resistance Normal cell surface expression Bakos et al. (1997) No ATP hydrolysis Human G534D/V G1179D Interdomain communication Szakacs et al. (2001) Human Q535C Q1180C No ATP hydrolysis Loo et al. (2002) Human K536Q Decreased drug resistance Hoof et al. (1994) LSGGQ or linker peptide or signature motif Human K536R Increased colchicine resistance (normal ATP hydrolysis?) Login to comment

PMID: 23741405 [PubMed] Dickens D et al: "A multi-system approach assessing the interaction of anticonvulsants with P-gp."

No. Sentence Comment

60 The ATPase deficient mutant encodes for a transporter with an amino acid change (G534D) that has previously been ectopically expressed and shown to be expressed at equivalent levels as the wild type protein and with normal membrane insertion but has a complete loss of drug-stimulated ATPase activity [31]. Login to comment