ABCMdb

PMID: 10820025

Booth CL, Pulaski L, Gottesman MM, Pastan I
Analysis of the properties of the N-terminal nucleotide-binding domain of human P-glycoprotein.
Biochemistry. 2000 May 9;39(18):5518-26., 2000-05-09 [PubMed]

Sentences

No. Mutations Sentence Comment

8 ABCB1 p.Asp555Asn Using a D555N mutated protein, we found that the conserved aspartate residue in the Walker B motif plays a role in magnesium-enhanced ATP-binding. Login to comment 45 ABCB1 p.Asp555Asn pTM1-MDR1 and pTM1-MDR1-D555N were supplied by Dr. Christine Hrycyna (25, 29). Login to comment 55 ABCB1 p.Cys431Ala The resulting expression vector was used as a template for site-directed mutagenesis to introduce a C431A mutation. Login to comment 58 ABCB1 p.Cys431Ala The coding sequence for the C431A mutant primer was 5'-GTTGGAAACAGTG- GCGCTGGGAAGAGCACA-3'. Login to comment 61 ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala The plasmid obtained contained a sequence encoding MDR1 amino acids 358-707 with a C431A mutation and was labeled pET- NBD1MDR1-C431A (358-707). Login to comment 62 ABCB1 p.Asp555Asn ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala A plasmid, containing a Table 1: Cloning Summary for Expression Vectors plasmid name cloning vector PCR primers (5' f 3')a restriction enzymesb pET-NBD1MDR1-C431A (358-707) pET3a A: GCAATACATATGGCAAGAGGAGCAGCTTATGAAATCTTC A: NdeI B: AAAGGATCCTCATTCAGTTAAATTTAGCTTCATAATCCT B: BamHI pET-NBD1MDR1-C431A/D555N (358-707) pET3a A: GCAATACATATGGCAAGAGGAGCAGCTTATGAAATCTTC A: NdeI B: AAAGGATCCTCATTCAGTTAAATTTAGCTTCATAATCCT B: BamHI pET-NBD1MDR1-C431A (412-574) pET23a A: GTTAAGATGCATATGGGCCTGAACCTGAAGGTGCAGAGT A: NdeI B: ACCTTTGAATTCTCAATCCAGAGCCACCTGAACCACTGC B: EcoRI pET-NBD1MDR1-C431A (358-590) pET3a A: GCAATACATATGGCAAGAGGAGCAGCTTATGAAATCTTC A: NdeI B: ATTGGATCCTCAAGACAAACGATGAGCTATCACAATGGT B: BamHI pET-NBD1MDR1-C431A (358-635) pET23a A: GAGATATACATATGGCAAGAGGAGCA A: NdeI B: TCTCCTCGAGCTAAACTTCATTTCCTGCTGTCTG B: XhoI pET-NBD1MDR1-C431A (409-635) pET23a A: GAGACATATGATCTTGAAGGGCCTGAACCTG A: NdeI B: TCTCCTCGAGCTAAACTTCATTTCCTGCTGTCTG B: XhoI pET-NBD1MDR1-C431A (375-707) pET23a A: GAGACATATGATTGACAGCTATTCGAAGAGT A: NdeI B: TCTCCTCGAGCTATTCAGTTAAATTTAGCTTCAT B: XhoI pET-NBD1MDR1-C431A (392-707) pET23a A: GAGACATATGTTGGAATTCAGAAATGTTCAC A: NdeI B: TCTCCTCGAGCTATTCAGTTAAATTTAGCTTCAT B: XhoI pET-NBD1MDR1-C431A (348-635) pET23a A: GAGACATATGGCATCTCCAAGCATTGAAGCATTTGCAAAT- GCAAGAGGAGCAGCT A: NdeI B: TCTCCTCGAGCTAAACTTCATTTCCTGCTGTCTG B: XhoI a A, forward primer; B, reverse primer. Login to comment 64 ABCB1 p.Asp555Asn ABCB1 p.Asp555Asn ABCB1 p.Asp555Asn ABCB1 p.Asp555Asn ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala sequence encoding MDR1 amino acids 358-707 with both C431A and D555N mutations, was prepared as described above, with the pTM1-MDR1-D555N vector bearing the MDR1 coding sequence with a D555N mutation as the primary template, and was labeled pET-NBD1MDR1-C431A/ D555N (358-707). Login to comment 65 ABCB1 p.Cys431Ala pET-NBD1MDR1-C431A was used as the template for construction of subsequent expression vectors as indicated in Table 1. Login to comment 92 ABCB1 p.Asp555Asn Sample consisted of NBD1 (358-707) or NBD1 D555N (358-707) proteins (~250 µg/mL) in 50 mM potassium phosphate/50 mM NaCl (pH 7.0). Login to comment 104 ABCB1 p.Cys431Ala ABCB1 p.Cys431Ala Recombinant proteins, encompassing amino acids 412-574, 358-590, and 358-707 of human P-glycoprotein each with a C431A mutation, encoded by pET-NBD1MDR1-C431A-based plasmids (Table 1) were expressed and purified from E. coli, purified from inclusion bodies under denaturing conditions, and renatured by rapid dilution. Login to comment 105 ABCB1 p.Cys431Ala The C431A mutant was used to prevent disulfide interactions. Login to comment 129 ABCB1 p.Asp555Asn (A) Expression of NBD1 proteins before (lanes 1, 3, 5, and 7) and after (lanes 2, 4, 6, and 8) IPTG induction. NBD1 proteins were as follows: NBD1 (358-707), lanes 1-2; NBD1 D555N (358-707), lanes 3 and 4; NBD1 (412-574), lanes 5 and 6; and NBD1 (358-590), lanes 7 and 8. Login to comment 130 ABCB1 p.Asp555Asn (B) Purified NBD1 proteins were identified by colloidal blue staining as follows: NBD1 (358-707), lane 1; NBD1 D555N (358-707), lane 2; NBD1 (412-574), lane 3; and NBD1 (358-590), lane 4. Login to comment 133 ABCB1 p.Asp555Asn NBD1 proteins were as follows: (A) NBD1 (358-707), (B) NBD1 (358-590), (C) NBD1 (412-574), and (D) NBD1 D555N (358-707). Login to comment 136 ABCB1 p.Asp555Asn D555N Amino Acid Substitution in the Walker B Consensus Sequence Results in an Alteration in Mg2+ -Enhanced ATP Binding. Login to comment 137 ABCB1 p.Asp555Asn ABCB1 p.Asp555Asn To evaluate the effect of Mg2+ on [R-32 P]-8-azido-ATP labeling, the NBD1 (358-707) protein was mutated at position 555 from aspartate to asparagine in the Walker B consensus motif (36). Login to comment 139 ABCB1 p.Asp555Asn Thus, the NBD1 D555N (358-707) protein serves as a specificity control in the present work. Login to comment 140 ABCB1 p.Asp555Asn Expression and purification of NBD1 D555N (358-707) protein is shown in Figure 1. Login to comment 141 ABCB1 p.Asp555Asn As demonstrated, NBD1 D555N (358-707) protein was localized in the inclusion-body protein and was purified by the methods described previously. Login to comment 142 ABCB1 p.Asp555Asn Unlike the wild-type NBD1 (358-707) protein, [R-32 P]-8-azido-ATP labeling of the mutant NBD1 D555N (358-707) protein was greater in the absence of MgSO4 than in the presence of MgSO4 (Figure 2D). Login to comment 143 ABCB1 p.Asp555Asn In fact, in the presence of MgSO4 the ability of [R-32 P]-8-azido-ATP to label NBD1 D555N (358-707) protein was impaired severely (Figure 2D). Login to comment 144 ABCB1 p.Asp555Asn Incubation of [R-32P]-8-azido-ATP with NBD1 (358-707) protein or NBD1 D555N (358-707) protein in the presence of increasing concentrations of MgSO4 resulted in an increase in labeling with wild-type protein and a decrease in labeling with mutant protein (data not shown). Login to comment 145 ABCB1 p.Asp555Asn The specificity of labeling of NBD1 D555N (358-707) protein was explored by incubating the protein with [R-32 P]-8-azido-ATP in the presence of increasing concentrations of ATP in the absence of MgSO4. Login to comment 148 ABCB1 p.Asp555Asn Analysis of NBD1 (358-707) and NBD1 D555N (358-707) proteins by CD was performed in order to assess the secondary structural components and to evaluate the effect of Mg2+. Login to comment 149 ABCB1 p.Asp555Asn The predicted secondary structural components of these proteins were 25% R-helix, 23% -strand, and 19% -turn; no differences between NBD1 (358-707) and NBD1 D555N (358-707) proteins were demonstrated (data not shown). Login to comment 150 ABCB1 p.Asp555Asn Similarly, the predicted secondary structural elements of NBD1 (358-707) and NBD1 D555N (358-707) proteins in the presence of 2 mM MgSO4 were not different than in the absence of MgSO4 (data not shown). Login to comment 151 ABCB1 p.Asp555Asn A temperature melt was performed to determine the thermal stability of NBD1 (358-707) and NBD1 D555N (358-707) proteins. Login to comment 206 ABCB1 p.Cys431Ala In the present work, human P-glycoprotein cDNAs with a C431A mutation were utilized to express a series of recombinant proteins containing NBD1 in E. coli. Login to comment 220 ABCB1 p.Asp555Asn Secondary structural analysis of NBD1 (358-707) and NBD1 D555N (358-707) proteins by circular dichroism showed 25% R-helix, 23% -strand, and 19% -turn with no significant difference in secondary structure between the two proteins. Login to comment 224 ABCB1 p.Asp555Asn More interesting was the lack of secondary structural change of NBD1 (358-707) and NBD1 D555N (358-707) proteins in the presence of Mg2+ . Login to comment 249 ABCB1 p.Asp555Asn ABCB1 p.Cys431Ala The C431A and D555N mutations within the Walker A and Walker B motifs, respectively, are identified by vertical bars. Login to comment