ABCMdb

ABCC7 p.Ser422Ala

Predicted by SNAP2:	A: N (87%), C: N (87%), D: N (72%), E: N (82%), F: N (66%), G: N (82%), H: N (82%), I: N (72%), K: N (87%), L: N (78%), M: N (78%), N: N (87%), P: N (87%), Q: N (93%), R: N (82%), T: N (93%), V: N (78%), W: N (61%), Y: N (72%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, T: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Functional roles of nonconserved structural segmen... J Gen Physiol. 2005 Jan;125(1):43-55. Epub 2004 Dec 13. Csanady L, Chan KW, Nairn AC, Gadsby DC
Functional roles of nonconserved structural segments in CFTR's NH2-terminal nucleotide binding domain.
J Gen Physiol. 2005 Jan;125(1):43-55. Epub 2004 Dec 13., [PMID:15596536]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR), encoded by the gene mutated in cystic fibrosis patients, belongs to the family of ATP-binding cassette (ABC) proteins, but, unlike other members, functions as a chloride channel. CFTR is activated by protein kinase A (PKA)-mediated phosphorylation of multiple sites in its regulatory domain, and gated by binding and hydrolysis of ATP at its two nucleotide binding domains (NBD1, NBD2). The recent crystal structure of NBD1 from mouse CFTR (Lewis, H.A., S.G. Buchanan, S.K. Burley, K. Conners, M. Dickey, M. Dorwart, R. Fowler, X. Gao, W.B. Guggino, W.A. Hendrickson, et al. 2004. EMBO J. 23:282-293) identified two regions absent from structures of all other NBDs determined so far, a "regulatory insertion" (residues 404-435) and a "regulatory extension" (residues 639-670), both positioned to impede formation of the putative NBD1-NBD2 dimer anticipated to occur during channel gating; as both segments appeared highly mobile and both contained consensus PKA sites (serine 422, and serines 660 and 670, respectively), it was suggested that their phosphorylation-linked conformational changes might underlie CFTR channel regulation. To test that suggestion, we coexpressed in Xenopus oocytes CFTR residues 1-414 with residues 433-1480, or residues 1-633 with 668-1480, to yield split CFTR channels (called 414+433 and 633+668) that lack most of the insertion, or extension, respectively. In excised patches, regulation of the resulting CFTR channels by PKA and by ATP was largely normal. Both 414+433 channels and 633+668 channels, as well as 633(S422A)+668 channels (lacking both the extension and the sole PKA consensus site in the insertion), were all shut during exposure to MgATP before addition of PKA, but activated like wild type (WT) upon phosphorylation; this indicates that inhibitory regulation of nonphosphorylated WT channels depends upon neither segment. Detailed kinetic analysis of 414+433 channels revealed intact ATP dependence of single-channel gating kinetics, but slightly shortened open bursts and faster closing from the locked-open state (elicited by ATP plus pyrophosphate or ATP plus AMPPNP). In contrast, 633+668 channel function was indistinguishable from WT at both macroscopic and microscopic levels. We conclude that neither nonconserved segment is an essential element of PKA- or nucleotide-dependent regulation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Both 414ϩ433 channels and 633ϩ668 channels, as well as 633(S422A)ϩ668 channels (lacking both the extension and the sole PKA consensus site in the insertion), were all shut during exposure to MgATP before addition of PKA, but activated like wild type (WT) upon phosphorylation; this indicates that inhibitory regulation of nonphosphorylated WT channels depends upon neither segment. Login to comment
46 pGEMHE- Flag3-633(S422A) was constructed by introducing the S422A point mutation into pGEMHE-Flag3-633, using Stratagene`s QuickChange Mutagenesis Kit, and primers S422A-FW (5Ј-TAACAATAGAAAAA- CTGCTAATGGTGATGACAGCCTCT) and S422A-RW (5Ј-AGAG- GCTGTCATCACCATTAGCAGTTTTTCTATTGTTA). Login to comment
92 Coexpression of segment Flag-3-633(S422A) (tagged at its NH2 terminus with a Flag epitope) with segment 668-1480 gave rise to severed CFTR channels (called F633 (S422A)ϩ668) whose activity was as strictly phosphorylation dependent (Fig. 2 D) as WT. Login to comment
93 Relative to the current elicited by addition of PKA (Fig. 2 E, PKA, striped bars), that during prior exposure to ATP alone (pre, black bars) was negligibly small, 0.014 Ϯ 0.005 (n ϭ 21) for 633ϩ668, 0.007 Ϯ 0.002 (n ϭ 21) for 414ϩ433, and 0.014 Ϯ 0.003 (n ϭ 12) for F633 (S422A)ϩ668, the same as found for WT (0.012 Ϯ 0.005, n ϭ 13). Login to comment
98 Residual current in ATP alone, a few seconds (‫53-51ف‬ s) after PKA removal (Fig. 2 E, post, gray bars), was 0.46 Ϯ 0.03 (n ϭ 7) for 633ϩ668, 0.56 Ϯ 0.03 (n ϭ 11) for 414ϩ433, and 0.55 Ϯ 0.02 (n ϭ 13) for F633(S422A)ϩ668, of that in the presence of PKA, just as it was for WT (0.50 Ϯ 0.02, n ϭ 9). Login to comment
101 Activation of 414ϩ433 channels (t1/2 ϭ 33 Ϯ 3 s, n ϭ 18) was slightly but significantly (P ϭ 0.007) slower than for WT (t1/2 ϭ 22 Ϯ 2 s, n ϭ 24), which was comparable to the others; t1/2 was 16 Ϯ 1 s (n ϭ 25) for 633ϩ668, and 21 Ϯ 3 s (n ϭ 7) for F633(S422A)ϩ668. Login to comment
105 Macropatches containing tens or hundreds of (A) WT, (B) 633ϩ668, (C) 414ϩ433, or (D) F633(S422A)ϩ668 (with NH2-terminal Flag tag), channels were superfused with 2 mM MgATP and, after ‫1ف‬ min, transiently with 300 nM PKA catalytic subunit (bars); the 20-s time bar applies to all four panels A-D, which show recordings obtained at -80 mV. Login to comment
111 Fractional currents at the test [ATP], normalized to the average of the bracketing currents and plotted against test [ATP], were well fit by the Michaelis-Menten equation (Fig. 3 E), yielding Km values of 40-50 ␮M for 633ϩ668, 414ϩ433, and F633(S422A)ϩ668, the same as that found for WT channels. Login to comment
119 ATP dependence of macroscopic current is intact for severed CFTR constructs. Currents from macropatches containing (A) WT, (B) 633ϩ668, (C) 414ϩ433, and (D) Flag-tagged 633(S422A)ϩ668 channels superfused with test concentrations of MgATP ranging from 5 ␮M to 1 mM, bracketed by exposures to 2 mM MgATP (bars; numbers indicate test [ATP] in ␮M). Login to comment
179 We could, however, simultaneously delete the extension and render the insertion unresponsive to phosphorylation by mutating its only phosphorylatable residue, serine 422, to alanine. Login to comment
180 The resulting construct, F633(S422A)ϩ668, yielded channels that, like WT, remained closed until they were phosphorylated, and then activated normally upon phosphorylation (Fig. 2, D and E). Login to comment

[hide] Control of CFTR channel gating by phosphorylation ... Physiol Rev. 1999 Jan;79(1 Suppl):S77-S107. Gadsby DC, Nairn AC
Control of CFTR channel gating by phosphorylation and nucleotide hydrolysis.
Physiol Rev. 1999 Jan;79(1 Suppl):S77-S107., [PMID:9922377]

Abstract [show]
Control of CTFR Channel Gating by Phosphorylation and Nucleotide Hydrolysis. Physiol. Rev. 79, Suppl.: S77-S107, 1999. - The cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel is the protein product of the gene defective in cystic fibrosis, the most common lethal genetic disease among Caucasians. Unlike any other known ion channel, CFTR belongs to the ATP-binding cassette superfamily of transporters and, like all other family members, CFTR includes two cytoplasmic nucleotide-binding domains (NBDs), both of which bind and hydrolyze ATP. It appears that in a single open-close gating cycle, an individual CFTR channel hydrolyzes one ATP molecule at the NH2-terminal NBD to open the channel, and then binds and hydrolyzes a second ATP molecule at the COOH-terminal NBD to close the channel. This complex coordinated behavior of the two NBDs is orchestrated by multiple protein kinase A-dependent phosphorylation events, at least some of which occur within the third large cytoplasmic domain, called the regulatory domain. Two or more kinds of protein phosphatases selectively dephosphorylate distinct sites. Under appropriately controlled conditions of progressive phosphorylation or dephosphorylation, three functionally different phosphoforms of a single CFTR channel can be distinguished on the basis of channel opening and closing kinetics. Recording single CFTR channel currents affords an unprecedented opportunity to reproducibly examine, and manipulate, individual ATP hydrolysis cycles in a single molecule, in its natural environment, in real time.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
149 On the other hand, the clear-cut decrement in channel function seen to be of major (e.g., Ser-660, -700, -737, -795, and -813) or minor (e.g., Ser-422 and -753) importance, coupled withupon adding the S422A mutation to the 9SA mutant (31) implies that Ser-422 does get phosphorylated in whole the apparent progressive decline of channel activity as the number of Ser-Ala mutations was increased, led toCFTR (at least, in 9SA mutant CFTR). Login to comment

[hide] Protein kinase A (PKA) still activates CFTR chlori... J Biol Chem. 1993 May 25;268(15):11304-11. Chang XB, Tabcharani JA, Hou YX, Jensen TJ, Kartner N, Alon N, Hanrahan JW, Riordan JR
Protein kinase A (PKA) still activates CFTR chloride channel after mutagenesis of all 10 PKA consensus phosphorylation sites.
J Biol Chem. 1993 May 25;268(15):11304-11., [PMID:7684377]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) plays a central role in transepithelial ion transport by acting as a tightly regulated apical chloride channel. Regulation is achieved by the concerted action of ATP at conserved nucleotide binding folds and serine phosphorylation at multiple sites by protein kinases A (PKA) and C (PKC). A previous investigation concluded that activation by PKA is critically dependent on phosphorylation at four of the nine predicted PKA sites in the R domain (S660A, S737A, S795A, S813A), because a "Quad" mutant lacking these sites could not be activated. We show in the present work that not only can this mutant be phosphorylated and activated, but a mutant in which all 10 predicted PKA sites have been altered still retains significant PKA-activated function. Potentiation of the PKA response by PKC is also preserved in this mutant. Thus CFTR may be regulated by cryptic PKA sites which also mediate interactions between different kinases. Such hierarchical phosphorylation of CFTR by obvious and cryptic PKA sites could provide a metered response to secretagogues.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 The following mutations were introduced into CFTR, S422A (TCT to GCT), S660A (TCA to GCA), S686A (TCT to GCT), S700A (TCT toGCT), S712A (TCC to GCC), S737A (TCC to GCC), S768A (TCT toGCT), T788A (ACAto GCA),S795A (TCA to GCA), S813A (TCA to GCA), S660E (TCA to GAA),S737E (TCC to GAG), S795E (TCA to GAA), and S813E (TCA to GAA). Login to comment
47 S422A was introduced into the XbaIIBamHIfragment (Fig. lA)and inserted A into pUCF2.5/9SA. Login to comment

[hide] CFTR mutations altering CFTR fragmentation. Biochem J. 2013 Jan 1;449(1):295-305. doi: 10.1042/BJ20121240. Tosoni K, Stobbart M, Cassidy DM, Venerando A, Pagano MA, Luz S, Amaral MD, Kunzelmann K, Pinna LA, Farinha CM, Mehta A
CFTR mutations altering CFTR fragmentation.
Biochem J. 2013 Jan 1;449(1):295-305. doi: 10.1042/BJ20121240., [PMID:23067305]

Abstract [show]
Most CF (cystic fibrosis) results from deletion of a phenylalanine (F508) in the CFTR {CF transmembrane-conductance regulator; ABCC7 [ABC (ATP-binding cassette) sub-family C member 7]} which causes ER (endoplasmic reticulum) degradation of the mutant. Using stably CFTR-expressing BHK (baby-hamster kidney) cell lines we demonstrated that wild-type CTFR and the F508delCFTR mutant are cleaved into differently sized N- and C-terminal-bearing fragments, with each hemi-CFTR carrying its nearest NBD (nucleotide-binding domain), reflecting differential cleavage through the central CFTR R-domain. Similar NBD1-bearing fragments are present in the natively expressing HBE (human bronchial epithelial) cell line. We also observe multiple smaller fragments of different sizes in BHK cells, particularly after F508del mutation (ladder pattern). Trapping wild-type CFTR in the ER did not generate a F508del fragmentation fingerprint. Fragments change their size/pattern again post-mutation at sites involved in CFTR's in vitro interaction with the pleiotropic protein kinase CK2 (S511A in NBD1). The F508del and S511A mutations generate different fragmentation fingerprints that are each unlike the wild-type; yet, both mutants generate new N-terminal-bearing CFTR fragments that are not observed with other CK2-related mutations (S511D, S422A/D and T1471A/D). We conclude that the F508delCFTR mutant is not degraded completely and there exists a relationship between CFTR's fragmentation fingerprint and the CFTR sequence through putative CK2-interactive sites that lie near F508.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The F508del and S511A mutations generate different fragmentation fingerprints that are each unlike the wild-type; yet, both mutants generate new N-terminal-bearing CFTR fragments that are not observed with other CK2-related mutations (S511D, S422A/D and T1471A/D). Login to comment
44 Cell culture, lysis, protein solubilization and Western blotting The cell culture methods to create the stable CFTR-expressing cell lines (WT, F, WT S422A, WT S422D, WT S511A, WT S511D, WT T1471A and WT T1471D) and their culture protocols have been described recently [25]. Login to comment
191 Compared with each other S422D- and S422A-CFTR revealed no gross differences in fragmentation (Figures 7A-7D, compare lanes 3 and 4). Login to comment

[hide] Role of tyrosine phosphorylation in the muscarinic... J Biol Chem. 2013 Jul 26;288(30):21815-23. doi: 10.1074/jbc.M113.479360. Epub 2013 Jun 11. Billet A, Luo Y, Balghi H, Hanrahan JW
Role of tyrosine phosphorylation in the muscarinic activation of the cystic fibrosis transmembrane conductance regulator (CFTR).
J Biol Chem. 2013 Jul 26;288(30):21815-23. doi: 10.1074/jbc.M113.479360. Epub 2013 Jun 11., [PMID:23760269]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride (Cl(-)) channel, which plays an important role in physiological anion and fluid secretion, and is defective in several diseases. Although its activation by PKA and PKC has been studied extensively, its regulation by receptors is less well understood. To study signaling involved in CFTR activation, we measured whole-cell Cl(-) currents in BHK cells cotransfected with GPCRs and CFTR. In cells expressing the M3 muscarinic acetylcholine receptor, the agonist carbachol (Cch) caused strong activation of CFTR through two pathways; the canonical PKA-dependent mechanism and a second mechanism that involves tyrosine phosphorylation. The role of PKA was suggested by partial inhibition of cholinergic stimulation by the specific PKA inhibitor Rp-cAMPS. The role of tyrosine kinases was suggested by Cch stimulation of 15SA-CFTR and 9CA-CFTR, mutants that lack 15 PKA or 9 PKC consensus sequences and are unresponsive to PKA or PKC stimulation, respectively. Moreover the residual Cch response was sensitive to inhibitors of the Pyk2 and Src tyrosine kinase family. Our results suggest that tyrosine phosphorylation acts on CFTR directly and through inhibition of the phosphatase PP2A. Results suggest that PKA and tyrosine kinases contribute to CFTR regulation by GPCRs that are expressed at the apical membrane of intestinal and airway epithelia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Carbachol Stimulates CFTR through PKA and Non-PKA Signaling Pathways-To explore PKA-independent regulation of CFTR without using inhibitors that might have confounding effects on other pathways, we studied the activation of 15SA-CFTR (S422A/S660A/S670A/S686A/T690A/S700A/S712A/ S737A/S753A/S768A/T787A/T788A/S790A/S795A/S813A). Login to comment