ABCC7 p.Asp924Val
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 15798900
[PubMed]
Sadlish H et al: "Biogenesis of CFTR and other polytopic membrane proteins: new roles for the ribosome-translocon complex."
No.
Sentence
Comment
166
Interestingly, removal of a single charged residue from TM8 (D924V) prevented Asn908 from being glycosylated and at the same time conferred TM7-independent stop transfer activity onto the TM8 hydrophobic segment (Carveth et al., 2002).
X
ABCC7 p.Asp924Val 15798900:166:61
status: NEW183 Similarly, the D924V mutation converts TM8 to a strong, independent stop transfer sequence but dramatically decreases CFTR chloride conductance (D. Dawson and W. Skach, unpublished observations).
X
ABCC7 p.Asp924Val 15798900:183:15
status: NEW
PMID: 19019984
[PubMed]
Pitonzo D et al: "Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon."
No.
Sentence
Comment
43
MATERIALS AND METHODS Plasmid Construction CFTR expression plasmids encoding wild-type and D924V mutant have been described previously (Carveth et al., 2002) and encode a methionine ATG translation start codon followed by CFTR residues Glu838 to Tryp1204.
X
ABCC7 p.Asp924Val 19019984:43:91
status: NEW46 Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A).
X
ABCC7 p.Asp924Val 19019984:46:41
status: NEW219 In both wild-type (WT) and D924V mutants, TM8 photocross-links were observed during initial stages of translocon insertion at truncations 957 and 967 (Figure 8).
X
ABCC7 p.Asp924Val 19019984:219:27
status: NEW220 However, photoadducts to D924V decreased abruptly at truncation sites beyond residue 967 (Figure 8B), and no peptidyl-tRNA-independent photocross-links to residue 913 were observed (Figure 8A).
X
ABCC7 p.Asp924Val 19019984:220:25
status: NEW221 Thus, the D924V mutant leaves the proximity of Sec61 at an earlier stage of synthesis than its wild-type counterpart and fails to exhibit peptidyl-tRNA-independent TM8-Sec61␣ interactions.
X
ABCC7 p.Asp924Val 19019984:221:10
status: NEW226 We therefore moved the aspartate group 1 residue toward the N terminus to position 923 (A923D and D924V), which would be located at approxi- Figure 8.
X
ABCC7 p.Asp924Val 19019984:226:98
status: NEW228 (A) Photocross-linking to integration intermediates (residues 837-977) containing WT and mutant (D924V) TM8 revealed similar UV-dependent photoadducts (upward arrowheads) for truncations 957 and 967 that disappeared after puromycin treatment.
X
ABCC7 p.Asp924Val 19019984:228:97
status: NEW230 At truncations 977 and 987, photoadducts to WT TM8 increased in intensity and were peptidyl-tRNA independent (lanes 14 and 15 and 20 and 21), whereas photoadducts were absent for the D924V mutant (lanes 17, 18, 23, and 24).
X
ABCC7 p.Asp924Val 19019984:230:183
status: NEW231 (B) Immunoprecipitation of photoadducts with Sec 61␣ antisera confirmed that the D924V mutation decreases Sec61␣ cross-linking at the same stage of synthesis when photocross-linking to WT TM8 becomes independent of the peptidyl-tRNA bond.
X
ABCC7 p.Asp924Val 19019984:231:88
status: NEW255 A923D, D924V mutations decreased Sec61␣ photocross-linking (to residue 913) after puromycin treatment (compare lane 4 with lane 10) but significantly increased the peptidyl-tRNA-independent photocross-linking to residue 912 (lanes 2 and 8).
X
ABCC7 p.Asp924Val 19019984:255:7
status: NEW283 Moreover, translocation termination is accomplished by both WT TM8 and the D924V mutant (Carveth et al., 2002), but integration is delayed only when an acidic residue is present.
X
ABCC7 p.Asp924Val 19019984:283:75
status: NEW
No.
Sentence
Comment
100
Interestingly, removal of an aspartate residue from TM8 (D924V) prevents transient lumenal exposure and at the same time confers independent stop transfer activity.
X
ABCC7 p.Asp924Val 23248597:100:57
status: NEW111 Similarly, the D924V mutation converts TM8 to a strong strop transfer sequence and facilitates cotranslational membrane integration, but decreases CFTR chloride conductance (our observations).
X
ABCC7 p.Asp924Val 23248597:111:15
status: NEW