ABCMdb

ABCC7 p.Ser422Ala

None has been submitted yet.

Publications

PMID: 15596536 [PubMed] Csanady L et al: "Functional roles of nonconserved structural segments in CFTR's NH2-terminal nucleotide binding domain."

No. Sentence Comment

7 Both 414ϩ433 channels and 633ϩ668 channels, as well as 633(S422A)ϩ668 channels (lacking both the extension and the sole PKA consensus site in the insertion), were all shut during exposure to MgATP before addition of PKA, but activated like wild type (WT) upon phosphorylation; this indicates that inhibitory regulation of nonphosphorylated WT channels depends upon neither segment. Login to comment
46 pGEMHE- Flag3-633(S422A) was constructed by introducing the S422A point mutation into pGEMHE-Flag3-633, using Stratagene`s QuickChange Mutagenesis Kit, and primers S422A-FW (5Ј-TAACAATAGAAAAA- CTGCTAATGGTGATGACAGCCTCT) and S422A-RW (5Ј-AGAG- GCTGTCATCACCATTAGCAGTTTTTCTATTGTTA). Login to comment
92 Coexpression of segment Flag-3-633(S422A) (tagged at its NH2 terminus with a Flag epitope) with segment 668-1480 gave rise to severed CFTR channels (called F633 (S422A)ϩ668) whose activity was as strictly phosphorylation dependent (Fig. 2 D) as WT. Login to comment
93 Relative to the current elicited by addition of PKA (Fig. 2 E, PKA, striped bars), that during prior exposure to ATP alone (pre, black bars) was negligibly small, 0.014 Ϯ 0.005 (n ϭ 21) for 633ϩ668, 0.007 Ϯ 0.002 (n ϭ 21) for 414ϩ433, and 0.014 Ϯ 0.003 (n ϭ 12) for F633 (S422A)ϩ668, the same as found for WT (0.012 Ϯ 0.005, n ϭ 13). Login to comment
98 Residual current in ATP alone, a few seconds (‫53-51ف‬ s) after PKA removal (Fig. 2 E, post, gray bars), was 0.46 Ϯ 0.03 (n ϭ 7) for 633ϩ668, 0.56 Ϯ 0.03 (n ϭ 11) for 414ϩ433, and 0.55 Ϯ 0.02 (n ϭ 13) for F633(S422A)ϩ668, of that in the presence of PKA, just as it was for WT (0.50 Ϯ 0.02, n ϭ 9). Login to comment
101 Activation of 414ϩ433 channels (t1/2 ϭ 33 Ϯ 3 s, n ϭ 18) was slightly but significantly (P ϭ 0.007) slower than for WT (t1/2 ϭ 22 Ϯ 2 s, n ϭ 24), which was comparable to the others; t1/2 was 16 Ϯ 1 s (n ϭ 25) for 633ϩ668, and 21 Ϯ 3 s (n ϭ 7) for F633(S422A)ϩ668. Login to comment
105 Macropatches containing tens or hundreds of (A) WT, (B) 633ϩ668, (C) 414ϩ433, or (D) F633(S422A)ϩ668 (with NH2-terminal Flag tag), channels were superfused with 2 mM MgATP and, after ‫1ف‬ min, transiently with 300 nM PKA catalytic subunit (bars); the 20-s time bar applies to all four panels A-D, which show recordings obtained at -80 mV. Login to comment
111 Fractional currents at the test [ATP], normalized to the average of the bracketing currents and plotted against test [ATP], were well fit by the Michaelis-Menten equation (Fig. 3 E), yielding Km values of 40-50 ␮M for 633ϩ668, 414ϩ433, and F633(S422A)ϩ668, the same as that found for WT channels. Login to comment
119 ATP dependence of macroscopic current is intact for severed CFTR constructs. Currents from macropatches containing (A) WT, (B) 633ϩ668, (C) 414ϩ433, and (D) Flag-tagged 633(S422A)ϩ668 channels superfused with test concentrations of MgATP ranging from 5 ␮M to 1 mM, bracketed by exposures to 2 mM MgATP (bars; numbers indicate test [ATP] in ␮M). Login to comment
179 We could, however, simultaneously delete the extension and render the insertion unresponsive to phosphorylation by mutating its only phosphorylatable residue, serine 422, to alanine. Login to comment
180 The resulting construct, F633(S422A)ϩ668, yielded channels that, like WT, remained closed until they were phosphorylated, and then activated normally upon phosphorylation (Fig. 2, D and E). Login to comment

PMID: 9922377 [PubMed] Gadsby DC et al: "Control of CFTR channel gating by phosphorylation and nucleotide hydrolysis."

No. Sentence Comment

149 On the other hand, the clear-cut decrement in channel function seen to be of major (e.g., Ser-660, -700, -737, -795, and -813) or minor (e.g., Ser-422 and -753) importance, coupled withupon adding the S422A mutation to the 9SA mutant (31) implies that Ser-422 does get phosphorylated in whole the apparent progressive decline of channel activity as the number of Ser-Ala mutations was increased, led toCFTR (at least, in 9SA mutant CFTR). Login to comment

PMID: 7684377 [PubMed] Chang XB et al: "Protein kinase A (PKA) still activates CFTR chloride channel after mutagenesis of all 10 PKA consensus phosphorylation sites."

No. Sentence Comment

37 The following mutations were introduced into CFTR, S422A (TCT to GCT), S660A (TCA to GCA), S686A (TCT to GCT), S700A (TCT toGCT), S712A (TCC to GCC), S737A (TCC to GCC), S768A (TCT toGCT), T788A (ACAto GCA),S795A (TCA to GCA), S813A (TCA to GCA), S660E (TCA to GAA),S737E (TCC to GAG), S795E (TCA to GAA), and S813E (TCA to GAA). Login to comment
47 S422A was introduced into the XbaIIBamHIfragment (Fig. lA)and inserted A into pUCF2.5/9SA. Login to comment

PMID: 23067305 [PubMed] Tosoni K et al: "CFTR mutations altering CFTR fragmentation."

No. Sentence Comment

6 The F508del and S511A mutations generate different fragmentation fingerprints that are each unlike the wild-type; yet, both mutants generate new N-terminal-bearing CFTR fragments that are not observed with other CK2-related mutations (S511D, S422A/D and T1471A/D). Login to comment
44 Cell culture, lysis, protein solubilization and Western blotting The cell culture methods to create the stable CFTR-expressing cell lines (WT, F, WT S422A, WT S422D, WT S511A, WT S511D, WT T1471A and WT T1471D) and their culture protocols have been described recently [25]. Login to comment
191 Compared with each other S422D- and S422A-CFTR revealed no gross differences in fragmentation (Figures 7A-7D, compare lanes 3 and 4). Login to comment

PMID: 23760269 [PubMed] Billet A et al: "Role of tyrosine phosphorylation in the muscarinic activation of the cystic fibrosis transmembrane conductance regulator (CFTR)."

No. Sentence Comment

102 Carbachol Stimulates CFTR through PKA and Non-PKA Signaling Pathways-To explore PKA-independent regulation of CFTR without using inhibitors that might have confounding effects on other pathways, we studied the activation of 15SA-CFTR (S422A/S660A/S670A/S686A/T690A/S700A/S712A/ S737A/S753A/S768A/T787A/T788A/S790A/S795A/S813A). Login to comment