ABCMdb

PMID: 15596536

Csanady L, Chan KW, Nairn AC, Gadsby DC
Functional roles of nonconserved structural segments in CFTR's NH2-terminal nucleotide binding domain.
J Gen Physiol. 2005 Jan;125(1):43-55. Epub 2004 Dec 13., [PubMed]

Sentences

No. Mutations Sentence Comment

7 ABCC7 p.Ser422Ala Both 414ϩ433 channels and 633ϩ668 channels, as well as 633(S422A)ϩ668 channels (lacking both the extension and the sole PKA consensus site in the insertion), were all shut during exposure to MgATP before addition of PKA, but activated like wild type (WT) upon phosphorylation; this indicates that inhibitory regulation of nonphosphorylated WT channels depends upon neither segment. Login to comment 46 ABCC7 p.Ser422Ala ABCC7 p.Ser422Ala ABCC7 p.Ser422Ala ABCC7 p.Ser422Ala pGEMHE- Flag3-633(S422A) was constructed by introducing the S422A point mutation into pGEMHE-Flag3-633, using Stratagene`s QuickChange Mutagenesis Kit, and primers S422A-FW (5Ј-TAACAATAGAAAAA- CTGCTAATGGTGATGACAGCCTCT) and S422A-RW (5Ј-AGAG- GCTGTCATCACCATTAGCAGTTTTTCTATTGTTA). Login to comment 92 ABCC7 p.Ser422Ala ABCC7 p.Ser422Ala Coexpression of segment Flag-3-633(S422A) (tagged at its NH2 terminus with a Flag epitope) with segment 668-1480 gave rise to severed CFTR channels (called F633 (S422A)ϩ668) whose activity was as strictly phosphorylation dependent (Fig. 2 D) as WT. Login to comment 93 ABCC7 p.Ser422Ala Relative to the current elicited by addition of PKA (Fig. 2 E, PKA, striped bars), that during prior exposure to ATP alone (pre, black bars) was negligibly small, 0.014 Ϯ 0.005 (n ϭ 21) for 633ϩ668, 0.007 Ϯ 0.002 (n ϭ 21) for 414ϩ433, and 0.014 Ϯ 0.003 (n ϭ 12) for F633 (S422A)ϩ668, the same as found for WT (0.012 Ϯ 0.005, n ϭ 13). Login to comment 98 ABCC7 p.Ser422Ala Residual current in ATP alone, a few seconds (‫53-51ف‬ s) after PKA removal (Fig. 2 E, post, gray bars), was 0.46 Ϯ 0.03 (n ϭ 7) for 633ϩ668, 0.56 Ϯ 0.03 (n ϭ 11) for 414ϩ433, and 0.55 Ϯ 0.02 (n ϭ 13) for F633(S422A)ϩ668, of that in the presence of PKA, just as it was for WT (0.50 Ϯ 0.02, n ϭ 9). Login to comment 101 ABCC7 p.Ser422Ala Activation of 414ϩ433 channels (t1/2 ϭ 33 Ϯ 3 s, n ϭ 18) was slightly but significantly (P ϭ 0.007) slower than for WT (t1/2 ϭ 22 Ϯ 2 s, n ϭ 24), which was comparable to the others; t1/2 was 16 Ϯ 1 s (n ϭ 25) for 633ϩ668, and 21 Ϯ 3 s (n ϭ 7) for F633(S422A)ϩ668. Login to comment 105 ABCC7 p.Ser422Ala Macropatches containing tens or hundreds of (A) WT, (B) 633ϩ668, (C) 414ϩ433, or (D) F633(S422A)ϩ668 (with NH2-terminal Flag tag), channels were superfused with 2 mM MgATP and, after ‫1ف‬ min, transiently with 300 nM PKA catalytic subunit (bars); the 20-s time bar applies to all four panels A-D, which show recordings obtained at -80 mV. Login to comment 111 ABCC7 p.Ser422Ala Fractional currents at the test [ATP], normalized to the average of the bracketing currents and plotted against test [ATP], were well fit by the Michaelis-Menten equation (Fig. 3 E), yielding Km values of 40-50 ␮M for 633ϩ668, 414ϩ433, and F633(S422A)ϩ668, the same as that found for WT channels. Login to comment 119 ABCC7 p.Ser422Ala ATP dependence of macroscopic current is intact for severed CFTR constructs. Currents from macropatches containing (A) WT, (B) 633ϩ668, (C) 414ϩ433, and (D) Flag-tagged 633(S422A)ϩ668 channels superfused with test concentrations of MgATP ranging from 5 ␮M to 1 mM, bracketed by exposures to 2 mM MgATP (bars; numbers indicate test [ATP] in ␮M). Login to comment 179 ABCC7 p.Ser422Ala We could, however, simultaneously delete the extension and render the insertion unresponsive to phosphorylation by mutating its only phosphorylatable residue, serine 422, to alanine. Login to comment 180 ABCC7 p.Ser422Ala The resulting construct, F633(S422A)ϩ668, yielded channels that, like WT, remained closed until they were phosphorylated, and then activated normally upon phosphorylation (Fig. 2, D and E). Login to comment 204 ABCC7 p.Ser660Ala Indeed, the single point mutation S660A was found to have a negligible effect on the gating of phosphorylated CFTR channels in excised patches exposed to saturating [ATP] (Winter and Welsh, 1997). Login to comment 206 ABCC7 p.Ser660Ala ABCC7 p.Ser670Ala These results on gating of strongly phosphorylated CFTR channels in excised patches do not contradict the finding (Wilkinson et al., 1997) of a Յ2-fold reduction in sensitivity to activation by IBMX (hence presumably by PKA) of S660A or S670A CFTR channels in intact oocytes. Login to comment