ABCC7 p.Ser42Phe
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 12007216
[PubMed]
Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."
No.
Sentence
Comment
111
Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Ser42Phe 12007216:111:186
status: NEW
PMID: 15084222
[PubMed]
D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."
No.
Sentence
Comment
55
These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b.
X
ABCC7 p.Ser42Phe 15084222:55:51
status: NEW89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency.
X
ABCC7 p.Ser42Phe 15084222:89:1470
status: NEW
PMID: 15536480
[PubMed]
Modiano G et al: "A large-scale study of the random variability of a coding sequence: a study on the CFTR gene."
No.
Sentence
Comment
33
In the Tajima`s test,19 the null hypothesis of neutrality is rejected if a statistically significant difference between p Common and rare nonsynonymous and synonymous cSNSs G Modiano et al European Journal of Human Genetics Table 1 List of the 61 cSNSsa encountered in the present survey The random samples of genes (and the technique utilized) cSNS variants found NE Italy (DGGE) Central Italy (DGGE) Southern France (DGGE) Northern France (DHPLC) Spain (SSCA) Czechia (DGGE) Hb  104 Exon Exon Length (bp) Ref. no. SNS SASc 1st 100d 2nd 500 1st 100d 2nde 1st 100d 2nd 500 1st 100 2nde 82d 72 Abs. Freq. Total sample size q  104 se  104 NSf Sf 1g 53 0 0 0 0 0/452 0 924 2 111 1 223C4T R31C 1 1 1/500 1 1 0 0/450 0 5 (11) 1 932 (2 432) 45.23 13.61 90 2 224G4T R31L 0 0 0/500 0 0 0 1/450 0 1 1 932 5.17 5.17 10 3 257C4T S42F 0 0 1/500 0 0 0 0/450 0 1 1 932 5.17 5.17 10 3 109 4 334A4G K68E 1 0 0 0/498 0 0 0 0/452 0 0 1 2 504 3.99 3.99 8 5 352C4T R74W 0 0 0 0/498 0 0 0 1/452 0 0 1 2 504 3.99 3.99 8 6 356G4A R75Q 1 7 1 7/498 2 9 2 9/452 0 2 40 (40) 2 504 (2 544) 157.23 24.66 310 7 386G4A G85E 0 0 1 1/498 0 0 0 0/452 0 0 2 2 504 7.99 5.65 16 4 216 8 482G4A R117H 0 0 0 0/292 0 2 0 1/456 0 0 3 2 302 13.03 7.52 26 9 528T4G I132M 0 0 0 0/292 0 0 0 1/456 0 0 1 2 302 4.34 4.34 8 10 575T4C I148T 1 2 0 1/292 0 0 0 1/456 0 1 6 2 302 26.06 10.63 52 5 90 11 640C4T R170C 0 0 0 0/6 0 0 1/448 0 1 1 436 6.96 6.96 14 12 641G4A R170H 1 1 0 0/6 0 0 2/448 0 4 (4) 1 436 (1 930) 20.73 10.35 41 6a 164 0 0 0/6 0 0 0/432 0 0 992 6b 126 0 0 0/6 0 0 0/454 0 942 7 247 0 0 0/6 0 0 0/796 0 1 284 8 93 13 1281G4A L383 0 0 0 0/6 0 0 1/456 0 0 1 1 516 6.60 6.60 13 9 183 14 1402G4A G424S 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 15 1459G4T D443Y 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 10 192 16 1540A4G M470Vh 42 197 30 37/96 39 199 (i) (i) 27 571(736) 1 484 (1 912) 3849.37 111.28 4 735 17 1598C4A S489X 0 0 0 0/96 0 0 0 1/796 0 1 2 374 4.21 4.21 8 18 1648A4G I506V 1 0 0 0/96 0 0 0 0/796 0 1 2 374 4.21 4.21 8 19 1655T4G F508C 0 1 0 0/96 0 0 0 1/796 0 2 2 038 8.42 5.96 17 20 1716G4A Q528 2 16 1 0/96 0 19 i I 5 43 (58) 1 478 (2 024) 286.56 37.08 557 11 95 21 1756G4T G542X 0 2 0 0/134 0 0 0/796 0 0 2 1 984 10.08 7.12 20 22 1764T4G G544 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 23 1784G4A G551D 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 12 87 24 1816G4A V562I 0 0 0 0 1 0 0/450 0 0 1 (1) 2 004 (2 504) 3.99 3.99 8 25 1816G4C V562L 0 0 0 1 0 0 1/450 0 0 2 (3) 2 004 (2 504) 11.98 6.91 24 26 1859G4C G576A 1 2 0 1 11 0 8/450 0 0 23 (27) 2 004 (2 538) 106.38 20.36 213 13 724j 449 27 1997G4A G622D 0 0 0/80 0/96 1 0 0 0/444 0 1 2 002 5.00 5.00 10 28 2082C4T F650 1 0 0/80 0/20 0 0 0 0/444 0 1 (1) 1 926 (2 412) 4.15 4.15 8 29 2134C4T R668C 1 2 0/80 0/96 1 11 0 12/444 0 27(32) 2 002 (2 558) 125.10 21.98 247 275 30 2377C4T L748 0 0 0/6 0 1 1 388 25.77 25.77 52 14a 129 31 2670G4A W846X 0 0 0/6 0 1 0/452 0/80 0 1 1 010 9.90 9.90 20 32 2694T4G T854 33 23 0/6 33 38 149/452 14/80 11 301 1 010 2980.20 143.92 4 184 33 2695G4A V855I 0 0 0/6 0 0 1/452 0/80 0 1 1 010 9.90 9.90 20 14b 38 0 0 0 0/520 0 0 0 0/446 0 2 448 15 251 34 2816G4C S895T 0 0 0/6 0 0 2/436 0 0 2 996 20.08 14.18 40 35 2831A4C N900T 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 36 2988G4C M952I 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 37 3030G4A T966 (2)k (1)k 0 6/436 0 6 (25)k 618 (1814)k 137.82 27.37 272 38 3032T4C L967S 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 16 80 0 0 0/498 0 0 0/450 0 0 1 502 17a 151 39 3123G4C L997F 0 2 2 1/494 0 7 1 4/454 0 0 17 2 502 67.95 16.42 135 40 3157G4A A1009T 0 2 0 0/494 0 0 0 0/454 0 0 2 2 502 7.99 5.65 16 41 3212T4C I1027T 1 0 0 0/494 0 0 0 0/454 0 0 1 2 502 4.00 4.00 8 17b 228 42 3286T4G F1052V 1 1 0 1/194 0 0 0 0/452 0 0 3 (3) 2 200 (2 240) 13.39 7.73 27 43 3337G4A G1069R 0 1 0 0/194 0 0 0 0/452 0 0 1 2 200 4.55 4.55 9 CommonandrarenonsynonymousandsynonymouscSNSs GModianoetal 186 EuropeanJournalofHumanGenetics 44 3345G4T Q1071H 0 0 0 0/194 0 1 0 0/452 0 0 1 2 200 4.55 4.55 9 45 3417A4T T1995 1 3 0 0/194 1 1 0 0/452 0 0 6 (8) 2 200 (2 506) 31.92 11.27 64 46 3419T4G L1096R 0 0 0 0/194 1 0 0 0/452 0 0 1 2 200 4.55 4.55 9 47 3477C4A T1115 0 0 0 0/194 0 0 0 1/452 0 0 1 2 200 4.55 4.55 9 18 101 48 3523A4G I1131V 0 0 1 0/10 0 0 0/448 0 0 1 (2) 1 512 (1 908) 10.48 7.07 21 49 3586G4C D1152H 0 0 0 0/10 0 0 1/448 0 0 1 1 512 6.61 6.61 13 19 249 50 3617G4T R1162L 0 0 1 1/494 0 0/260 0 0/454 0 0 2 2 262 8.84 6.25 18 51 3690A4G Q1186 0 0 0 0/494 0 0/260 0 0/454 1 0 1 2 262 4.42 4.42 9 52 3813A4G L1227 0 1 0 0/494 0 0/260 0 0/454 0 0 1 2 262 4.42 4.42 9 53 3837T4G S1235R 1 1 0 1/494 0 4/260 0 7/454 0 1 15 (15) 2 262 (2 310) 69.94 16.71 140 20 156 54 4002A4G P1290 2 3 0/6 3 5 18/454 3/80 2 36 1 012 357.73 58.22 690 21 90 55 4009G4A V1293I 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 56 4029A4G T1299 1 0 0/6 0 1/300 0 1/456 0 0 3 (8) 1 316 (2 330) 34.33 12.12 69 57 4041C4G N1303K 1 0 0/6 0 0/300 0 0/456 0 0 1 1 316 7.60 7.60 15 58 4085T4C V1318A 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 22 173 0 0 0/18 0 0 0/450 0 0 1 022 23 106 0 0 0 0/6 0 0 0/448 0 1 436 24l 198+3 59 4404C4T Y1424 1 0 0/6 1 2 5/420 0 2 11 (32) 980 (2 516) 127.19 22.34 251 60m 4521G4A Q1463 (21) (16) (3/32) (14/80) (30) (94/420) 15/76 (17) 15 (227) 76 (1052) 2142.86 131.07 3 367 61 4563T4C D1477 0 0 0/6 0 1 0/420 0 0 1 980 10.20 10.20 20 Totals 6 525 9 584 16 109 The bracketed figures include also the RFLP analysis data (see Materials and methods); the NE Italy, Central Italy, Southern and Northern France are each subdivided into two samples where the 1st is made up of 100 genes.
X
ABCC7 p.Ser42Phe 15536480:33:838
status: NEW
PMID: 16126774
[PubMed]
Morea A et al: "Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility."
No.
Sentence
Comment
76
This test involved nine subjects from the infertile group, revealing the occurrence of the following rare mutations: E217G, T1054A, W356X, D443Y and 3667insTC in males and L997F and R297Q in females and 29 subjects from the control, in which we found: A1009T, D110Y, E826K, G1069R, G1130A, G194V, I556V, L320F, M348K, M82V, P1290T, R117C, R352W, R74W, S42F, S660T, S911R, S912L, T1086A, T582S, V920L and Y89C.
X
ABCC7 p.Ser42Phe 16126774:76:355
status: NEW
PMID: 19885835
[PubMed]
McWilliams RR et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma."
No.
Sentence
Comment
95
S42F has been described in 1 Italian CF patient.25 E528E is a synonymous polymorphism involving the last base pair in exon 10 (1716 G > A), which has been reported to affect splicing, but has not been linked to severe pulmonary disease.26 S912L is thought to be a neutral variant (serine for a leucine), unless in cis position to another mutation.27 The F1052V missense mutation is a variant with a modest effect, with normal or near-normal sweat chloride tests in combination with other mild variants.28,29 N1088S is a novel mutation that substitutes asparagine for a serine amino acid, both positively charged, and its functionality is unclear.
X
ABCC7 p.Ser42Phe 19885835:95:0
status: NEW103 Compound Heterozygotes Among Pancreatic Cancer Cases CFTR Mutations Sex Age at Diagnosis, y Ever/Never Smoker Family History of Pancreatic Cancer Pancreatitis ‡3 Years Before Cancer Diagnosis df508/S42F M 70 Nonsmoker No No R117H/E528E (splice site) M 75 Smoker Yes No df508/S912L W 56 Smoker No No df508/N1088S W 73 Smoker No No df508/M1191I M 79 Smoker No No df508/S1235R M 73 Smoker No No df508/F1052V M 49 Smoker No No df508/5T M 60 Smoker No No Man indicates man; W, woman.
X
ABCC7 p.Ser42Phe 19885835:103:205
status: NEW
PMID: 19897426
[PubMed]
Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."
No.
Sentence
Comment
74
For many of these subjects mutations were identified following DGGE and/or dHPLC analysis, and not through the RDB-based test, as gene alterations are "rare"/uncommon [A238V, R352W, S42F, (V201M, D1270N & R74W) and L206W] or because they have never been identified before [D372E (1251T→G) and L1414S (4373T→C)].
X
ABCC7 p.Ser42Phe 19897426:74:182
status: NEW89 Mutations found in the homozygous (n=2) and heterozygous (n=20) diagnosed foetuses are the following: ΔF508/ΔF508 (n=1), 711+5G→A/711+5G→A (n=1), ΔF508/P5L (n=1), 2183AA→G/S42F (n=1), ΔF508/ D1445N (n=1), 711+5G→A/ΔF508 (n=1), G542X/E527G (n=1), N1303K/1717-1 G→A (n=1), R117H/E527G (n=1), ΔF508/2183AA→G (n=1), ΔF508/D1152H (n=1), R347H/ ΔF508 (n=1), ΔF508/G542X (n=2), ΔF508/N1303K (n=2), R1162X/ΔF508 (n=3), N1303K/D1152H (n=3).
X
ABCC7 p.Ser42Phe 19897426:89:211
status: NEW97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction.
X
ABCC7 p.Ser42Phe 19897426:97:881
status: NEW99 Notes to Tables: (A) CFTR mutations A238V, R352W, 4006-19del3, S42F, D372E (1251T→G), L1414S (4373T→C), (V201M, D1270N & R74W) and L206W are not included in the RDB-based screening.
X
ABCC7 p.Ser42Phe 19897426:99:63
status: NEW
PMID: 23276700
[PubMed]
Krenkova P et al: "Distribution of CFTR mutations in the Czech population: positive impact of integrated clinical and laboratory expertise, detection of novel/de novo alleles and relevance for related/derived populations."
No.
Sentence
Comment
48
[125CNT]+[223CNT] S42F/R75X# Ex2/Ex3 1 0.08 44. c.164+1GNA 296+1GNA In2 1 0.08 45. c.274GNA E92K# Ex4 1 0.08 46. c.349CNT R117C*# Ex4 1 0.08 47. c.509GNA R170H Ex5 1 0.08 48. c.533GNA G178E Ex5 1 0.08 49. c.579+1GNT 711+1GNT*# In5 1 0.08 50. c.902ANG Y301C Ex7 1 0.08 51. c.1040GNA R347H*# Ex7 1 0.08 52. c.1114CNT Q372X Ex7 1 0.08 53. c.1117-1GNA 1249-1GNA In7 1 0.08 54. c.1209+1GNA 1341+1GNA# In8 1 0.08 55. c.1519_1521delATC I507del*# Ex10 1 0.08 56. c.1654CNT Q552X# Ex11 1 0.08 57. c.1673TNC L558S# Ex11 1 0.08 58. c.1679+1GNC 1811+1GNC In11 1 0.08 59. c.1687TNC Y563H Ex12 1 0.08 60. c.1753GNT E585X# Ex12 1 0.08 61. c.1766+1GNC 1898+1GNC In12 1 0.08 62. c.2044delA 2176delA Ex13 1 0.08 63. c.2051_2052delAAinsG 2183delAANG# Ex13 1 0.08 64. c.2052delA 2184delA*# Ex13 1 0.08 3.
X
ABCC7 p.Ser42Phe 23276700:48:18
status: NEW
PMID: 25869325
[PubMed]
Chang MC et al: "Cystic fibrosis transmembrane conductance regulator gene variants are associated with autoimmune pancreatitis and slow response to steroid treatment."
No.
Sentence
Comment
8
Results: A total of 28.1% (25/89) of the AIP patients carried 26 CFTR variants, including nine with I556V, seven with 5T, four with S42F, two with I125T, and one each with R31C, R553X, S895N, and G1069R.
X
ABCC7 p.Ser42Phe 25869325:8:132
status: NEW112 The identified variants included I556V in nine patients, 5T in seven, S42F in four, I125T in two, and R31C, R553X, S895N, and G1069R each in one patient (Table 1).
X
ABCC7 p.Ser42Phe 25869325:112:70
status: NEW140 AIP (n = 89) CFTR variants n = 26 % in AIP % with variant I556V 9 10.1% 34.6% 5 T 7 7.9% 26.9% S42F 4 4.5% 15.4% I125T 2 2.2% 7.7% R31C 1 1.1% 3.8% R553X 1 1.1% 3.8% S895T 1 1.1% 3.8% G1069R 1 1.1% 3.8% Table 2 Comparison of patients with and without CFTR variants in 89 patients with autoimmune pancreatitis.
X
ABCC7 p.Ser42Phe 25869325:140:95
status: NEW149 The most common CFTR variant in AIP patients was I556V (34.6%), followed by the T5 allele in intron 8 (26.9%) and S42F (15.4%).
X
ABCC7 p.Ser42Phe 25869325:149:114
status: NEW151 The S42F mutation was not detected in ICP and HLP patients in our previous studies [19,20].
X
ABCC7 p.Ser42Phe 25869325:151:4
status: NEW
PMID: 25910067
[PubMed]
Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."
No.
Sentence
Comment
54
[1117-8A>G;1727G>C; 2002C>T]) and mutations G1069R (p.Gly1069Arg), D614G (p.Asp614Gly), S42F (p.Ser42Phe) and S912L (p.Ser912Leu) should also be considered as part of this extension, even if not found in CF-PI but studied up to the DEL step because they are found in genotypes with an unknown allele.
X
ABCC7 p.Ser42Phe 25910067:54:88
status: NEWX
ABCC7 p.Ser42Phe 25910067:54:96
status: NEW363 [72G>C;164+2T>G] uncertain: CF-PI and/or CF-PS L24F nd; 296+2T>G nd R31C c.91C>T CFTR-RD non CF-causing p.Arg31Cys S42F c.125C>T uncertain: found only with an unknown allele in trans nd p.Ser42Phe E56G c.167G>A CBAVD nd p.Glu56Lys [R74W;V201M;D1270N] c.
X
ABCC7 p.Ser42Phe 25910067:363:115
status: NEWX
ABCC7 p.Ser42Phe 25910067:363:188
status: NEW