ABCC7 p.Cys276*

[switch to full view]
Comments [show]
Publications
PMID: 12007216 [PubMed] Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Cys276* 12007216:109:269
status: NEW
Login to comment

PMID: 15358638 [PubMed] Zaman MM et al: "Interleukin 8 secretion from monocytes of subjects heterozygous for the deltaF508 cystic fibrosis transmembrane conductance regulator gene mutation is altered."
No. Sentence Comment
49 Although the majority of CF subjects were homozygous for ⌬F508, mutations on the other allele (compound heterozygotes) included 621 ϩ 1G-T, N1303K, C276X, W1282X, and 1717-1GϾA.
X
ABCC7 p.Cys276* 15358638:49:161
status: NEW
Login to comment

PMID: 15705796 [PubMed] O'Sullivan BP et al: "Platelet activation in cystic fibrosis."
No. Sentence Comment
44 Clinical characteristics of cystic fibrosis patients Patient Age, y Vitamin E, mg/L* FEV1, % predicted† Inpatient or outpatient‡ Genotype Platelet studies§ 1 20 6.6 25 In ␦F508/unk A 2 20 3.6 70 In ␦F508/G542X A 3 11 16.8 92 Out ␦F508/dF508 A 4 16 5.4 101 Out ␦F508/G542X A 5 9 3.9 124 Out ␦F508/dF508 A,F 6 6 5.1 118 Out ␦F508/dF508 A,F 7 13 8.1 119 Out ␦F508/dF508 A,F 8 10 9.7 104 Out ␦F508/dF508 A,F 9 22 9.0 58 In ␦F508/dF508 A 10 19 8.0 57 Out ␦F508/N1303K A 11 17 7.0 24 Out ␦F508/dF508 A,D,E 12 20 3.2 55 Out ␦F508/dF508 A,D 13 15 5.8 41 In ␦F508/dF508 A,D,E 14 26 12.7 88 Out ␦F508/dF508 A,D 15 11 16.3 72 Out ␦F508/W1282X A,D 16 18 10.0 58 In ␦F508/dF508 A,D 17 22 10.5 50 Out ␦F508/dF508 A,D 18 35 8.6 87 Out ␦F508/C276X A,E 19 17 16.2 62 In ␦F508/dF508 B,E 20 14 4.1 85 In ␦F508/dF508 B 21 22 2.3 62 In ␦F508/G542X B 22 21 7.7 54 In ␦F508/N1303K B 23 19 2.4 69 In ␦F508/Y1092X B 24 19 4.6 87 In ␦F508/dF508 B, C, E 25 21 8.2 58 In R334W/unk C 26 22 5.8 85 In ␦F508/dF508 C,E 27 22 2.9 67 In unk/unk C 28 20 6.7 77 In ␦F508/dF508 E 29 18 13.3 92 In ␦F508/dF508 E 30 22 8.8 71 In ␦F508/394delTT E 31 15 13.0 68 In ␦F508/dF508 E 32 14 unk 97 Out ␦F508/dF508 E unk indicates unknown.
X
ABCC7 p.Cys276* 15705796:44:871
status: NEW
Login to comment

PMID: 10228103 [PubMed] Jorissen MB et al: "Genotype-phenotype correlations for the paranasal sinuses in cystic fibrosis."
No. Sentence Comment
120 of Patients in Surgical Group ⌬F508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations ⌬F508 171 75.7 27 Non-⌬F508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,† ) A455E (1) G542X (4,‡ ) G551D (1) R553X (1) G628R(G→C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G→A (3,† ) 1898ϩ1G→C (1) 2183AA-G (3,†† ) 3659delC (2) 3272-26A→G (2,† ) 4218-insT (2) unknown (11,‡ ) * The genotype and mutations are given for the 113 patients with CF.
X
ABCC7 p.Cys276* 10228103:120:195
status: NEW
Login to comment

121 of Patients in Surgical Group DF508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations DF508 171 75.7 27 Non-DF508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,ߤ ) A455E (1) G542X (4,ߥ ) G551D (1) R553X (1) G628R(G࢐C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G࢐A (3,ߤ ) 189811G࢐C (1) 2183AA-G (3,ߤߤ ) 3659delC (2) 3272-26A࢐G (2,ߤ ) 4218-insT (2) unknown (11,ߥ ) * The genotype and mutations are given for the 113 patients with CF.
X
ABCC7 p.Cys276* 10228103:121:174
status: NEW
Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."
No. Sentence Comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L .
X
ABCC7 p.Cys276* 25910067:368:812
status: NEW
Login to comment