ABCMdb

ABCB1 p.Asp555Asn

Predicted by SNAP2:	A: D (91%), C: D (85%), E: D (85%), F: D (91%), G: D (91%), H: D (91%), I: D (91%), K: D (91%), L: D (91%), M: D (91%), N: D (91%), P: D (95%), Q: D (91%), R: D (91%), S: D (85%), T: D (85%), V: D (91%), W: D (95%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
165 But Hrycyna et al. [9] reported that the mutations D555N and D1200N (D555 and D1200 are presumably involved in Mg2+ binding) resulted in impaired nucleotide photoaffinity labeling only for D555N. Login to comment

[hide] Both ATP sites of human P-glycoprotein are essenti... Biochemistry. 1999 Oct 19;38(42):13887-99. Hrycyna CA, Ramachandra M, Germann UA, Cheng PW, Pastan I, Gottesman MM
Both ATP sites of human P-glycoprotein are essential but not symmetric.
Biochemistry. 1999 Oct 19;38(42):13887-99., 1999-10-19 [PMID:10529234]

Abstract [show]
Human P-glycoprotein (P-gp) is a cell surface drug efflux pump that contains two nucleotide binding domains (NBDs). Mutations were made in each of the Walker B consensus motifs of the NBDs at positions D555N and D1200N, thought to be involved in Mg(2+) binding. Although the mutant and wild-type P-gps were expressed equivalently at the cell surface and bound the drug analogue [(125)I]iodoarylazidoprazosin ([(125)I]IAAP) comparably, neither of the mutant proteins was able to transport fluorescent substrates nor had detectable basal nor drug-stimulated ATPase activities. The wild-type and D1200N P-gps were labeled comparably with [alpha-(32)P]-8-azido-ATP at a subsaturating concentration of 2.5 microM, whereas labeling of the D555N mutant was severely impaired. Mild trypsin digestion, to cleave the protein into two halves, demonstrated that the N-half of the wild-type and D1200N proteins was labeled preferentially with [alpha-(32)P]-8-azido-ATP. [alpha-(32)P]-8-Azido-ATP labeling at 4 degrees C was inhibited in a concentration-dependent manner by ATP with half-maximal inhibition at approximately 10-20 microM for the P-gp-D1200N mutant and wild-type P-gp. A chimeric protein containing two N-half NBDs was found to be functional for transport and was also asymmetric with respect to [alpha-(32)P]-8-azido-ATP labeling, suggesting that the context of the ATP site rather than its exact sequence is an important determinant for ATP binding. By use of [alpha-(32)P]-8-azido-ATP and vanadate trapping, it was determined that the C-half of wild-type P-gp was labeled preferentially under hydrolysis conditions; however, the N-half was still capable of being labeled with [alpha-(32)P]-8-azido-ATP. Neither mutant was labeled under vanadate trapping conditions, indicating loss of ATP hydrolysis activity in the mutants. In confirmation of the lack of ATP hydrolysis, no inhibition of [(125)I]IAAP labeling was observed in the mutants in the presence of vanadate. Taken together, these data suggest that the two NBDs are asymmetric and intimately linked and that a conformational change in the protein may occur upon ATP hydrolysis. Furthermore, these data are consistent with a model in which binding of ATP to one site affects ATP hydrolysis at the second site.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Two internal complementary primers were used, each containing the mutation of interest (G f A at position 1663 for D555N). Login to comment
61 The coding sequence for the D555N mutant primer was 5'- CTCCTGCTGAATGAGGCCAC-3'. Login to comment
70 The resulting plasmid was called pTM1-MDR1-D555N. Login to comment
79 The D555N/D1200N double mutant was constructed exactly like pTM1-MDR1-D1200N except that pTM1-MDR1-D555N was used as the template for the first PCR reaction. Login to comment
80 The resulting expression plasmid was named pTM1-MDR1-D555N/ D1200N. Login to comment
106 Recombinant vaccinia viruses vvT7MDR1(WT) (wild-type P-gp), vvMDR1-CM (P-gp-D1200N), vvMDR1-Mg5 (P-gp-D555N), and vvMDR1-DM (P-gp-D555N/D1200N) were constructed as previously described (28) from the corresponding pTM1-MDR1 vectors described above. Login to comment
163 The two mutants, designated P-gp-D555N and P-gp-D1200N, were constructed by site-directed mutagenesis, cloned into pTM1-MDR1, and transiently expressed in HeLa cells coinfected with the vaccinia virus vTF7-3 as described under Experimental Procedures. Login to comment
165 Total extracts from HeLa cells expressing wild-type P-gp, P-gp-D555N, P-gp-D1200N, and the double mutant P-gp-D555N/ D1200N were subjected to immunoblot analysis with the monoclonal antibody C219 (32). Login to comment
166 While P-gp-D1200N was found to be expressed at a level comparable to wild-type P-gp, in this preparation of membranes it appears that less P-gp-D555N and P-gp D555N/D1200N were expressed compared to wild-type. Login to comment
169 Fluorescent substrate accumulation assays were performed on intact HeLa cells expressing wild-type P-gp, P-gp-D555N, and P-gp-D1200N with the P-gp substrate calcein-AM. Login to comment
170 HeLa cells were transiently infected with vTF7-3 and transfected with pTM1-MDR1 (wild-type), pTM1-MDR1-D555N, and pTM1-MDR1-D1200N, with pTM1 as the negative control, and allowed to incubate for approximately 24 h. After incubation with 0.5 µM calcein-AM for 10 min, cells expressing wild-type P-gp accumulated less substrate than the pTM1 control as measured by a decrease in fluorescence intensity (Figure 2). Login to comment
172 Strikingly, the two Walker B mutants P-gp-D555N and P-gp-D1200N were completely devoid of transport function (Figure 2). Login to comment
178 The ability of Walker B mutants P-gp-D555N, P-gp-D1200N, and P-gp-D555N/D1200N to hydrolyze ATP either in the absence (basal) or presence (drug-stimulated) of 25 µM verapamil was measured as the vanadate-sensitive release of inorganic phosphate from Mg2+ ‚ATP as described under Experimental Procedures, with membrane preparations from vTF7-3-infected HeLa cells alone or vTF7-3-infected cells that were coinfected with recombinant vaccinia viruses encoding wild-type P-gp, P-gp-D555N, P-gp-D1200N, and P-gp-D555N/D1200N. Login to comment
184 (A) vTF7-3-infected-transfected HeLa cells (500 000) expressing wild-type P-gp (bold line), P-gp-D555N (---), and P-gp-D1200N (-‚-) were subjected to FACS analysis after incubation with 5 µg of MRK-16 for 30 min at 37 °C, washing (200g, 5 min), and staining with FITC-conjugated anti-mouse IgG secondary antibody (1 µg) for 30 min at 37 °C. Login to comment
188 HeLa cells were infected with vTF7-3 recombinant vaccinia viruses expressing wild-type P-gp, P-gp-D555N, P-gp-D1200N, and P-gp-D555N/D12000N and harvested after 48 h. Membranes (1 µg/lane) prepared from these cells were subjected to SDS-PAGE and immunoblotting with monoclonal antibody C219 (1:1500). Login to comment
191 HeLa cells were infected with vTF7-3 and transfected with pTM1-MDR1 (wild type), pTM1-MDR1-D555N, and pTM1-MDR1-D1200N for 24 h. Calcein (0.5 µM) accumulation was determined in these cells by FACS after a 10 min incubation at 37 °C in the presence (thin line) and absence (bold line) of 2 µM cyclosporin A. vTF7-3-infected cells transfected with pTM1 vector DNA were included as a negative control. Login to comment
195 Crude membrane preparations derived from HeLa cells infected with vTF7-3 alone and from cells coinfected with recombinant vaccinia viruses encoding wild-type P-gp, P-gp-D555N, P-gp-D1200N, and P-gp-D555N/D1200N were labeled with [125I]IAAP at a concentration of 7.5 nM, immunoprecipitated with anti-P-gp polyclonal antibody PEPG-2 (33), and subjected to SDS-PAGE and autoradiography (Figure 4A). Login to comment
202 To further demonstrate that ATP hydrolysis is essential and to evaluate the roles of the two NBDs for inhibition of [125I]IAAP labeling as a result of vanadate trapping, we analyzed the effects of the Walker B consensus motif mutations D555N, D1200N, and D555N/D1200N. Login to comment
207 Human P-gp-D555N and P-gp-D1200N Differ Dramatically in Their Ability To Be Labeled with [R-32P]-8-Azido-ATP. Login to comment
210 Membrane preparations from HeLa cells infected with vTF7-3 and coinfected with vvT7MDR1 (WT) (wild-type P-gp), vvMDR1-CM (P-gp-D1200N), vvMDR1-Mg5 (P-gp-D555N), or vvMDR1-DM (P-gp-D555N/D1200N). Login to comment
216 (A) Wild type and the mutant P-gps D555N, D1200N, and D555N/1200N were expressed in HeLa cells by use of recombinant vaccinia viruses, and crude membranes (45 µg) were used for [125I]IAAP photoaffinity labeling. Login to comment
220 Wild-type (b) and mutant Pgps, D555N ([), D1200N (4), and D555N/D1200N (O) were expressed in HeLa cells by use of recombinant vaccinia viruses and crude membranes (15 µg) were used for [125I]IAAP labeling in the presence of varying concentrations of vanadate, 5 mM MgCl2, and 2.5 mM ATP. Login to comment
227 Strikingly, the [R-32P]-8-azido-ATP labeling observed in membranes expressing P-gp-D555N and P-gp-D555N/D1200N was severely impaired. Login to comment
229 These results suggest that the ability to bind ATP to the N-half ATP site, as determined by photoaffinity labeling, is eliminated or reduced significantly in the protein containing a mutation in the magnesium binding site (D555N). Login to comment
232 The same experiment was subsequently performed at a saturating concentration of 77.5 µM [R-32P]-8-azido-ATP, and under these conditions, the same differential labeling phenomenon is observed, although slightly more label is incorporated into P-gp-D555N (Figure 5B). Login to comment
239 As was demonstrated in Figure 5, again, no substantial labeling was observed for P-gp-D555N. Login to comment
251 Crude membrane preparations (50 µg) from HeLa cells infected with vTF7-3 and recombinant vaccinia viruses expressing wild-type P-gp, P-gp-D555N, P-gp-D1200N, or P-gp-D555N/ D1200N were photoaffinity-labeled on ice (0 °C) with either (A) 2.5 µM or (B) 77.5 µM [R-32P]-8-azido-ATP. Login to comment
255 Crude membrane preparations (50-60 µg) from HeLa cells infected with vTF7-3 and recombinant vaccinia viruses expressing wild-type P-gp, P-gp-D555N, P-gp-D1200N, or P-gp-D555N/D1200N were photoaffinity-labeled with either (A) [R-32P]- 8-azido-ATP (2.5 µM) or (B) [125I]IAAP (15 nM) as described in the legend to Figures 4 and 5. Login to comment
272 Similar to P-gp-D1200N, P-gp-D555N and P-gp-D555N/D1200N were not capable of being vanadate-trapped, confirming their lack of ATPase activity (data not shown). Login to comment
292 Under the conditions of this assay, P-gp-D555N was labeled poorly, precluding the reliable estimation of the concentration required for 50% inhibition of labeling by ATP for this construct. Login to comment
294 Under the conditions of the assay, the binding capacity of the C-site, as demonstrated by labeling of P-gp-D555N, is limited and could not be reliably quantitated. Login to comment
297 To determine if conformational differences exist between active wild-type Pgp and inactive P-gp-D555N and P-gp-D1200N, the reactivity of these constructs expressed transiently in HeLa cells was assessed by use of the conformation-sensitive monoclonal anti-human P-gp antibody UIC2 (5, 45). Login to comment
300 Furthermore, the UIC2 reactivity of cells expressing either P-gp-D555N and P-gp-D1200N is indistinguishable from each other, in either the presence or absence of cyclosporin A, and is equivalent to that of the cyclosporin A-treated wild-type-expressing cells. Login to comment
301 These UIC2 reactivity data, taken together with the ATPase data that demonstrated complete abrogation of ATPase activity for the D555N and D1200N P-gp proteins (Figure 3) and the ATP labeling data that demonstrated marked differences in the ability of these molecules to bind ATP (Figure 5), strongly suggest that the intrinsic ability of the P-gp molecule to hydrolyze ATP or associate with hydrolysis products accounts for the difference in conformation detected by UIC2. Login to comment
307 The extremely low labeling efficiency of P-gp-D555N precluded analysis of that protein in this assay. Login to comment
315 FIGURE 8: UIC2 reactivity shift induced by incubation with cyclosporin A. vTF7-3-infected-transfected HeLa cells expressing wild-type P-gp, P-gp-D555N, or P-gp-D1200N were subjected to FACS analysis after staining with UIC2 in the presence (thin line) and absence (bold line) of 5 µM cyclosporin A. Login to comment
354 These mutations at positions D555N and D1200N, made separately or in concert, did not affect the ability of the transporter to bind substrate but completely abrogated transport function and both basal and drug-stimulated ATPase activity. Login to comment
365 Whereas P-gp-D1200N, the mutant transporter with a C-terminal amino acid substitution, labels comparably to the wild-type protein, P-gp-D555N, containing a homologous N-terminal mutation, is severely impaired in its ability to be labeled with [R-32P]-8-azido-ATP. Login to comment
366 The inability of P-gp-D555N to be labeled efficiently even though the C-half NBD was intact may be because the mutation severely affected the ability of Mg‚ATP to bind to the N-half NBD, and the protein exists in such a conformation that either the C-half NBD site is obscured from nucleotide or the amino acid to which the azido group is to be cross-linked is improperly positioned. Login to comment
367 This hypothesis that the N-half NBD was impaired for labeling in the D555N protein was supported through analysis of the labeling pattern of the two halves of the molecule. Login to comment
368 After mild trypsinization, it was apparent that the N-half is predominantly labeled in the D1200N and wild-type proteins, whereas little to no labeling of the N-half of the P-gp-D555N was observed. Login to comment
393 This model is also consistent with the data from the nonfunctional Walker B motif mutants, P-gp-D555N and P-gp-D1200N. Login to comment
395 In the case of P-gp-D555N, only the C-half is intact. Login to comment

[hide] Effect of ABC transporters on HIV-1 infection: inh... FASEB J. 2000 Mar;14(3):516-22. Lee CG, Ramachandra M, Jeang KT, Martin MA, Pastan I, Gottesman MM
Effect of ABC transporters on HIV-1 infection: inhibition of virus production by the MDR1 transporter.
FASEB J. 2000 Mar;14(3):516-22., [PMID:10698967]

Abstract [show]
The MDR1 multidrug transporter P-gp (P-glycoprotein) is an efflux pump that extrudes diverse hydrophobic drugs and peptides from cells. Since the entry of HIV-1 into cells involves an initial interaction of the viral gp41 hydrophobic peptide with the plasma membrane, a potential effect of P-gp on HIV-1 infectivity was explored. Virus production was greatly decreased when P-gp was overexpressed at the surface of a continuous CD4(+) human T-leukemic cell line (12D7) infected with HIV-1(NL4-3), a T-tropic molecular clone of HIV-1. P-gp overexpression did not significantly alter the surface expression or distribution of either the HIV-1 receptor CD4 or the coreceptor CXCR4. Reduction of HIV-1 infectivity in P-gp-expressing cells occurred both during the fusion of viral and plasma membranes and at subsequent step(s) in the HIV-1 life cycle.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 MDR1mt contains the mutant residue Asn in place of Asp at position 555 of the molecule (D555N). Login to comment
41 Target HeLa cells were coinfected with VCB3 (CD4-expressing vv), VTF7-3 (vv expressing T7 RNA polymerase), and either of the following vv: WR (wild-type control), MDR1, D555N (amino-terminal ATP binding site mutant of MDR1), V185 (substrate mutant of MDR1 that changes substrate specificity of MDR1) (18), or CFTR (19). Login to comment
58 Bicistronic constructs expressing either wild-type (wt) MDR1 or MDR1 mutated (D555N) at the ATP utilization site (mt) to inactivate P-gp pump function and DHFR were stably introduced into 12D7 cells by selection with methotrexate (24, 25). Login to comment
82 Similar results were seen in five independent experiments. Figure 3 shows that fusion was greatly reduced in target cells expressing either wt MDR1, MDR1 with an inactivating amino-terminal ATP-utilization site (D555N) mutation that renders the transporter inactive or MDR1 with a single mutation in the substrate binding site (G185V) (18). Login to comment
96 WR: wild-type control; MDR1: wild-type MDR1; D555N: amino-terminal ATP binding site mutant of MDR1; G185V; substrate mutant of MDR1 that changes the substrate specificity; CFTR: cystic fibrosis transmembrane regulator. Login to comment
152 We wish to thank J. A. Hoxie (University of Pennsylvania) for providing 12G5 CXCR4 antibody; Y. Sugimoto (Japanese Foundation for Cancer Research) for providing biotinylated MRK16-Fab antibody; G. Englund (NIAID) for help with the three-color FACS analyzes; K. Strebel (NIAID) for help with fluorescence microscopy; C. A. Hrycyna (NCI) for providing the D555N cDNA, for further construction of the pHMIDmt, and the generation of recombinant vaccinia viruses; E. A. Berger (NIAID) for providing VCB3, VTF7-3, VCB21, VCB16, and VCB60 vaccinia viruses; M. Welsh (University of Iowa College of Medicine) for the CFTR vaccinia virus; and Y. Raviv and R. Blumenthal (NCI-Frederick) for discussions and data sharing. Login to comment

[hide] Nucleotide-induced conformational changes in P-gly... Biochemistry. 2000 Apr 18;39(15):4559-68. Julien M, Gros P
Nucleotide-induced conformational changes in P-glycoprotein and in nucleotide binding site mutants monitored by trypsin sensitivity.
Biochemistry. 2000 Apr 18;39(15):4559-68., 2000-04-18 [PMID:10758006]

Abstract [show]
Limited trypsin digestion was used to monitor nucleotide-induced conformational changes in wild-type P-glycoprotein (Pgp) as well as in nucleotide binding domain (NBD) Pgp mutants. Purified and reconstituted wild-type or mutant mouse Mdr3 Pgps were preincubated with different hydrolyzable or nonhydrolyzable nucleotides, followed by limited proteolytic cleavage at different trypsin:protein ratios. The Pgp tryptic digestion products were separated by SDS-PAGE followed by immunodetection with the mouse monoclonal anti-Pgp antibody C219, which recognizes a conserved epitope (VVQE/AALD) in each half of the protein. Different trypsin digestion patterns were observed for wild-type Pgp incubated with MgCl(2) alone, MgADP, MgAMP.PNP, MgATP, and MgATP + vanadate. A unique trypsin digestion profile suggestive of enhanced resistance to trypsin was observed under conditions of vanadate-induced trapping of nucleotides (MgATP + vanadate). The trypsin sensitivity profiles of Pgp mutants bearing either single or double mutations in Walker A (K429R, K1072R) and Walker B (D551N, D1196N) sequence signatures of NBD1 and NBD2 were analyzed under conditions of vanadate-induced trapping of nucleotides. The proteolytic cleavage pattern observed for the double mutants K429R/K1072R and D551N/D1196N, and for the single mutants K429R, K1072R, and D1196N were similar and clearly distinct from wild-type Pgp under the same conditions. This is consistent with the absence of ATP hydrolysis and of vanadate-induced trapping of 8-azido-ADP previously reported for these mutants [Urbatsch et al. (1998) Biochemistry 37, 4592-4602]. Interestingly, the trypsin digestion profiles observed under vanadate-induced trapping for the D551N and D1196N mutants were quite different, with the D551N mutant showing a profile resembling that seen for wild-type Pgp. The different sensitivity profiles of Pgp mutants bearing mutations at the homologous residue in NBD1 (D551N) and NBD2 (D1196N) suggest possible structural and functional differences between the two sites.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
232 Additional photolabeling experiments using the Walker B mutants D555N and D1200N showed that in contrast to results from Urbatsch et al. (15), only the D1200N mutant can be photolabeled under binding conditions with all the label being present at the NBD1 (16). Login to comment

[hide] Analysis of the properties of the N-terminal nucle... Biochemistry. 2000 May 9;39(18):5518-26. Booth CL, Pulaski L, Gottesman MM, Pastan I
Analysis of the properties of the N-terminal nucleotide-binding domain of human P-glycoprotein.
Biochemistry. 2000 May 9;39(18):5518-26., 2000-05-09 [PMID:10820025]

Abstract [show]
Human P-glycoprotein, the MDR1 gene product, requires both Mg(2+)-ATP binding and hydrolysis to function as a drug transporter; however, the mechanism(s) defining these events is not understood. In the present study, we explored the nature of Mg(2+)-ATP binding in the N-terminal nucleotide-binding domain of human P-glycoprotein and identified the minimal functional unit required for specific ATP binding. Recombinant proteins encompassing amino acids within the region beginning at 348 and ending at 707 were expressed in Escherichia coli, purified from inclusion bodies under denaturing conditions, and renatured by rapid dilution. The ability of ATP to interact with these proteins was examined by use of the photoactive ATP analogue [alpha-(32)P]-8-azido-ATP. Photoaffinity labeling of recombinant proteins identified the region between amino acids 375 and 635 as the region necessary to obtain specific ATP-binding properties. Specific protein labeling was saturable, enhanced by Mg(2+), and inhibited by ATP. Recombinant proteins confined within the region beginning at amino acid 392 and ending at amino acid 590 demonstrated nonspecific [alpha-(32)P]-8-azido-ATP labeling. Nonspecific labeling was not enhanced by Mg(2+) and was inhibited only by high concentrations of ATP. Using a D555N mutated protein, we found that the conserved aspartate residue in the Walker B motif plays a role in magnesium-enhanced ATP-binding. Taken together, these data define the region of the N-terminal nucleotide-binding domain of P-glycoprotein that is required for specific ATP binding and suggest that magnesium may play a role in stabilizing the ATP-binding site.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Using a D555N mutated protein, we found that the conserved aspartate residue in the Walker B motif plays a role in magnesium-enhanced ATP-binding. Login to comment
45 pTM1-MDR1 and pTM1-MDR1-D555N were supplied by Dr. Christine Hrycyna (25, 29). Login to comment
62 A plasmid, containing a Table 1: Cloning Summary for Expression Vectors plasmid name cloning vector PCR primers (5' f 3')a restriction enzymesb pET-NBD1MDR1-C431A (358-707) pET3a A: GCAATACATATGGCAAGAGGAGCAGCTTATGAAATCTTC A: NdeI B: AAAGGATCCTCATTCAGTTAAATTTAGCTTCATAATCCT B: BamHI pET-NBD1MDR1-C431A/D555N (358-707) pET3a A: GCAATACATATGGCAAGAGGAGCAGCTTATGAAATCTTC A: NdeI B: AAAGGATCCTCATTCAGTTAAATTTAGCTTCATAATCCT B: BamHI pET-NBD1MDR1-C431A (412-574) pET23a A: GTTAAGATGCATATGGGCCTGAACCTGAAGGTGCAGAGT A: NdeI B: ACCTTTGAATTCTCAATCCAGAGCCACCTGAACCACTGC B: EcoRI pET-NBD1MDR1-C431A (358-590) pET3a A: GCAATACATATGGCAAGAGGAGCAGCTTATGAAATCTTC A: NdeI B: ATTGGATCCTCAAGACAAACGATGAGCTATCACAATGGT B: BamHI pET-NBD1MDR1-C431A (358-635) pET23a A: GAGATATACATATGGCAAGAGGAGCA A: NdeI B: TCTCCTCGAGCTAAACTTCATTTCCTGCTGTCTG B: XhoI pET-NBD1MDR1-C431A (409-635) pET23a A: GAGACATATGATCTTGAAGGGCCTGAACCTG A: NdeI B: TCTCCTCGAGCTAAACTTCATTTCCTGCTGTCTG B: XhoI pET-NBD1MDR1-C431A (375-707) pET23a A: GAGACATATGATTGACAGCTATTCGAAGAGT A: NdeI B: TCTCCTCGAGCTATTCAGTTAAATTTAGCTTCAT B: XhoI pET-NBD1MDR1-C431A (392-707) pET23a A: GAGACATATGTTGGAATTCAGAAATGTTCAC A: NdeI B: TCTCCTCGAGCTATTCAGTTAAATTTAGCTTCAT B: XhoI pET-NBD1MDR1-C431A (348-635) pET23a A: GAGACATATGGCATCTCCAAGCATTGAAGCATTTGCAAAT- GCAAGAGGAGCAGCT A: NdeI B: TCTCCTCGAGCTAAACTTCATTTCCTGCTGTCTG B: XhoI a A, forward primer; B, reverse primer. Login to comment
64 sequence encoding MDR1 amino acids 358-707 with both C431A and D555N mutations, was prepared as described above, with the pTM1-MDR1-D555N vector bearing the MDR1 coding sequence with a D555N mutation as the primary template, and was labeled pET-NBD1MDR1-C431A/ D555N (358-707). Login to comment
92 Sample consisted of NBD1 (358-707) or NBD1 D555N (358-707) proteins (~250 µg/mL) in 50 mM potassium phosphate/50 mM NaCl (pH 7.0). Login to comment
129 (A) Expression of NBD1 proteins before (lanes 1, 3, 5, and 7) and after (lanes 2, 4, 6, and 8) IPTG induction. NBD1 proteins were as follows: NBD1 (358-707), lanes 1-2; NBD1 D555N (358-707), lanes 3 and 4; NBD1 (412-574), lanes 5 and 6; and NBD1 (358-590), lanes 7 and 8. Login to comment
130 (B) Purified NBD1 proteins were identified by colloidal blue staining as follows: NBD1 (358-707), lane 1; NBD1 D555N (358-707), lane 2; NBD1 (412-574), lane 3; and NBD1 (358-590), lane 4. Login to comment
133 NBD1 proteins were as follows: (A) NBD1 (358-707), (B) NBD1 (358-590), (C) NBD1 (412-574), and (D) NBD1 D555N (358-707). Login to comment
136 D555N Amino Acid Substitution in the Walker B Consensus Sequence Results in an Alteration in Mg2+ -Enhanced ATP Binding. Login to comment
137 To evaluate the effect of Mg2+ on [R-32 P]-8-azido-ATP labeling, the NBD1 (358-707) protein was mutated at position 555 from aspartate to asparagine in the Walker B consensus motif (36). Login to comment
139 Thus, the NBD1 D555N (358-707) protein serves as a specificity control in the present work. Login to comment
140 Expression and purification of NBD1 D555N (358-707) protein is shown in Figure 1. Login to comment
141 As demonstrated, NBD1 D555N (358-707) protein was localized in the inclusion-body protein and was purified by the methods described previously. Login to comment
142 Unlike the wild-type NBD1 (358-707) protein, [R-32 P]-8-azido-ATP labeling of the mutant NBD1 D555N (358-707) protein was greater in the absence of MgSO4 than in the presence of MgSO4 (Figure 2D). Login to comment
143 In fact, in the presence of MgSO4 the ability of [R-32 P]-8-azido-ATP to label NBD1 D555N (358-707) protein was impaired severely (Figure 2D). Login to comment
144 Incubation of [R-32P]-8-azido-ATP with NBD1 (358-707) protein or NBD1 D555N (358-707) protein in the presence of increasing concentrations of MgSO4 resulted in an increase in labeling with wild-type protein and a decrease in labeling with mutant protein (data not shown). Login to comment
145 The specificity of labeling of NBD1 D555N (358-707) protein was explored by incubating the protein with [R-32 P]-8-azido-ATP in the presence of increasing concentrations of ATP in the absence of MgSO4. Login to comment
148 Analysis of NBD1 (358-707) and NBD1 D555N (358-707) proteins by CD was performed in order to assess the secondary structural components and to evaluate the effect of Mg2+. Login to comment
149 The predicted secondary structural components of these proteins were 25% R-helix, 23% -strand, and 19% -turn; no differences between NBD1 (358-707) and NBD1 D555N (358-707) proteins were demonstrated (data not shown). Login to comment
150 Similarly, the predicted secondary structural elements of NBD1 (358-707) and NBD1 D555N (358-707) proteins in the presence of 2 mM MgSO4 were not different than in the absence of MgSO4 (data not shown). Login to comment
151 A temperature melt was performed to determine the thermal stability of NBD1 (358-707) and NBD1 D555N (358-707) proteins. Login to comment
220 Secondary structural analysis of NBD1 (358-707) and NBD1 D555N (358-707) proteins by circular dichroism showed 25% R-helix, 23% -strand, and 19% -turn with no significant difference in secondary structure between the two proteins. Login to comment
224 More interesting was the lack of secondary structural change of NBD1 (358-707) and NBD1 D555N (358-707) proteins in the presence of Mg2+ . Login to comment
249 The C431A and D555N mutations within the Walker A and Walker B motifs, respectively, are identified by vertical bars. Login to comment

[hide] Functionally similar vanadate-induced 8-azidoadeno... J Biol Chem. 2001 Jun 15;276(24):21199-208. Epub 2001 Apr 3. Sauna ZE, Smith MM, Muller M, Ambudkar SV
Functionally similar vanadate-induced 8-azidoadenosine 5'-[alpha-(32)P]Diphosphate-trapped transition state intermediates of human P-glycoprotin are generated in the absence and presence of ATP hydrolysis.
J Biol Chem. 2001 Jun 15;276(24):21199-208. Epub 2001 Apr 3., 2001-06-15 [PMID:11287418]

Abstract [show]
P-glycoprotein (Pgp) is an ATP-dependent drug efflux pump whose overexpression confers multidrug resistance to cancer cells. Pgp exhibits a robust drug substrate-stimulable ATPase activity, and vanadate (Vi) blocks this activity effectively by trapping Pgp nucleotide in a non-covalent stable transition state conformation. In this study we compare Vi-induced [alpha-(32)P]8-azido-ADP trapping into Pgp in the presence of [alpha-(32)P]8-azido-ATP (with ATP hydrolysis) or [alpha-(32)P]8-azido-ADP (without ATP hydrolysis). Vi mimics P(i) to trap the nucleotide tenaciously in the Pgp.[alpha-(32)P]8-azido-ADP.Vi conformation in either condition. Thus, by using [alpha-(32)P]8-azido-ADP we show that the Vi-induced transition state of Pgp can be generated even in the absence of ATP hydrolysis. Furthermore, half-maximal trapping of nucleotide into Pgp in the presence of Vi occurs at similar concentrations of [alpha-(32)P]8-azido-ATP or [alpha-(32)P]8-azido-ADP. The trapped [alpha-(32)P]8-azido-ADP is almost equally distributed between the N- and the C-terminal ATP sites of Pgp in both conditions. Additionally, point mutations in the Walker B domain of either the N- (D555N) or C (D1200N)-terminal ATP sites that arrest ATP hydrolysis and Vi-induced trapping also show abrogation of [alpha-(32)P]8-azido-ADP trapping into Pgp in the absence of hydrolysis. These data suggest that both ATP sites are dependent on each other for function and that each site exhibits similar affinity for 8-azido-ATP (ATP) or 8-azido-ADP (ADP). Similarly, Pgp in the transition state conformation generated with either ADP or ATP exhibits drastically reduced affinity for the binding of analogues of drug substrate ([(125)I]iodoarylazidoprazosin) as well as nucleotide (2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate). Analyses of Arrhenius plots show that trapping of Pgp with [alpha-(32)P]8-azido-ADP (in the absence of hydrolysis) displays an approximately 2.5-fold higher energy of activation (152 kJ/mol) compared with that observed when the transition state intermediate is generated through hydrolysis of [alpha-(32)P]8-azido-ATP (62 kJ/mol). In aggregate, these results demonstrate that the Pgp.[alpha-(32)P]8-azido-ADP (or ADP).Vi transition state complexes generated either in the absence of or accompanying [alpha-(32)P]8-azido-ATP hydrolysis are functionally indistinguishable.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Preparation of Crude Membranes from HeLa Cells Expressing Mutant and Wild-type Pgp-A 70-80% confluent monolayer of HeLa cells was infected with vTF7-3 and transfected with pTM1-MDR1 (wild type) or pTM1-MDR1 bearing the homologous mutations at positions 555 (D555N) and 1200 (D1200N) as described previously (9). Login to comment
56 The vaccinia virus expression vectors pTM1-MDR1 (wild type) and pTM1-MDR1(D555N) and pTM1-MDR1(D1200N) were provided by C. A. Hrycyna and M. M. Gottesman, Laboratory of Cell Biology, NCI, National Institutes of Health, Bethesda. Login to comment
224 The Pgp mutants D555N and D1200N in Walker B domain of ATP sites do not show Vi-induced trapping of [␣-32 P]8-azido-ADP using either [␣-32 P]8-azido-ADP or [␣-32 P]8-azido-ATP. Login to comment
225 Crude membranes were prepared from HeLa cells transiently expressing the pTM1-MDR1 (designated wild type) and pTM1-MDR1 bearing the homologous mutations in Walker B region of ATP sites at positions 555 and 1200 (designated D555N and D1200N), respectively. Login to comment
230 Lane 1, wild-type Pgp membranes labeled with [␣-32 P]8-azido-ATP; lane 2, D555N membranes labeled with [␣-32 P]8-azido-ATP; lane 3, D1200N membranes labeled with [␣-32 P]8-azido-ATP; lane 4, wild-type membranes labeled with [␣-32 P]8-azido-ADP; lane 5, D555N membranes labeled with [␣-32 P]8-azido-ADP; and lane 6, D1200N membranes labeled with [␣-32 P]8-azido-ADP. Login to comment
290 The mutations in either the N-terminal ATP site (D555N) or the C-terminal site (D1200N) abolish Vi-induced trapping of [␣-32 P]8-azido-ADP by both the hydrolysis and non-hydrolysis routes (Fig. 6). Login to comment

[hide] P-glycoprotein plays an insignificant role in the ... Cancer Res. 1998 Oct 15;58(20):4688-93. Russ G, Ramachandra M, Hrycyna CA, Gottesman MM, Pastan I, Bennink JR, Yewdell JW
P-glycoprotein plays an insignificant role in the presentation of antigenic peptides to CD8+ T cells.
Cancer Res. 1998 Oct 15;58(20):4688-93., [PMID:9788623]

Abstract [show]
Most antigenic peptides presented to CD8+ T cells are generated from cytosolic precursors and are translocated by TAP into the endoplasmic reticulum, where they associate with MHC class I molecules. TAP-deficient cells exhibit a limited capacity to deliver peptides from cytosolic proteins to class I molecules. One candidate for an alternative peptide transporter is P-glycoprotein, which transports numerous substances, including peptides, across membranes. Elevation of P-glycoprotein expression is partially responsible for the resistance developed by neoplasias to chemotherapeutic drugs. Overexpression of P-glycoprotein has been reported to enhance the expression of class I molecules. Here, we investigated the role of P-glycoprotein in the generation of peptide-MHC complexes. We were unable to detect P-glycoprotein-mediated transport of synthetic peptides into the endoplasmic reticulum of either T2 cells (TAP-deficient) infected with a recombinant vaccinia virus (rVV) expressing P-glycoprotein or drug-resistant cells in which TAP is inactivated by a peptide from the herpes simplex virus ICP47 protein. Expression of rVV-encoded P-glycoprotein in T2 cells was unable to enhance cell surface expression of any of three MHC class I allomorphs tested. rVV-mediated expression of P-glycoprotein enabled T2 cells to produce limited amounts of class I-peptide complexes from cytosolic antigens, but this was not blocked by a drug that inhibits its transporter function, and a similar degree of presentation was mediated by functionally inactive mutated forms of P-glycoprotein. Thus, this was a nonspecific effect that we attributed to diminished membrane integrity resulting from P-glycoprotein overexpression. Taken together, our findings cast serious doubts that P-glycoprotein is a biologically significant transporter of cytosolic peptides.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Further rVVs were used to express P-glycoprotein |MDRI(T7)] and P-glycoprotein mutants (NM- D555N, CM-D1200N, and DM-D555N + D1200N), under the control of the T7 promoter (14). Login to comment
109 The introduced mutations alter one or both of highly conserved Asp residues located, respectively, within Walker B regions of either NH2-terminal (D555N) or COOH-terminal (D1200N) ATP binding/utilization sites that are believed to be involved in binding to Mg2+. Login to comment
64 Further rVVs were used to express P-glycoprotein |MDRI(T7)] and P-glycoprotein mutants (NM- D555N, CM-D1200N, and DM-D555N + D1200N), under the control of the T7 promoter (14). Login to comment
105 To determine the requirement for a functional P-glycoprotein, we used rVVs expressing three mutated forms of the protein under the control of the T7 promoter, termed CM, NM, and DM. The introduced mutations alter one or both of highly conserved Asp residues located, respectively, within Walker B regions of either NH2-terminal (D555N) or COOH-terminal (D1200N) ATP binding/utilization sites that are believed to be involved in binding to Mg2+. Login to comment

[hide] New light on multidrug binding by an ATP-binding-c... Trends Pharmacol Sci. 2006 Apr;27(4):195-203. Epub 2006 Mar 20. Shilling RA, Venter H, Velamakanni S, Bapna A, Woebking B, Shahi S, van Veen HW
New light on multidrug binding by an ATP-binding-cassette transporter.
Trends Pharmacol Sci. 2006 Apr;27(4):195-203. Epub 2006 Mar 20., [PMID:16545467]

Abstract [show]
ATP-binding-cassette (ABC) multidrug transporters confer multidrug resistance to pathogenic microorganisms and human tumour cells by mediating the extrusion of structurally unrelated chemotherapeutic drugs from the cell. The molecular basis by which ABC multidrug transporters bind and transport drugs is far from clear. Genetic analyses during the past 14 years reveal that the replacement of many individual amino acids in mammalian multidrug resistance P-glycoproteins can affect cellular resistance to drugs, but these studies have failed to identify specific regions in the primary amino acid sequence that are part of a defined drug-binding pocket. The recent publication of an X-ray crystallographic structure of the bacterial P-glycoprotein homologue MsbA and an MsbA-based homology model of human P-glycoprotein creates an opportunity to compare the original mutagenesis data with the three-dimensional structures of transporters. Our comparisons reveal that mutations that alter specificity are present in three-dimensional 'hotspot' regions in the membrane domains of P-glycoprotein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Although mutation of only one of these residues (L975A, V981A and F983A) has no effect on the phenotype of the protein [20], double mutations either completely inhibit (V981A/F983A and L975A/V981A) or cause 50% inhibition (L975A/F983A) of Table 1. Login to comment
59 Published mutations in human and murine P-glycoprotein that alter drug transport in cells Location of mutation Mutation Refs Mutation Refs Mutation Refs Transmembrane helices H61A and others [14] I214L [60] L868W [59] G64R [15] P223A [65] I936A [21] L65R [15] S224P [60] F938A [21] Q139[H/P/R] [60] I306R [18] S939[A/C/T/Y/W/D/F] [21,22] G141V [17] F335A [16] T941A [21] G185V [61,62] V338A [66] Q942A [21] I186N [61] G338A [67,68] A943G [21] G187V [17] A339P [67,68] Y946A [21] G187E [60] G341A [66] S948A [21] A192T [60] S344[A/T/C/Y] [66] Y949A [21] F200L [60] N350I [19] C952A [21] F204S [60] P709A [65] F953A [21] R206L [60] G830V [17] L975A [20] W208G [60] I837L [23] F978A [16] K209E [60] N839I [23] V981A [20] L210I [60] I862F [19] F983A [20] T211P [60] L865F [19] F978A [16] V213A [60] P866A [65] N988D [59] Intracellular domain T169I [60] K177I [60] G288V [17] R170L [60] E180G [60] A931T [19] L171P [60] G181R [60] F934A [21] T172P [60] G183D [60] G935A [21] S176P [60] D184N [60] NBD D555N [63] K1076M [69] E1197Q [64] D558N [64] D1093N [64] D1203N [64] D592N [64] E1125Q [64] D1237N [64] E604Q [64] S1173A [70] E1249Q [64] Review TRENDS in Pharmacological Sciences Vol.27 No. Login to comment