ABCMdb

ABCC7 p.His139Arg

None has been submitted yet.

Publications

PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."

No. Sentence Comment

369 H139R, G149R, D192G and R258G in the two first CLs inhibited maturation and transport of CFTR to the cell surface. Login to comment

PMID: 15084222 [PubMed] D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."

No. Sentence Comment

89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

PMID: 15176679 [PubMed] Decaestecker K et al: "Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients."

No. Sentence Comment

92 - Cystic fibrosis transmembrane conductance regulator genotypes of patients in the three study groups G85E PI PS Genotype Subjects n Genotype Subjects n Genotype Subjects n G85E/F508del# 34 F508del# /F508del# 58 F508del# /unknown 15 G85E/unknown 8 F508del# /unknown 2 F508del# /3849z10 kbCRT} 5 G85E/G542X# 5 F508del# /1717-1GR A 1 F508del# /R117H} 3 G85E/W1282X# 4 F508del# /N1303K# 1 T338I/L1065P 2 G85E/I507del# 3 F508del*/H139R 1 E585X/3272-26ARG} 2 G85E/R1162X# 3 F508del# /R1066C # 1 2183AARG/2789z5GRA 2 G85E/2183AARG 2 F508del# /G542X# 1 F508del# /711z5GRA 1 G85E/G85E 1 F508del# /712-1GRT 1 F508del# /D1152H} 1 G85E/E585X# 1 F508del# /621z1GRT 1 F508del# /1898z3ARG 1 G85E/711z1GRT# 1 F508del# /1898z1 1 F508del# /R347H} 1 G85E/712-1GRT# 1 Total 68 F508del# /2789z5GRA 1 G85E/621z1GRT# 1 2789z5GRA/? Login to comment

PMID: 16196493 [PubMed] Loo TW et al: "Rescue of DeltaF508 and other misprocessed CFTR mutants by a novel quinazoline compound."

No. Sentence Comment

26 Wild-type, ∆F508, H139R, G149R, R258G, S945L, and H949Y CFTR cDNAs were inserted into the pcDNA3 (Invitrogen, Oakville, ON) vector as described previously.13,14 Wild-type and mutant G268V P-gp cDNAs were inserted into the pMT21 vector (Genetics Institute) as described previously.15 Baby hamster kidney (BHK) cells stably expressing CFTR or P-gp were generated by cotransfection with cDNA and pWL-neo (Stratagene, Cedar Creek, TX). Login to comment
132 (C) BHK cells expressing misprocessed CFTR mutants H139R, G149R, R258G, S945L, H949Y, or wild-type CFTR were incubated for 48 h with (+) or without (-) 3 µM CFcor-325. Whole cell extracts were subjected to immunoblot analysis with a rabbit polyclonal antibody against CFTR. Login to comment
144 BHK cells expressing mutants H139R, G149R, and R258G in the first transmembrane domain (TMD1)30 or mutants S945L and H949Y in TMD213 were treated with or without 3 µM CFcor-325 for 48 h. Whole cell SDS extracts were then subjected to immunoblot analysis. Login to comment
146 By contrast, CFcor-325 had little effect on mutants H139R or G149R. Login to comment
183 These include the substituted benzo[c]- quinolizinium compounds,39 thapsigargin,40 and curcumin.41 Drug rescue of ∆F508 CFTR with benzo[c]quinolizinium compounds, however, requires concentrations that are about 100-fold higher (250-500 µM) than that needed for CFcor-325, while rescue with thapsigargin and curcumin could not be repeated by other investigators.25,42,43 A possible explanation for the observation that curcumin treatment increased cAMP-stimulated iodide efflux in BHK cells expressing ∆F508 CFTR41 was that the compound can directly stimulate CFTR channels that were already present at the cell surface.44 We were unable to induce maturation of misprocessed CFTR mutants that had the mutations H139R or G149R in the first intracellular loop. Login to comment
207 (44) Berger, A. L.; Randak, C. O.; Ostedgaard, L. S.; Karp, P. H.; Vermeer, D. W.; Welsh, M. J. Curcumin stimulates cystic fibrosis transmembrane conductance regulator Cl-channel activity. J. Biol. Chem. 2005, 280, 5221-5226. in the first cytoplasmic loop (H139R or G149R) prevents the establishment of these interactions. Login to comment
24 Wild-type, ∆F508, H139R, G149R, R258G, S945L, and H949Y CFTR cDNAs were inserted into the pcDNA3 (Invitrogen, Oakville, ON) vector as described previously.13,14 Wild-type and mutant G268V P-gp cDNAs were inserted into the pMT21 vector (Genetics Institute) as described previously.15 Baby hamster kidney (BHK) cells stably expressing CFTR or P-gp were generated by cotransfection with cDNA and pWL-neo (Stratagene, Cedar Creek, TX). Login to comment
130 (C) BHK cells expressing misprocessed CFTR mutants H139R, G149R, R258G, S945L, H949Y, or wild-type CFTR were incubated for 48 h with (+) or without (-) 3 µM CFcor-325. Whole cell extracts were subjected to immunoblot analysis with a rabbit polyclonal antibody against CFTR. Login to comment
142 BHK cells expressing mutants H139R, G149R, and R258G in the first transmembrane domain (TMD1)30 or mutants S945L and H949Y in TMD213 were treated with or without 3 µM CFcor-325 for 48 h. Whole cell SDS extracts were then subjected to immunoblot analysis. Login to comment
181 These include the substituted benzo[c]- quinolizinium compounds,39 thapsigargin,40 and curcumin.41 Drug rescue of ∆F508 CFTR with benzo[c]quinolizinium compounds, however, requires concentrations that are about 100-fold higher (250-500 µM) than that needed for CFcor-325, while rescue with thapsigargin and curcumin could not be repeated by other investigators.25,42,43 A possible explanation for the observation that curcumin treatment increased cAMP-stimulated iodide efflux in BHK cells expressing ∆F508 CFTR41 was that the compound can directly stimulate CFTR channels that were already present at the cell surface.44 We were unable to induce maturation of misprocessed CFTR mutants that had the mutations H139R or G149R in the first intracellular loop. Login to comment
205 (44) Berger, A. L.; Randak, C. O.; Ostedgaard, L. S.; Karp, P. H.; Vermeer, D. W.; Welsh, M. J. Curcumin stimulates cystic fibrosis transmembrane conductance regulator Cl- channel activity. J. Biol. Chem. 2005, 280, 5221-5226. in the first cytoplasmic loop (H139R or G149R) prevents the establishment of these interactions. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

PMID: 9305991 [PubMed] Seibert FS et al: "Disease-associated mutations in cytoplasmic loops 1 and 2 of cystic fibrosis transmembrane conductance regulator impede processing or opening of the channel."

No. Sentence Comment

107 The remaining amino acid substitutions significantly decreased the yield of band C, with relative amounts of "vector only" (background) < G149R-CFTR < H139R-CFTR < R258G-CFTR < D192G-CFTR , wild-type CFTR (Figure 2, bottom). Login to comment
120 In accordance with reduced levels of processing, the H139R, G149R, D192G, and R258G mutations significantly decreased the anion translocation capability of CFTR, whereas the properly processed I148T, I175V, and R297Q variants allowed iodide movement comparable to that of wild type. Login to comment
153 When reconstructed in heterologous expression systems, four of the amino acid substitutions (H139R, G149R, D192G, and R258G) inhibited maturation and transport of CFTR to the cell surface, so that the protein cannot carry out its regular functions at that location. Login to comment

PMID: 16635477 [PubMed] Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."

No. Sentence Comment

139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment

PMID: 23104983 [PubMed] He L et al: "Correctors of DeltaF508 CFTR restore global conformational maturation without thermally stabilizing the mutant protein."

No. Sentence Comment

181 B, C) HEK293 cells were transiently transfected with CFTR with misprocessing mutations located in CL1 (H139R), CL2 (R258G), and CL3 (S945L) (B), or in NBD1 (èc;I507 and R560T; C). Login to comment

PMID: 25304080 [PubMed] Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."

No. Sentence Comment

59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment